Final Technical Report

Food Standard Agency Project Q01099

Extending the Fish Species Lab-on-a-Chip Capillary Electrophoresis PCR-RFLP Database

Steve Garrett, John Dooley, Marie-Anne Clarke & Helen M. Brown. Department of Chemistry & Biochemistry Campden BRI Gloucestershire, GL55 6LD

Executive Summary

Food fraud is a significant problem which affects both the industry and consumer. Manufacturers have to ensure the authenticity of food ingredients to enable compliance with food safety and labelling regulations. If they are found to be supplying incorrectly labelled products they run the risk of prosecution, damage to brand image and incur substantial financial penalties.

As part of a programme to develop analytical procedures suitable for use by local authority food enforcement laboratories, the Food Standards Agency has supported the development of a number of DNA based food authenticity tests which use the Agilent 2100 Bioanalyzer, a lab-on-a-chip capillary electrophoresis (CE) end-point detection system. It is a relatively low-cost, user-friendly system, which is suitable for uptake by laboratories that do not have extensive facilities and expertise in DNA analysis.

A lab-on-a-chip CE DNA profiling approach for fish species identification was originally developed and evaluated in FSA project Q010697. The method used Polymerase Chain Reaction (PCR) amplification of a 464bp region of mitochondrial target in the cytochrome b (cyt b) gene and three restriction enzyme digests to produce species specific DNA profiles.

The main objective of this follow up project Q01099 was to extend the range of species covered in the cyt b 464 bp PCR-RFLP (Restriction Fragment Length Polymorphism) profiles database. This was initially carried out by obtaining authentic fish species and generating cyt b DNA sequence data experimentally. However, during the course of the project, sequence data was also obtained from the ‘Fish Trace’ project. This collaborative study funded by the European Commission generated cyt b gene sequence information on thousands of authentic fish samples from different catch locations in Europe, covering approximately 200 different species.

Following retrieval of the Fish Trace cyt b sequences, a large database of theoretical PCR-RFLP profiles was constructed using in-house bioinformatics approaches. The database contained the PCR-RFLP profiles for the three restriction endonucleases, Dde I, Hae III and Nla III, identified in project Q01069 as the most appropriate for the discrimination of fish species.

Approximately 30 of the 200 Fish Trace species exhibited intra-species profile variability. In these species an altered DNA sequence either led to a further enzyme cutting site or loss of a cutting site. For these species, only one of the three enzyme profiles was affected. Some of the variations in profile appeared to be linked to the catch location of the fish samples but the extensive study of the fish populations and profiles differences were not the focus of this work.

In some instances closely related species gave the same profiles for the three enzymes. For example, Yellowfin tuna and Bigeye tuna gave the same profile. Therefore the use of other restriction enzymes in addition to Dde I, Hae III, Nla III would be required to enable species identification in such instances.

The Fish Trace database was then challenged with experimental data derived from 35 authentic and commercial fish samples. The lab-on-a-chip CE system produced DNA fragments that were consistent with the theoretical profiles, although there was an overestimation of the sizes with the Series II DNA 1000 lab chip kit. The original DNA 500 lab chip kit used in Q01069 produced PCR-RFLP

DNA fragment sizes that were closer to the theoretical sizes, however these kits have been replaced by the Series II DNA 1000 lab chip kit in 2006.

A further objective for this project was the development of alternative PCR-RFLP profile approaches for canned salmon and tuna. The 464 cyt b target was too large to be amplified from canned products due to difficulties in amplification from highly degraded DNA, so alternative smaller cyt b targets were chosen.

For salmon, a 168 bp target was identified by comparison of a number of salmon species cyt b sequences. Two restriction enzymes, Bfa I and Dde I, allowed discrimination of Coho, Chum, Pink, Red and Chinook salmon species. These five species are found in the Pacific Ocean and are associated with commercial products. A PCR-RFLP assay developed was successfully applied to canned materials.

For canned tuna, an existing published PCR-RFLP assay15 was evaluated for use on the lab-on-a-chip CE system. The method used a 176 bp cyt b amplicon and three enzymes, MboI, Bsi YI and MnlI, to discriminate Albacore, Yellowfin tuna, Bigeye, Bluefin and Skipjack tuna species. In a blind study, all the unknown canned tuna samples were identified correctly by the analyst.

Some work was carried out to determine the feasibility of applying a published method18 for discriminating between King and Queen scallops to the lab-on-a-chip CE system. These are the two most common scallop species available to the UK consumer, with the King being the higher quality and more expensive of the two. The method used amplification of an ITS2 region (an internal transcribed spacer region which flanks the 5.8S ribosomal RNA gene) followed by digestion with the enzyme Nla III. Although the method was successfully applied for lab-on-a-chip analysis, there was a lack of available authentic samples to fully validate the method.

The final objective involved testing the feasibility of using the cytochrome oxidase I (COI) gene as an alternative target for PCR-RFLP identification of fish species. This is the target sequence used by an international collaboration in molecular taxonomy to enable the 'barcoding' of all living organisms (http://www.dnabarcodes.org/). The 'barcoding ' PCR primers were applied to DNA from over 30 fish species and the resulting PCR products were sequenced. Unlike the 464 cyt b target, different COI primer combinations had to be used in order to achieve amplification for all species. Also, the size of the COI target sequence was approximately 700bp, making it considerably larger than the 464bp cyt b target and less amplifiable from processed fish products. Theoretical COI PCR-RFLP profiles were produced for all the species again using the enzymes DdeI, Hae III and Nla III. Unique profiles were produced for 29 species. The COI PCR-RFLP would make an appropriate alternative target if the amplicon size could be reduced and a single set of primers could be developed.

GLOSSARY ...... 7 1 INTRODUCTION ...... 9

1.1 FISH SPECIES IDENTIFICATION USING CYTOCHROME B PCR-RFLP ...... 9

1.2 BENEFITS OF LAB-ON-A-CHIP CE ...... 9

1.3 PCR-RFLP AND SEQUENCE DATABASES...... 10

1.4 SMALL AMPLICONS FOR CANNED FISH SPECIES IDENTIFICATION...... 10

1.5 OTHER SEAFOOD IDENTIFICATION ...... 11

2 MATERIALS AND METHODS ...... 12

2.1 SEAFOOD MATERIALS ...... 12

2.1.1 Authentic fish samples ...... 12

2.1.2 Additional commercial fish samples ...... 14

2.2 EXTRACTION OF DNA FROM FISH MATERIALS ...... 14

2.2.1 CTAB DNA extraction method ...... 15

2.2.2 Promega’s Maxwell™ 16 DNA extraction robot ...... 15

2.3 DNA ANALYSIS ...... 15

2.3.1 DNA amplification ...... 15

2.3.1.1 464bp cyt b amplicon (general fish) ...... 15

2.3.1.2 168bp cyt b amplicon (canned salmon) ...... 15

2.3.1.3 176bp cyt b amplicon (canned tuna) ...... 16

2.3.1.4 ITS-2 amplicon (scallop ) ...... 16

2.3.1.5 700bp cytochrome oxidase I (COI) amplicon ...... 16

2.3.2 Conventional gel electrophoresis ...... 17

2.3.3 Capillary electrophoresis using the Agilent 2100 Bioanalyzer for PCR product detection and PCR-RFLP profiling ...... 17

2.3.4 Restriction digestion ...... 17

2.3.5 DNA sequencing ...... 18

2.3.6 Generation of consensus sequence ...... 18

2.4 GENERATION OF THEORETICAL PCR-RFLP PROFILES USING DNA SEQUENCE DATA FROM THE FISHTRACE DATABASE ...... 18

2.4.1 Recovery of DNA sequence information from the Fish Trace database: ...... 18

2.4.2 FishTracer.pl for recovering large numbers of fish DNA sequences: ...... 18

2.4.3 Direct recovery of individual fish samples: ...... 19

2.4.4 DNA digests to generate theoretical PCR-RFLP profiles...... 19

2.4.5 Theoretical PCR-RFLP profiling using RestDigest.pl ...... 19

2.4.6 Theoretical PCR-RFLP profiling using AnnHyb...... 19

3 RESULTS & DISCUSSION ...... 21

3.1 FURTHER DEVELOPMENT OF 464BP CYT B PCR-RFLP PROFILES DATABASE ...... 21

3.1.1 Comparison of Series II DNA 1000 chip and DNA 500 PCR-RFLP profiles...... 21

3.1.2 Development of theoretical cyt b PCR-RFLP profiles from sequence data generated by CCFRA ...... 23

3.1.3 Classification of samples using Fish Trace data ...... 25

3.1.3.1 FishTracer.pl for recovering large numbers of fish DNA sequences ...... 26

3.1.3.2 Recovery of small (<5) numbers of fish samples: ...... 26

3.1.3.3 Generation of theoretical PCR-RFLP profiles using restdigest.pl...... 26

3.1.3.4 Generation of theoretical PCR-RFLP profiles using AnnHyb ...... 26

3.1.3.5 Generation of PCR-RFLP profile database for 464bp Amplicon...... 27

3.1.4 Theoretical tuna species 464bp cytochrome b PCR-RFLP profiles derived using GenBank sequence data ...... 28

3.2 DEVELOPMENT OF A LAB-ON-A-CHIP CE METHOD FOR CANNED SALMON ...... 30

3.2.1 Sequence comparison and identification of restriction enzymes for use in PCR-RFLP ...... 30

3.2.2 Application of the salmon cyt b PCR-RFLP assay to reference material ...... 30

3.2.3 Application of the salmon cyt b PCR-RFLP assay to canned salmon materials...... 31

3.3 DEVELOPMENT OF A LAB-ON-A-CHIP CE PCR-RFLP METHOD FOR CANNED TUNA ...... 33

3.3.1 Application of the published tuna cyt b PCR-RFLP assay to reference material ...... 33

3.3.2 Validation of tuna PCR-RFLP method on commercial products ...... 34

3.4 EVALUATION OF PCR-RFLP APPROACH FOR KING AND QUEEN SCALLOP DIFFERENTIATION ...... 37

3.5 EVALUATION OF THE USE OF THE CYTOCHROME OXIDASE SUB-UNIT (COI) BARCODING AMPLICON AS A SECONDARY PCR-RFLP TARGET ...... 39

3.5.1 Production of COI sequence data from authentic fish materials ...... 39

3.5.2 Development of theoretical COI PCR-RFLP profiles ...... 39

4 ACKNOWLEDGEMENTS ...... 42 5 REFERENCES ...... 43 6 FIGURES ...... 45 7 APPENDIX ...... 60

Glossary

2100 Bioanalyzer : A small-scale capillary electrophoresis system using lab-on-a-chip technology and microfluidics for the specific separation of DNA or protein fragments.

ATP : Adenosine triphosphate, cellular energy source.

Capillary electrophoresis (CE) : A method of DNA fragment separation using small diameter capillary tubes. Fragments are separated based on size and charge and are detected using a variety of methods, in this case laser-induced fluorescence (LIF).

Copy number : The number of copies of a gene per cell. Some genes are multi-copy, i.e. there is more than one copy on the genome. Mitochondrial genes are multi-copy by virtue of the fact that most cells contain several hundred mitochondria.

Cytochrome b (cyt b) : A mitochondrial gene widely used for species identification and population studies.

DNA : Deoxyribonucleic acid. A molecule that contains the genetic codes used in the development and function of all living organisms and viruses. dNTP : Deoxynucleotide-triphosphate. The base units of DNA.

Fluorescent Units (FU) : A measure of fluorescent intensity used by the 2100 Bioanalyzer.

Gel electrophoresis : A method used to separate proteins or DNA fragments on acrylamide or agarose gel matrices. Fragments migrate on the basis of size and charge when an electric current is applied. The gel matrix acts as a sieve to separate the fragments based on size.

Gene : An ordered series of bases which code for a specific protein.

Genome : The total DNA content of an individual or organelle.

LabChip : Small (3cm2), disposable, single-use plastic and glass units containing etched capillaries attached directly to twelve sample loading wells. DNA fragments up to 1000bp can be separated on the chip by the 2100 Bioanalyzer. Currently the Series II LabChips are in use.

Mitochondria/mitochondrion : Intercellular bodies found in most cells. Each mitochondrion contains its own genome.

PCR : Polymerase Chain Reaction – a method of amplifying a specific gene or region of DNA to produce millions of copies.

PCR-RFLP : A combination of PCR and RFLP analysis used to generate simplified ‘fingerprints’ useful for the identification of organisms at the species level or above.

Primer : A short oligonucleotide designed to anneal to specific regions of DNA in order to facilitate the PCR. Primers are designed to complement regions of DNA bounding the gene of interest.

Primer dimer : is a potential by-product in PCR consisting of primer molecules that have annealed to each other because of strings of complementary bases in the primers

Restriction enzyme : Natural bacterial enzymes used to cleave DNA molecules at specific positions (recognition sites), e.g. EcoRI site is GAATTC. These enzymes are widely used by molecular biologists to generate RFLP fingerprints.

Restriction Fragment Length Polymorphisms (RFLP) : A type of DNA fingerprint generated by cleaving larger DNA fragments into a series of smaller fragments. Generally fragments are resolved by gel electrophoresis. This method is useful for the identification of organisms at species level or above.

RNA : Ribonucleic acid. A single stranded structure that forms the link between expression of DNA and the formation of proteins. mRNA : Messenger RNA. A form of RNA that is used to transfer genetic information from the nucleus to the outer matrix of the cell for the purpose of protein synthesis.

Taq polymerase : A specific, heat-stable DNA polymerase used to replicate DNA targets during PCR. tRNAGlu: Transfer RNA , a small RNA molecule that links an amino acid (in this case glutamic acid) to its mRNA codon.

1 Introduction

1.1 Fish species identification using cytochrome b PCR-RFLP

The introduction of the Fish Labelling Regulations in 2003 (and as amended thereafter) stipulated that certain fish and aquaculture products must be labelled with the commercial designation of the fish species it contains. There is therefore a need for a method to verify fish species in order to ensure compliance with this legislation.

Determination of fish species present in fresh and processed products can be achieved by the use of DNA amplification and detection techniques. Several approaches have been developed using the polymerase chain reaction (PCR), but direct sequence analysis of an amplified common gene target or restriction fragment length polymorphism (RFLP) is the most common technique. Sequencing of the DNA fragments is the "gold standard" approach however it requires expensive equipment and skilled operators, whereas PCR-RFLP is considered to be a more cost effective and less demanding approach, thus more suitable for use by public analyst laboratories.

Although other gene targets have been studied, the mitochondrial cytochrome b (cyt b) gene is the most common target for PCR-RFLP analysis. An amplicon, approximately 464bp long, with a primer pair positioned on the tRNAGlu and the cyt b gene, was used to develop PCR-RFLP profiles for sturgeon1, salmon2, gadoid3, flatfish4 species and other species5. A collaborative trial was performed amongst European laboratories and the results obtained established that the method was suitable for identification of species and detecting mixtures of species within products6.

In Food Standards Agency project Q01069 this PCR-RFLP approach was combined with lab-on-a-chip capillary electrophoresis on the Agilent 2100 Bioanalyzer to enable simple and reliable detection of salmon and white fish species7,8. Following a successful trial of the method amongst analytical laboratories, the lab-on-a-chip 464bp cyt b PCR-RFLP species identification approach was considered to be suitable method for uptake by enforcement laboratories9.

1.2 Benefits of Lab-on-a-chip CE

Lab-on-a-chip capillary electrophoresis (CE) offers distinct advantages for DNA profiling. The CE chips deliver highly reproducible profiles using significantly less sample and are less labour intensive when compared to traditional methods.

One key aspect of the Bioanalyzer is the reproducibility of profile patterns; little variation in fragment sizes is observed between analyses on the same sample or even between similar samples analysed on different instruments. This enables a species to be identified using a database of PCR- RFLP profiles, thus reducing the need to analyse authentic species controls at the same time.

In the FSA project Q01069, the DNA 500 CE chip kits were used to generate the PCR-RFLP profiles. They produced experimental profiles that were a good match to the theoretical profiles and there appeared to be little batch to batch variation, even with changes to instruments, driver software and disposable equipment. The DNA 500 chips have now been discontinued by the manufacturer. A replacement chip kit, Series II DNA 1000 has been used in this project. It uses the same chip

platform but offers a wider sizing range covering 15bp to 1500bp. There are some slight sizing differences between the two kits.

1.3 PCR-RFLP and sequence databases

In FSA project Q01069 authentic samples from a limited range of species were obtained. The 464bp cyt b amplicon was sequenced and theoretical PCR-RFLP profiles for three enzymes, DdeI, HaeIII and NlaIII, were produced. Experimental profiles were then compared to the theoretical ones and a PCR- RFLP profiles database was produced.

Exploitation of existing fish species sequence databases is a good way of expanding the application of the method. Such databases allow for the rapid production of authentic theoretical PCR-RFLP data for a wider range of species.

There are many publicly available fish sequence databases, including:

 FishTrace10, the European Commission (EC) funded the development of a sequence database for the cyt b gene. This database covers thousands of specimens from about 200 species from different catch locations in the Mediterranean, North Sea and Atlantic Ocean. Each sequence can be traced back to a voucher specimen deposited in one of several natural history museums.

 Seafood plus11, another EC funded project, contains mitochondrial sequence data including some cyt b sequences.

 Mito fish12 , a mitochondrial genome database for fish compiled from various sources.

 Barcode of Life's Fishbol13, a significant resource currently covering over 4,000 fish species. This database contains the sequences of a mitochondrial target, namely the cytochrome oxidase sub-unit 1 (COI) gene.

 Genebank14 , also a useful resource for fish gene sequences; however, this database contains the sequences of many different genes and the material sequenced may not be traceable.

The primary objective of project Q01099 was to obtain cyt b sequence data for a wide range of fish species and better develop theoretical PCR-RFLP profiles. The use of COI sequences as an alternative to cyt b was also investigated.

1.4 Small amplicons for canned fish species identification.

Although the 464bp cyt b target is suitable for analysis of the majority of fish products the target is too large for successful amplification from canned fish. The retorting process, used for canning fish, degrades DNA significantly and any DNA that is extracted is often less than 200bp. The difficulty for the PCR-RFLP approach is that the DNA digest fragments are either too small or too close in size to be resolved.

Canned salmon and tuna fish are common products in the UK, so PCR-RFLP methods that can identify the species would be useful for enforcement purposes. Although canned fish products are not covered by the Fish Labelling Regulations, any species labelling must not be misleading to the consumer, as outlined in the Food Labelling Regulations, 1996, as amended. There are several published approaches for verifying the species of canned tuna fish; however, there are none for canned salmon. Quinteiro et al.15 developed a PCR-RFLP method employing a 176 bp cyt b target and restriction enzymes (BsiYI, MboI and MnlI) to differentiate between six tuna species. This target can be amplified from canned samples and the use of the three enzyme system enables easy transfer onto the 2100 Bioanalyzer platform. A recent approach by Wen-Feng Lin & Deng-Fwu Hang16 used a set of two primer pairs to target 126bp and 146 bp regions of the cyt b gene and five restriction digests to enable identification of eight species of canned tuna.

There are no PCR-RFLP methods for the detection and identification of canned salmon species. However, there are PCR and sequencing approaches for the study of ancient salmon materials where DNA is highly degraded. Yang et al. 17 used small mitochondrial target sequences (<200bp) to identify salmon bone materials dating back 2000-7000 years.

The approach by Quinteiro et al.15 to identify species of tuna and a novel salmon PCR-RFLP method for application to canned products were investigated in this project.

1.5 Other seafood identification

The Fish Labelling Regulations, 2003, as amended includes the species labelling of molluscs and crustacea. However, the 464bp cyt b target used for vertebrate fish species PCR-RFLP is not suitable for molluscs and crustacea so other approaches must be adopted. One common approach has been to target a nuclear ribosomal DNA region spanning the 5.8S ribosomal RNA gene and the two internal transcribed spacers, ITS-1 and ITS-2. This region has been specifically targeted for bivalve molluscs such as scallops (Lopez-Pinon et al, 200218) and was explored in this project as a possible method for authentication of scallops.

2 Materials and Methods

All chemicals used for this work, unless otherwise stated, were supplied by Sigma-Aldrich (Poole, Dorset, UK) and were of molecular biology grade or equivalent. Primers for PCR were supplied by MWG-Biotech UK Ltd (Ebersberg, Germany) and were of high-pure salt-free (HPSF) grade. PCR amplification was performed using either a PE9600 or ABI9800 PCR machine (Applied Biosystems, Warrington, Cheshire, UK). PCR-RFLP profiles were generated using Series II DNA1000 LabChips and the Agilent 2100 Bioanalyzer (Agilent Technologies UK Ltd, Stockport, Cheshire, UK). All DNA sequencing was performed by Lark Technologies (Takeley, Essex, UK) using the BigDye Terminator protocol (Applied Biosystems).

2.1 Seafood materials

2.1.1 Authentic fish samples Authentic samples (between 1-5) from each fish species were obtained from various sources. Samples provided were either (i) whole frozen fish, (ii) portions of fish-meat either frozen or preserved in 99-100% ethanol or (iii) canned fish. Samples were provided with written confirmation detailing the authenticity of the species. All samples apart from the canned were frozen upon receipt. Details of samples and sources are shown in Table 1.

Table 1: Details of authentic fish materials specifically obtained for this project. Common name Latin name Source

Sardine Sardina pilchardus CEFAS Ling Molva molva CEFAS Pollock Pollachius pollachius CEFAS Anglerfish Lophius piscatorius CEFAS Sea bass Dicentrarchus labrax CEFAS Black sea-bream Spondyliosoma cantharus CEFAS Red mullet Mullus surmuletus CEFAS Witch Glyptocephalus cynoglossus CEFAS Lemon sole Microstomus kitt CEFAS Dover sole Solea solea CEFAS Turbot Psetta maxima Billingsgate Market Flounder Platichthys flesus Billingsgate Market Bonito Sarda sarda Billingsgate Market Rainbow Trout Onchorynchus mykiss Billingsgate Market Herring Clupea harengus Billingsgate Market Yellow tailed snapper Chrysurus ocyurus Billingsgate Market Thread fin Nemipterus delagoae Billingsgate Market Emperor Lethrinus spp Billingsgate Market Albacore tuna Thunnus alalunga Instituto de Investigaciones Marinas Yellowfin tuna Thunnus albacares Instituto de Investigaciones Marinas Bigeye tuna Thunnus obesus Instituto de Investigaciones Marinas Skipjack tuna Katsuwonus pelamis Instituto de Investigaciones Marinas Bigeye tuna Thunnus obesus AZTI Blackfin tuna Thunnus atlanticus AZTI Northern bluefin tuna Thunnus thynnus AZTI Chum (or Keta, Dog) Wild Pacific Oncorhynchus keta John West Salmon (canned) Sockeye (or Red) Wild Pacific Salmon Oncorhynchus nerka John West (canned) Pink (or Humpy) Wild Pacific Salmon Oncorhynchus garbuscha John West (canned) Chinook (or King, Spring, Tyee) Wild Oncorhynchus tswawytscha John West Pacific Salmon (canned) Coho (or Silver, Medium Red) Wild Oncorhynchus kisutch John West Pacific Salmon (canned) CEFAS : The Centre for Environment Fisheries and Aquaculture Science, Lowestoft UK.Instituto de Investigaciones Marinas, C/Eduardo Cabello 6, 36208Vigo, Spain

AZTI - Tecnalia / Unidad de Investigación Alimentaria Txatxarramendi Ugartea z/g 48395 Sukarrieta (Bizkaia), Spain

John West Foods North American Technical Department 20730 72nd Avenue South Kent Washington, USA.

Other authentic materials (whitefish and salmon species) used were obtained for FSA project Q01069. Details are found in that final report7.

2.1.2 Additional commercial fish samples Additional fish materials (fresh, frozen or canned) were obtained from local fishmongers and retailers. Fresh and frozen samples were stored frozen and canned materials were stored chilled or at ambient temperature. Details of samples are found in Table 2.

Table 2: Details of other materials specifically obtained for this project.

Non-Authenticated Commercial Frozen or Fresh Fish products

Rainbow trout Black halibut Halibut

Brown trout Red snapper Grey mullet

Swordfish steaks John Dory Gilthead bream

Skate wing Brill Dab

Witch Megrim Tusk

Non-Authenticated Canned Materials

Wild pink salmon Wild red salmon Medium red salmon

Tuna chunks in brine Yellowfin tuna in spring water Tuna steaks in brine

Skipjack tuna steaks in brine Albacore tuna in brine Tuna fillets in olive oil

Non-Authenticated Commercial Scallop products

King scallops Queen scallops Patagonian scallops

2.2 Extraction of DNA from fish materials A reliable DNA extraction method is vital to the success of any detection method; however, it is known that extraction of good quality DNA from processed products is more difficult than extraction from raw materials as the DNA is degraded during the processing stages. In addition, manual methods of DNA extraction can be time consuming and lead to bottlenecks during sample analysis. Two approaches for DNA extraction (a CTAB based method and an automated DNA extraction robot using magnetic-bead based technologies) were used in this study. The latter method was used on fresh and frozen material where possible in order to save time.

The CTAB method is routinely used by many labs for the extraction of DNA from different samples. FSA sponsored project (Q0108420) confirmed that the CTAB method was suited to DNA extraction from raw and processed meat products. Recently, DNA extraction kits, including those based on magnetic bead technologies, have been developed with the aim of extracting DNA from difficult matrices including foods. Magnetic bead based methods have the advantage that they can be adapted for use with robotic extraction techniques for processing of larger sample numbers.

2.2.1 CTAB DNA extraction method Samples (2g) were suspended in 5ml of CTAB buffer (2% CTAB [hexadecyltrimethylammonium bromide], 100mM Tris-HCl, 20mM EDTA, 1.4M NaCl, pH 8.0) and 40µl of Proteinase K solution (20mg/ml) was added. Samples were vortexed vigorously and then incubated overnight at 60ºC. After incubation, 1ml of supernatant was removed to a 2.0ml Eppendorf tube, cooled to room temperature and centrifuged at 13,000g for 10 minutes using a microcentrifuge. The clear supernatant was recovered and an equal volume of chloroform added. The solution was vortexed vigorously and then centrifuged at 16,000g for 15 minutes before the upper aqueous layer was removed to a clean 1.5ml Eppendorf tube. An equal volume of 99.5% isopropanol was added and the DNA precipitated at room temperature for 30 minutes. DNA was pelleted by centrifugation at 16,000g for 15 minutes, washed in 70% ethanol and air dried for 30 minutes at room temperature. The DNA pellet was resuspended in 100µl of ultrapure water and purified using Promega’s Wizard® Purification Resin as per the manufacturer’s protocol. DNA extracts were recovered in 50µl of 1xTE buffer (10mM Tris-HCl, pH 7.4, 1mM EDTA, pH 8.0). Final DNA concentrations (ng/µl) were determined using a GeneQuant pro DNA calculator (Pharmacia).

2.2.2 Promega’s Maxwell™ 16 DNA extraction robot DNA was extracted from fish material (~50mg) using the Maxwell™ 16 DNA extraction robot (Promega). The Maxwell™ 16 Tissue DNA purification kit (catalogue number AS1030) and associated extraction protocol was used as per the manufacturer’s instructions. DNA was eluted in 400µl of elution buffer and quantified using the GeneQuant pro DNA calculator.

2.3 DNA analysis

2.3.1 DNA amplification

2.3.1.1 464bp cyt b amplicon (general fish) PCR products (464bp of the cyt b gene) were produced by amplification of DNA extracts (50ng) in 20µL reactions containing 1x Amplitaq Gold PCR buffer (Applied Biosystems), 300nM of each primer

(L14735 and H15149. Details in Table 3), 200nM dNTPs, 5mM MgCl2 and 0.05U/µl of Amplitaq Gold (Applied Biosystems). Amplification profiles (95ºC for 5 minutes [denaturation]; 40 cycles of: 95ºC for 40 seconds 50ºC for 80 seconds, 72ºC for 80 seconds [amplification]; 72ºC for 7 minutes [final extension]) were applied using a GeneAmp PE9600 or ABI9800 PCR machine (Applied Biosystems). Unpurified PCR products (1µl) were applied to the Bioanalyzer to confirm amplification.

2.3.1.2 168bp cyt b amplicon (canned salmon) PCR products (168bp of the cyt b gene) were produced by amplification of DNA extracts (50ng) in 20µl reactions containing 1x Amplitaq Gold PCR buffer (Applied Biosystems), 300nM of each primer

(CytB5-F and CytB5-R. Details in Table 3), 250nM dNTPs, 5mM MgCl2 and 0.05U/µl of Amplitaq Gold (Applied Biosystems). Amplification profiles (95ºC for 5 minutes [denaturation]; 45 cycles of: 95ºC for 40 seconds, 50ºC for 80 seconds, 72ºC for 80 seconds [amplification]; 72ºC for 7 minutes [final extension]) were applied using a GeneAmp PE9600 or ABI9800 PCR machine (Applied Biosystems). Unpurified PCR products (1µl) were applied to the Bioanalyzer or conventional gel electrophoresis was applied to confirm amplification.

2.3.1.3 176bp cyt b amplicon (canned tuna) PCR products (176bp of the cyt b gene) were produced by amplification of DNA extracts (50ng) in 25µL reactions containing 1x Amplitaq Gold PCR buffer (Applied Biosystems), 300nM of each primer

(H15573 and L15424. Details in Table 3), 200nM dNTPs, 2mM MgCl2 and 0.05U/µl of Amplitaq Gold (Applied Biosystems). Amplification profiles (95ºC for 7 minutes [denaturation]; 45 cycles of: 95ºC for 20 seconds, 52ºC for 20 seconds, 72ºC for 50 seconds [amplification]; 72ºC for 5 minutes [final extension]) were applied using a GeneAmp PE9600 or ABI9800 PCR machine (Applied Biosystems). Unpurified PCR products (1µl) were applied to the Bioanalyzer or conventional gel electrophoresis was applied to confirm amplification.

2.3.1.4 ITS-2 amplicon (scallop ) PCR products 359-383bp from the ITS-2 region were produced by amplification of DNA extracts (50ng) in 25µL reactions containing 1x Amplitaq Gold PCR buffer (Applied Biosystems), 300nM of each primer (Details in Table 3), 200nM dNTPs, 2mM MgCl2 and 0.05U/µl of Amplitaq Gold (Applied Biosystems). Amplification profiles (95ºC for 5 minutes [denaturation]; 40 cycles of: 95ºC for 20s, 55ºC for 20 seconds, 72ºC for 45 seconds [amplification]; 72ºC for 5 minutes [final extension]) were applied using a GeneAmp PE9600 or ABI9800 PCR machine (Applied Biosystems). Unpurified PCR products (1µl) were applied to the Bioanalyzer or conventional gel electrophoresis was applied to confirm amplification.

2.3.1.5 700bp cytochrome oxidase I (COI) amplicon Analysis of the cytochrome oxidase sub-unit 1 (COI) gene was performed using primer sequences developed by Ward et al., (2005)19. Primer details are shown in Table 3. Combinations of pairs of primers (Fish-F1 with Fish-R1 or Fish-R2; Fish-F2 with Fish-R1 or Fish-R2) were used to determine the optimal PCR amplification with each fish species. PCR products were produced by amplification of DNA extracts (50ng) in 25µL reactions containing 1x Amplitaq Gold PCR buffer (Applied Biosystems),

300nM of each primer (Details in Table 3), 200nM dNTPs, 2mM MgCl2 and 0.05U/µl of Amplitaq Gold (Applied Biosystems). Amplification profiles (95ºC for 5 minutes [denaturation]; 40 cycles of: 95ºC for 30s, 54ºC for 30s, 72ºC for 60s [amplification]; 72ºC for 5 minutes [final extension]) were applied using a GeneAmp PE9600 or ABI9800 PCR machine (Applied Biosystems). Unpurified PCR products (1µl) were applied to the Bioanalyzer or gel electrophoresis to confirm amplification.

Table 3: PCR primers used in this study. Primer Application Sequence (5’ – 3’) Reference

L14735 cyt b gene AAAAACCACCGTTGTTATTCAACTA Hold et al, 20012 H15149* cyt b gene GCICCTCARAATGAYATTTGTCCTCA Hold et al, 20012 FishF1 COI gene TCAACCAACCACAAAGACATTGGCAC Ward et al, 200519 FishF2 COI gene TCGACTAATCATAAAGATATCGGCAC Ward et al, 200519 FishR2 COI gene ACTTCAGGGTGACCGAAGAATCAGAA Ward et al, 200519 CytB5-F Canned salmon AAAATCGCTAATGACGCACTAGTCGA Yang et al, 200417

CyrB5-R Canned salmon GCAGACAGAGGAAAAAGCTGTTGA Yang et al, 200417

H15573 Canned tuna AATAGGAAGTATCATTCGGGTTTGATG Quinteiro et al, 199815

L15424 Canned tuna ATCCCATTCCACCCATACTACTC Quinteiro et al, 199815

ITS-R Scallops CTCGTCTGATCTGAGGTCG Lopez-Pinon et al, 200218

ITS-2 Scallops CATCGATATCTTGAACGC Lopez-Pinon et al, 200218

*Primer sequence contains mismatches Y (C or T), R (A or G) and Inosine (I)

2.3.2 Conventional gel electrophoresis PCR products (5µl) were mixed with 1µl loading buffer (10% Ficoll400, 0.25% Bromophenol Blue) and the whole volume loaded onto a 2% agarose gel containing SYBR Safe stain (Invitrogen, Paisley, UK). The DNA fragments were separated using 100V for 30 minutes. Gel images were captured using a GelDoc2000 Image Capture System (Bio-Rad, Hemel Hempstead, UK) and Quantity-One software (Vers 4.3.0, Bio-Rad) following the manufacturers’ instructions. Hard-copy images of the gels were printed from the system and electronic copies stored in Quantity-One and Tiff file formats.

2.3.3 Capillary electrophoresis using the Agilent 2100 Bioanalyzer for PCR product detection and PCR-RFLP profiling Reagents and DNA1000 Series II LabChips were prepared following the manufacturer’s instructions. Batches (~500µl) of gel matrix (used to fill LabChip capillaries) were prepared as required or at 4 weekly intervals. All reagents were stored between 1-4oCwhen not in use and allowed to reach room temperature 30 minutes before use. Digested PCR products (5µl) were mixed with 1µl of 60mM EDTA, to achieve a final concentration of 10mM EDTA, prior to loading on to LabChips. Aliquots (1µl) of the reaction mix were loaded on to the LabChip, as per the manufacturer's instructions, and analysed on the 2100 Bioanalyzer.

2.3.4 Restriction digestion Restriction enzymes were obtained from New England Biolabs or Roche Diagnostics GmbH and used as per the manufacturer’s instructions. Unpurified PCR product (2.5µl) was digested overnight at 37ºC or 25ºC with 2–5 units of enzyme in a total volume of 5µl. Reactions were terminated by incubation at 65ºC for 10 minutes.

Table 4 : Restriction Enzymes used in study.

Assay Enzyme Supplier

Cyt b gene DdeI, HaeIII, NlaIII New England Biolabs Canned salmon DdeI, BfaI, CviKI-1 New England Biolabs Canned tuna MboI, MnlI, New England Biolabs, BsiYI Roche Diagnostics GmbH Scallops AluI, SmaI, NlaIII New England Biolabs

2.3.5 DNA sequencing Sequencing PCRs were performed in 25µl reaction volumes using the same conditions as shown above (section 2.3.1). Amplification was confirmed by running 1µl of PCR product on the 2100 Bioanalyzer. The remaining PCR product (24µl) was sent to Lark Technologies for sequencing. PCR products were cleaned using a Qiagen PCR purification kit before being sequenced in both directions. PCR primers used to produce PCR products were supplied to Lark Technologies for use in sequencing reactions. Sequence data were provided to Campden BRI as a text file and graphical sequence output file.

2.3.6 Generation of consensus sequence Full DNA sequences for each PCR product were generated by aligning forward and reverse contigs using the SeqMan module of the LaserGene software suite (Ver. 5.05; DNASTAR Inc, Madison, USA). Discrepancies were corrected manually using information in the graphical sequence file. Complete sequence data for each individual from a single species was aligned using the MegAlign module of the LaserGene package and a consensus sequence was produced.

2.4 Generation of theoretical PCR-RFLP profiles using DNA sequence data from the FishTrace database

2.4.1 Recovery of DNA sequence information from the Fish Trace database: In order to generate theoretical PCR-RFLP profiles for different fish species, DNA sequence data was recovered from the Fish Trace database (http://www.fishtrace.org/gb/main.htm).

DNA sequence data for large numbers (>5) of fish samples were recovered from the FishTrace database using a bespoke database (Perl )programme (FishTracer.pl), which was written to perform this task. DNA sequences for small numbers (<5) of individual fish specimens were recovered directly from the FishTrace database website.

2.4.2 FishTracer.pl for recovering large numbers of fish DNA sequences: The Perl programme, FishTracer.pl, was run through a WinXP DOS command window on a PC (P4, 2.00GHz 500MB RAM). The PC had direct internet access. FishTracer.pl used a text file containing fish species and catch area identification codes to recover all genetic data for each individual fish sample. Data from each fish sample was stored as an individual HTML formatted file. FishTracer.pl also separated the cyt b gene and Rhodopsin gene sequences for each sample and saved these in separate FASTA formatted files.

2.4.3 Direct recovery of individual fish samples: Direct recovery of individual fish DNA sequences from the FishTrace site was performed by searching for and viewing the specimens available for the species of interest. Where DNA sequence data was available for a particular specimen the relevant information page was opened to show the DNA sequence. DNA sequence data for the cyt b or Rhodopsin genes was copied and pasted into a text file. The sequence “AAAAACCACCGTTGTTATTCAACTACAAGAACCTTA” was added to the start of the FishTrace DNA sequence. This 36bp of DNA includes the sequence for the forward PCR primer (L14735) along with a 20bp consensus sequence derived from DNA sequences generated during FSA project Q01069. After adding the 36bp to the start of the DNA sequence, the DNA sequence was trimmed to a length of 438bp. Finally, the theoretical sequence was brought back to 464bp by the addition of the reverse PCR primer (H15149) DNA sequence, “TGAGGACAAATRTCATTYTGAGGNGC”.

2.4.4 DNA digests to generate theoretical PCR-RFLP profiles. Theoretical PCR-RFLP profiles for the 464bp PCR fragment were generated using DNA sequence data from the FishTrace database saved in FASTA formatted files. PCR-RFLP profiles for large numbers of samples (>5) were generated using the Perl programme, RestDigest.pl, which was specifically written to perform this task. For small numbers of samples (<5) the PCR-RFLP profiles were generated using AnnHyb software (Ver. 4-17; http://annhyb.free.fr).

PCR-RFLP profiles for other DNA gene targets were generated using the AnnHyb software package. Sequence data (obtained as part of this study or from sequence databases) was edited using the EditSeq module of LaserGene, Ver. 5.07 (DNAStar, USA) and saved in FASTA formatted files prior to use in AnnHyb.

2.4.5 Theoretical PCR-RFLP profiling using RestDigest.pl The Perl programme, RestDigest.pl, was run through a DOS command window using the same PC that was used for FishTracer.pl. RestDigest.pl used the FASTA formatted files generated by FishTracer.pl to generate theoretical restriction digest profiles for each fish sample using three enzymes (DdeI, HaeIII NlaIII). Initially the programme edited the cyt b sequences in the FASTA file by adding the 36bp consensus sequence (AAAAACCACCGTTGTTATTCAACTACAAGAACCTTA) to the start of the sequence. The new extended sequence was trimmed to leave a 438bp fragment before the 26bp consensus sequence (TGAGGACAAATRTCATTYTGAGGNGC) was added to bring the final sequence up to 464bp, which is the theoretical PCR fragment generated by the Fish PCR. The approach used by RestDigest.pl was similar to that described for the manual generation of sequence data (see above). RestDigest.pl then used the theoretical 464bp PCR fragment to generate theoretical PCR-RFLP profiles for the three enzymes, DdeI, HaeIII & NlaIII. Profiles for each sample were saved in a tab-delimited text file, where each line contained sample information (identification), PCR-RFLP profile fragment sizes expected after digestion with enzymes DdeI, HaeIII and NlaIII and the 464bp PCR amplicon.

2.4.6 Theoretical PCR-RFLP profiling using AnnHyb. Theoretical PCR-RFLP profiles were generated using the AnnHyb (Ver. 4-17; http://annhyb.free.fr) software package. DNA sequences were entered as FASTA formatted files. FASTA files were generated directly from DNA sequencing work or by editing DNA sequence data from sequence databases (FishTrace, GenBank). PCR-RFLP profiles were generated by up-loading the sequence files

into the AnnHyb software. Theoretical digests were generated by selecting enzymes, including DdeI, HaeIII & NlaIII, from the available list. Results were saved in individual text files. The restriction site positions produced by AnnHyb were converted to DNA fragment sizes by finding the difference between the largest cut site position and 464. Subsequent fragment sizes were derived by finding the difference between the next largest cut site position and the largest position. This was repeated until the smallest cut site position was reached. The last fragment equates to the smallest cut-site position. For example an enzyme profile with cut site positions of 441, 375, 287, 126 produces fragments of 464-441=23bp, 441-375=66bp, 375-287=88bp, 287-126=161bp & 126bp (the smallest cut-site position).

3 Results & Discussion

3.1 Further development of 464bp cyt b PCR-RFLP profiles database

3.1.1 Comparison of Series II DNA 1000 chip and DNA 500 PCR-RFLP profiles.

In FSA project Q01069, the PCR-RFLP profiles for Dde I, Nla III and Hae III data were generated from authentic fish species and compared to theoretical PCR-RFLP profiles generated from sequence data. There was good correlation between the anticipated fragment sizes and those derived experimentally when the analysis was performed on the DNA 500 capillary electrophoresis chip. However, during the course of FSA project Q00199, Agilent discontinued the DNA 500 chip kit and replaced it with the Series II DNA 1000 lab chip. The DNA fragment sizes produced with the new chip kits were different. Series II DNA 1000 PCR-RFLP profiles were therefore produced for some of the species from Q01069 and compared to the profiles produced by the DNA 500 chip (Table 5). The number of fragments resolved was generally in agreement but the sizes of each DNA fragment were determined to be higher on the Series II DNA 1000 lab chip. For example, Atlantic salmon (Salmo salar) produced DdeI fragments of 113, 318 and 326bp on the DNA 500 chip and fragments of 117, 332, 340 on the new DNA 1000 chip.

Variation in PCR-RFLP fragment sizes produced by the Series II DNA 1000 chips was tested by analysis on three different Bioanalyzer machines (Table 6). The results indicated that the variation in fragment size was generally below 5% for DNA fragments of about 50bp but the variation appeared to be substantially higher (up to 17%) for fragments below 50bp. Additionally, some of these smaller fragments were not always automatically detected by the Bioanalyzer.

The problem encountered with the change in lab chip kits from the DNA 500 to the Series II DNA 1000 identified the need for the development of both theoretical and experimental PCR-RFLP profile databases for the new species. If changes in Bioanalyzer instrumentation, software and chip kits have the potential to influence the sizing of DNA fragments it is recommended that fish identification is always performed using an appropriate control with each batch of samples.

Table 5: Comparison of species PCR-RFLP profiles generated using the DNA500 and DNA1000 LabChip kits.

DNA fragments (bp) following DNA fragments (bp) following digestion with the enzyme … DNA500 digestion with the enzyme Series II Species LabChip data DNA1000 LabChip data

Dde I Hae III Nla III Dde I Hae III Nla III

Atlantic salmon 113, 318, 326 37, 100, 319 441 117, 332, 340 40, 105, 333 459 (Salmo salar)

Red/sockeye salmon 114, 346, 353 35, 102, 320 160, 272 119, 359, 363 39, 110, 330 166, 284 (Oncorhynchus nerka)

Pink salmon (Oncorhynchus 112, 343, 349 421 92, 181 119, 360 436 99, 189 gorbuscha)

Chinook/Pacific salmon (Oncorhynchus 177, 273, 280 99, 318 439 188, 285, 290 109, 329 455 tschawytscha)

Coho/silver salmon 65, 113, 274, 74, 121, 286 100, 319 182, 246 107, 328 191, 257 (Oncorhynchus kisutch) 281 292

Keta/chum salmon 112, 341, 349 420 181, 270 119, 361 435 189, 283 (Oncorhynchus keta)

Cut-throat trout/trout (Oncorhynchus clarki 112, 343, 351 98, 316 92, 183 121, 359 109, 333 101, 191 clarki)

Cod 97, 107, 84, 115, 234 37, 102, 321 89, 100, 280 94, 123, 248 47, 111, 334 (Gadus morhua) 291

Pacific Cod/Cod 98, 106, 198, 235 37, 102, 320 89, 100, 279 209, 247 37, 130, 335 (Gadus macrocephalus) 292

Alaska pollock/Pacific pollock 38, 67, 101, 38, 47, 98, 46, 77, 110, 50, 59, 198, 232 208, 245 (Theragra 243 278 257 107, 290 chalcogramma)

Haddock (Melanogrammus 433 37, 429 94, 183 466 47, 442 102, 192 aeglefinus)

Plaice [32], 138, 266, 90, 103, 37, 129, 286 86, 100, 187 144, 273, 287 145, 298 (Pleuronectes platessa) 273 193

Hoki [35], 175, [23], 44, 101, 44, 67, 105, 75, 110, (Marruronus 181, 265, 272 108, 296 255, 262 288 264 273 novaezelandiae)

Hake 38, 101, 127, 44, 110, 134, 155, 307, 314 477 (U) 160, 321, 327 489 (Merluccius merluccius) 185 198

Table 6 : Repeatability of PCR-RFLP profiles generated on different Bioananalyzers using the Series II DNA 1000 chip kits

Sample Species & Enzyme PCR-RFLP DNA fragments produced using the Series II DNA % variation no 1000 labchip (bp) Instrument 1 Instrument 2 Instrument 3 1 Pacific cod 245 251 246 2.4 Dde I 206 210 207 1.4

2 Alaska pollock 239 248 241 3.7 Dde I 203 209 205 2.9 3 Haddock 441 464 444 5.1 Dde I

4 Coley 330 343 333 3.8 Dde I 118 123 120 4.1 5 Pacific Cod 324 336 326 3.6 Hae III 105 111 107 5.4 41 47 42 13.3 6 Alaska pollock 248 257 251 3.6 Hae III 105 110 107 4.7 74 77 75 3.9 39 46 47 17.7 7 Haddock 428 450 431 5.0 Hae III 42 42 0 8 Coley 328 338 329 3.0 Hae III 107 112 109 4.7 42 44 4.7 9 Pacific Cod 286 292 288 2.1 Nla III 104 106 107 2.8 94 98 96 4.2 10 Alaska pollock 284 289 289 1.7 Nla III 103 105 106 2.8 56 59 56 5.2 43 48 11.1 11 Haddock 187 192 189 2.6 Nla III 99 102 99 3.0 12 Coley 376 380 375 1.3 Nla III 105 106 107 1.8

3.1.2 Development of theoretical cyt b PCR-RFLP profiles from sequence data generated by CCFRA Cyt b sequence data was a produced for 17 authentic fish species obtained from CEFAS and Billingsgate Fish market(Table 7). Sequences from the different individuals (where available) of each species were aligned to produce a species-specific consensus sequence. The consensus sequences from each fish species were aligned to assist with identifying regions of sequence variation or homology (Figure 1). The sequences for each species were also used to predict expected PCR-RFLP patterns for each of the fish species using the three enzymes Dde I, Hae III and Nla III. Theoretical and experimentally derived profiles were produced (Table 7).

Table 7: Theoretical and experimental cyt b 464 bp PCR-RFLP profiles of fish samples sequenced by Campden BRI during FSA project Q01099.

Species Number of Amplicon RFLP analysis individuals length Enzyme Theoretical experimental Bonito 1 466 DdeI 229, 210, 27 233. 214 Sarda sarda HaeIII 189, 150,127 189, 149, 131 NlaIII 249, 126, 91 253, 138, 108 Emperor 1 467 DdeI 349, 118 Not tested Lethrinus Sp. HaeIII 333, 128, 6 NlaIII 287, 154, 26 Flounder 1 467 DdeI 319, 148 336, 329, 145 Platichthys flesus HaeIII 292, 129, 41, 5 298, 138, 48 NlaIII 283, 96, 88, 291, 107, 94 Herring 1 466 DdeI 466 516 Culpea harengus HaeIII 466 520 NlaIII 371, 66, 29 394, 84 Yellow tailed 1 469 DdeI 441, 28 Not tested snapper HaeIII 152, 123, 112, 71, 6 Chrysurus ocyurus NlaIII 377, 92 Rainbow trout/trout 1 465 DdeI 348, 117 Not tested Oncorhynchus HaeIII 316, 109, 40, mykiss NlaIII 195, 179, 91, Threadfin bream 1 466 DdeI 439, 27 Not tested Nemipterus delagoe HaeIII 211, 127,122, 6, NlaIII 196, 91, 88, 91 Turbot 1 467 DdeI 282, 118, 39, 28 296, 124, 38 Psetta maxima HaeIII 183, 150, 134 190, 149, 135 NlaIII 467 487 Sea bass/Bass 5 464 DdeI 195, 121, 60, 39, 22 206, 123, 64, 42, 21 Dicentrarchus HaeIII 183, 126, 63, 46, 40 187, 137, 62, 42 labrax NlaIII 289, 91, 84 289, 109, 94 Sardine 4 466 DdeI 276, 190 291, 285, 187 Sardina pilchardus HaeIII 302, 104, 46, 14 313, 109, 41 NlaIII 192, 179, 34, 32, 29 195, 185, 61, 51

Red mullet 5 461 DdeI 282, 160, 19 295, 292, 160 Mullus surmuletus HaeIII 189, 122, 109, 41 195, 131, 108, 41 NlaIII 247, 90, 50, 38, 36, 254, 106, 59, 47 Pollock 7 466 DdeI 442, 24 451 Pollachius HaeIII 316, 109, 41 333, 109, 44 pollachius NlaIII 371, 95 381, 106 Lemon sole 3 466 DdeI 466 477

Microstomus kitt HaeIII 298, 128, 40 297, 131, 48 NlaIII 195, 91, 88, 92 192, 103, 97 Dover sole/Sole 5 463 DdeI 436, 27 451 Solea solea HaeIII 266, 147, 50 271, 148, 58 NlaIII 340, 123, 359, 124 Witch/Torbay sole 7 464 DdeI 300, 156, 8 308, 301, 154 Glyptocephalus HaeIII 235, 126 , 97, 6, 239, 132, 99 cynoglossus NlaIII 286, 90, 88 288, 107, 96 Black sea bream 5 462 DdeI 234, 206, 22 238, 208 Spondyliosoma HaeIII 462 468 cantharus NlaIII 369, 93 372, 107 Anglerfish/Monkfish 4 461 DdeI 231, 230 234 Lophius piscatorius HaeIII 294, 167 303, 179 NlaIII 161, 120, 92, 88

3.1.3 Classification of samples using Fish Trace data The identification of fish samples within the FishTrace database (www.fishtrace.org) is achieved using unique sample-specific identification codes, for example GadMor-NS-04. Each sample code is composed of a six letter species identification code that is derived from the Latin name of each species, e.g. Atlantic cod (Gadus morhua) is coded “GadMor”. This convention allows different species of the same genus to be identified. For example, Sharpsnout sea bream (Diplodus puntazzo) is coded “DipPun” while White seabream (Diplodus sargus) is coded “DipSar”. In addition to the six letter species code each fish in the FishTrace database has a two letter catch area code. FishTrace has recognised nine catch areas as shown in Table 8; however, in the database many of the fish from the Baltic sea had been labelled SB rather than BS and those of the Madeiran archipelago as AM rather than MA. This provided eleven possible catch area codes rather than nine. The last part of the sample ID code comprises the number 01 to 05 for each individual fish from each catch area1. The unique sample ID code allows individual fish identification; therefore, using the example above (GadMor-NS-04) it is possible to identify the sample as the fourth individual of Gadus morhua (Atlantic cod) caught in the North Sea.

Table 8: Catch areas used in the Fish Trace project

Catch Area Catch area code Baltic sea BS / SB North sea NS English channel & Bay of Biscay CB Cantabric sea & NW Iberian peninsula CS Madeiran archipelago MA / AM Canary Islands CI Western Mediterranean & Bay of Cadiz WM Eastern Mediterranean EM Extra Europeanª EE ª Extra European fish are those caught outside European waters but commercially available within the EU.

1 Note that at the time of analysis information on only five or less individual fish per catch area were stored in the database

3.1.3.1 FishTracer.pl for recovering large numbers of fish DNA sequences At the time of analysis FishTrace contained data on 220 fish species, each of which could potentially include 45 individual samples (five individuals from nine catchment areas). The Perl script, FishTracer.pl, was specifically written to recover large volumes of DNA sequence data from the FishTrace database. This script used a text file (FishTrace.txt) containing information about the fish species of interest in the FishTrace database. This data included the six letter species identification code used by FishTrace to generate individual sample identification codes and the catch area codes. FishTracer.pl used the information in the FishTrace.txt file to generate and grab individual web pages relating to each fish in the database. These pages included sequence data, where available, for the mitochondrial cyt b and nuclear Rhodopsin genes from each fish sample. The script recovered all possible combinations of catch areas (11 in total) and up to 5 fish (01 to 05) for each species, so for each species 55 pages of information were recovered and stored as HTML (web) pages. The complete database (12,100 html pages of information) was recovered in around five hours. Pages with no sequence information were less than 10kb in size and were deleted. In addition to generating a single data file for each fish, the FishTracer.pl script also automatically extracted the cyt b gene and rhodopsin gene DNA sequences where available. The cyt b gene sequences for each fish sample were stored in a single FASTA formatted text file containing all sequences data for all fish samples. The FASTA formatted file of cyt b gene sequences was used by the Perl programme RestDigest.pl to generate PCR-RFLP profiles for each fish sample with enzymes Dde I, Hae III and Nla III.

3.1.3.2 Recovery of small (<5) numbers of fish samples: A small number of individual fish samples were recovered from the FishTrace database by visiting the website and opening the respective page for the fish sample. DNA sequence data for the cyt b gene only was recovered and saved locally at Campden BRI. Sequence data recovered manually was compared with that retrieved using FishTracer.pl using the MegAlign module of DNAStar. Results (not shown) showed no difference in the sequence data, indicating that FishTrace.pl could be used to recover DNA sequences from the FishTrace database.

3.1.3.3 Generation of theoretical PCR-RFLP profiles using restdigest.pl. Theoretical PCR-RFLP profiles for the 464bp PCR fragment were generated using DNA sequence data from the FishTrace database. In order to produce profiles that were comparable with the 464bp PCR amplicon it was necessary to edit the DNA sequence recovered from FishTrace. The FishTrace data comprised the whole cyt b sequence without any of the flanking regions, such as intergenic spacers or neighbouring genes. The editing process used is described in section 2.4.5 of this report.

3.1.3.4 Generation of theoretical PCR-RFLP profiles using AnnHyb For individual sequences downloaded from databases, theoretical PCR-RFLP profiles for the 464bp PCR fragment were generated using alternative AnnHyb software. This software had been used to generate profiles during FSA project (Q01069). Profiles generated using RestDigest.pl and AnnHyb were compared to ensure consistency between profiling software. Results (not shown here) indicated that some variation between fragments of less than 4bp was observed when PCR-RFLP profiles were generated using the two different software programmes. This difference was due to

the way that the programmes identified the exact point of cleavage. However, the theoretical differences (<4bp) were well within the sizing variation reported for the 2100 Bioanalyzer and were, therefore, considered unlikely to affect the results.

3.1.3.5 Generation of PCR-RFLP profile database for 464bp Amplicon. The tab delimited results file (from RestDigest.pl) was opened in MSExcel to reveal the profiles for each sample. Additional profile data generated using AnnHyb was added as necessary. This file was also edited to include experimental profiles generated using both the old DNA 500 LabChips (see FSA project report Q01069) and the newer DNA 1000 LabChips. This edited file formed the basis of the PCR-RFLP profile fish database and is shown in Appendix B.

Overall results showed that in the majority of cases identical PCR-RFLP profiles were generated from all samples of a single species present in FishTrace. A few fish, such as Whiting (Merlangius merlangus), Lemon sole (Microstomus kitt) and Black Sea Bream (Spondyliosoma cantharus) did produce different profiles with one of the three enzymes. In these species an inter species variation produced altered DNA sequence that led either to an additional enzyme restriction site or loss of one. For these species, only one of the three enzyme profiles was affected. Some of the variations in profile appeared to be linked to the catch location of the fish samples but extensive study of the fish populations and profile differences were not the focus of this project.

In some instances closely related species gave the same profile for the three enzymes. For example, Thunnus albacares (Yellowfin tuna) and Thunnus obesus (Bigeye tuna) gave the same profile. Therefore the use of other restriction enzymes in addition to Dde I, Hae III and Nla III would be required in such instances.

When theoretical profiles were compared to those generated experimentally a good correlation was observed between the theoretical fragment sizes and those obtained when analysis was performed on the DNA500 LabChips. Experimental PCR-RFLP fragments sizes obtained using Series II DNA1000 LabChips were generally 5–10 bp larger than those theoretically predicted from the sequence data. A comparison of theoretical FishTrace profiles and experimental profiles can be found in Appendix C.

When there was a slight difference between the experimental and the theoretical profile for a particular enzyme, other cyt b gene sequences, obtained from the Genbank database, were analysed. It was noted that the Sea bass theoretical Fish Trace DdeI profile was different to the one derived experimentally. A 145 bp fragment was present in the theoretical Fish Trace profile, but the experimantal profile produced a 123bp fragment. Examination of the 464 cyt b sequence data produced in this study and other sequences in Genbank identified a Dde I restriction site that had not been incorporated into the profile derived from FishTrace data. The cutting site was located in part of the tRNA gene DNA sequence found in a section just in front of the cyt b gene. The original FishTrace data did not include this section, so a consensus sequence had to be added to all Fish Trace sequences and this did not contain the Dde I restriction site. The theoretical profile contains 121bp and 24bp fragments rather than a single 145bp fragment. This inconsistency was only observed with Sea Bass but there may be other species which may be affected. Similarly , it must be noted that this can also happen with HaeIII and NlaIII profiles if there are cutting sites found in this short region of DNA.

3.1.4 Theoretical tuna species 464bp cytochrome b PCR-RFLP profiles derived using GenBank sequence data Only a limited number of tuna species were represented in the FishTrace database at the time of this project and thus further theoretical PCR-RFLP profiles were derived using cyt b DNA sequences recovered from GenBank. Many of the recovered sequences were partial sequences (e.g. L11557, which is a partial sequence of the mitochondrial cyt b gene from yellowfin tuna, Thunnus albacares) and did not include the whole of the 464bp region. In addition to the partial sequences, 13 complete mitochondrial genomes from tuna species were recovered. These sequences were from bullet tuna (Auxis rochei; AB103467, AB103468, AB105165, NC_005313), frigate tuna (A. thazard; NC_005318, AB105447), Skipjack tuna (Katsuwonus pelamis; AB101290, NC_005316), Bluefin tuna (T.thynnus; AY302574, NC_004901, AB097669) and Albacore tuna (T. alalunga; AB101291, NC_005317). To identify the location of the 464bp region within the recovered tuna sequences a local BLAST analysis was performed against the saved tuna sequences using a 464bp DNA sequence from Bluefin tuna (Thunnus thynnus). This analysis revealed that only the 13 complete mitochondrial genomes contained the complete 464bp sequence. The complete genome sequences were trimmed to include the 464bp region and aligned. The initial alignment showed that several of the sequences from each species in GenBank were identical. The duplicate sequences were removed and the alignment was repeated (Figure 2).

Theoretical profiles for the tuna species were produced using the trimmed mitochondrial sequences described above. Sequences for the other tuna species were produced using a combination of the partial sequences obtained from GenBank, data produced by sequencing samples available at Campden BRI and a consensus sequence derived from the 13 aligned mitochondrial sequences. Theoretical PCR-RFLP profiles for the tuna species using the three enzymes DdeI, HaeIII and NlaIII were generated using the sequence constructs and the AnnHyb software package. Results of this theoretical profiling are shown in Table 9. A number of the species produced the same profile. Bigeye tuna (T.obesus), Yellowfin tuna (T. albacores) and T. maccoyyii could not be distinguished from each other and T. alalunga and T. oritentalis produced an identical profile to each other. For these species either alternative enzymes or sequence analysis would be needed to identify the species.

Table 9:Results of theoretical PCR-RFLP profiling of12 tuna species using the 464bp PCR amplicon and the three enzymes, DdeI, HaeIII and NlaIII.

Tuna species Enzyme PCR-RFLP Fragments Enzyme Overall Pattern1 profile2 Bigeye DdeI 8 18 210 229 A 1 T. obesus HaeIII 132 37 147 149 A NlaIII 90 250 125 A Bullet DdeI 8 228 228 B 2 Auxis rochei HaeIII 126 159 179 B NlaIII 24 32 34 249 125 B Skipjack DdeI 8 18 210 228 A 3 Katsuwonus HaeIII 132 332 C pelamis NlaIII 90 88 161 125 C Albacore DdeI 8 18 210 228 A 4 T. alalunga HaeIII 126 6 37 146 149 D NlaIII 90 249 125 A Bluefin DdeI 8 18 210 64 164 C 5 T.thynnus HaeIII 132 37 146 149 A NlaIII 90 249 125 A Yellowfin DdeI 8 18 210 228 A 1 T. albacares HaeIII 132 37 146 149 A NlaIII 90 249 125 A Little tunny DdeI 8 228 228 B 6 Euthynnus HaeIII 132 153 179 B alletteratus NlaIII 90 249 125 A Frigate DdeI 464 D 7 Auxis thazard HaeIII 126 159 179 B NlaIII 24 32 34 249 125 B Pacific DdeI 8 18 210 228 A 4 bluefin HaeIII 126 6 37 146 149 D T. oritentalis NlaIII 90 249 125 A Longtail DdeI 8 228 228 B 8 T. tonggol HaeIII 132 37 146 149 A NlaIII 90 249 125 A Blackfin DdeI 8 228 228 B 8 T. atlanticus HaeIII 132 37 146 149 A NlaIII 90 249 125 A Southern DdeI 8 18 210 228 A 1 bluefin HaeIII 132 37 146 149 A T. maccoyii NlaIII 90 249 125 A 1 Individual enzyme profiles are coded so that fish sharing the same profile for a particular enzyme are given the same letter

2 Profiles (based on 3 enzymes) are coded so that fish sharing the same overall profile have the same number.

3.2 Development of a lab-on-a-chip CE method for canned salmon

3.2.1 Sequence comparison and identification of restriction enzymes for use in PCR-RFLP Mitochondrial DNA sequences from different species of salmonids were obtained from GenBank. The sequences used were from O. clarkii (AY032633, AY886762, NC_006897), O. mykiss (AY032629, AY032630, AY032631, AY032632, DQ288268, DQ288269, DQ288270, DQ288271, L29771, NC_001717), O. tshawytscha (AF392054, NC_002980), S. alpinus (AF154851, NC_000861), S. fontinalis (AF154850, NC_000860) and S. salar (AF133701, NC_001960, U12143). A 1200bp region of the cyt b gene from these sequences was aligned in order to identify regions of homology and variation (Figure 3). Some regions of homology that were within a 200bp range, where potential PCR primers for canned samples could be designed, were observed. Many of these short sequences contained insufficient DNA variation to allow species identification by PCR-RFLP profiling. However, a short (168bp) amplifiable region , which was originally reported by Yang et al, 2004.17 for use in salmon bone sequence analysis, did contain some variation that could be exploited for RFLP development.

DNA sequences from two salmon species, O. kitsutch (coho/medium red salmon) (AJ314563, AF165079 & DQ449933) and two O. nerka (red salmon) (AJ314568 & EF055889), corresponding to this 168bp region of the cyt b gene were obtained from GenBank. These four sequences were aligned with trimmed sequences from the larger 1200bp cyt b gene region (Figure 4). This alignment allowed regions of variation to be identified where potential PCR-RFLP profiles could be generated. Enzymes for generating theoretical PCR-RFLP profiles were identified using AnnHyb. Recognition sites for the three enzymes, Bfa1 (CTAG), CvikI-1 (RGCY) and Dde1 (CTNAG), which allow identification of most salmon species are marked on Figure 4. Theoretical profiles were confirmed using authentic salmon and the PCR primers (Table 3) and respective enzymes.

3.2.2 Application of the salmon cyt b PCR-RFLP assay to reference material Fresh authentic salmon species DNA was amplified using the 168 cyt b amplicon. The three restriction enzymes selected to enable discrimination of salmon species were applied to the authentic samples (Table 10). The Bfa I fragment sizes obtained with the Bioanalyzer were generally higher than the anticipated fragment sizes. For example with Chinook salmon the theoretical 19, 57 and 92bp fragments were determined to be 61 and 97 bp. In this case the 19 bp fragment was not detected. In Chum salmon the 19, 30, 50 and 57 bp fragments were determined to be 20, 24, 57 and 73 respectively. For Sockeye salmon the 19, 42, 50 and 57 fragments were determined to be 20, 40 and 62. In this case it appears that the 50 and the 57 bp fragments co-migrated. There were also additional fragments detected in the Atlantic and Chum salmon at 95 bp and in the Pink salmon at 84bp which may be fragment produced by incomplete digestion of the PCR product. With CvikI-I the sizing of the fragments was severely affected by the co-migration of the 10, 11, 12 bp fragments with the 15bp lower marker (Figure 5). Dde I produced the anticipated fragments although there did appear to be a primer dimer running at about 20 bp in some of the samples.

Table 10: 168bp Cyt b PCR-RFLP analysis of 8 authentic salmon species materials (not canned)

BfaI Cvikl-I DdeI Expected size Observed size Expected size Observed Expected Observed Sample (bp) (bp) (bp) size (bp) size (bp) size (bp) Chinook 10, 11, 12, 17, 19, 57, 92 61, 97 51, 117 59, 129 salmon 20, 30, 68 Coho 10, 11, 12, 17, 19, 57, 92 62, 97 48, 51, 69 58, 73 salmon 20, 30, 68 Sockeye 10, 11, 12, 17, 19, 42, 50, 57 20, 42, 62 48, 120 60, 124 salmon 20, 30, 68 sizing not Chum 20, 24, 57, 73, 10, 11, 17, 30, 19,30, 50, 69 possible due 48, 120 59, 122 salmon (95) 80 to lower Pink 12, 19, 30, 50, 20, 24, 57, 61, 10, 11, 12, 17, marker mis- 48, 120 59, 123 salmon 57 (84) 20, 30, 68 classification Atlantic 24, 59, 73, 10, 11, 12, 17, 19, 30, 50, 69 48, 120 21, 59, 100 salmon (95), 20, 30, 68 Cherry 62, 106 No result 11, 12, 30, 68 18, 33, 117 30, 128 salmon Cut throat 10, 11, 12, 17, 19, 42, 50, 57 20, 46, 60, 48, 120 No result trout 20, 30, 68 ( ) represents additional bands that are possibly due to incomplete digestion of PCR product

3.2.3 Application of the salmon cyt b PCR-RFLP assay to canned salmon materials Primers were used to amplify the target from DNA samples extracted from a range of canned salmon species. The DNA extracts were prepared using the Maxwell 16 DNA extractor from freeze dried canned salmon material. The PCR product was in the range 166-171 bp; however, it was noted that a small PCR product was observed at about 20bp. The quantity of this product appeared to be dependent on the quantity of the larger product, i.e. high yield of 170bp product coincided with low yield of 20bp product. This suggests that the product was a primer dimer which may be produced when low amounts of the 170bp target are present in the DNA sample extract. This product ran alongside the 15bp lower marker and was carried through into the PCR-RFLP digests (Table 11). It also masked out the 19bp product. The Bfa I enzyme produced some partial digest products which were not anticipated from the theoretical profiles. However, the other fragments produced were consistent with the presence of the anticipated salmon species. Figure 6 shows the Bfa I profiles for the 5salmon species as a gel-like image generated by the Bioanalyzer software. It clearly shows the differences between the species with specific indicator fragments identified. Chinook and Coho gave the same BfaI profile, however these species can be differentiated by their Dde I profiles.. The DdeI enzyme gave the anticipated fragments for each of the 5 species.

3.2.4 Conclusion

A PCR-RFLP method targeting a 168 bp section of the cyt b gene was developed. Although theoretically it was developed to differentiate 8 salmonid species using three enzymes, in practice, only two of the enzymes produced reliable profiles. CvikI-I produced a large number of small fragments that interfered with the running of the lower size marker on the Bioanalyzer. In theory,

this meant that Sockeye salmon could not be distinguished from Cut throat trout, and Chum salmon could not be distinguished from Atlantic salmon.

The 168bp cyt b target was successfully amplified from canned salmon samples and PCR-RFLP profiles were produced with two remaining enzymes (Bfa I and Dde I) from the five species native to the Pacific Ocean. Although the method can be used for discrimination of these species, further sequence analysis may be required to conclusively identify other salmon species.

Table 11: PCR-RFLP analysis of canned salmon samples

Dde I Bfa I

Sample Expected size (bp) Observed size (bp) Expected size (bp) Observed size (bp)

Chum 48, 120 22, (54), 58, 122, 19,30, 50, 69 21, 23, 58, 74, (95) salmon 21, 58, 122 21, 23, 59, 74,( 95)

Sockeye 48, 120 21, 58, 124 19, 42, 50, 57 21, 44, 63, (84) salmon 21, 59, 124 21, 44, 60, (85), ( 99)

Pink 48, 120 21, 58, 123 12, 19, 30, 50, 57 21, 24, 62, (84) salmon 21, 58, 124 21, 24, 61,( 83)

Chinook 51, 117 21, 61, 123, (127) 19, 57, 92 21, 61, (83), 99 salmon 21, 60, 123 21, 61, (83), 98

Coho 48, 51, 69 21, 60, 74 19, 57, 92 20, 61,( 82), 96 salmon 21, 60, 74 22, 62,( 84), 99

20-22bp fragment in bold -suspected primer dimer () possible partial digestion PCR products

3.3 Development of a lab-on-a-chip CE PCR-RFLP method for canned tuna

3.3.1 Application of the published tuna cyt b PCR-RFLP assay to reference material The published method by Quinteiro et al. (1998)15 used three enzymes, MboI, Bsi YI and MnlI, to differentiate a range of tuna fish species in canned products. Authentic tuna materials (not canned) were obtained, and DNA was extracted and analysed using primer sets and enzymes detailed in the abovementioned study.

The results obtained from five tuna species are shown in Table 12. The sizes of the fragments produced by Series II DNA 1000 LabChip were generally larger than the published sizes. For example, MboI produced fragments of 59bp and 132bp with Thunnus alalunga whereas the published fragment sizes were 47 and 129 bp. Similarly the MboI fragments obtained for Thunnus Thynnus were 47, 55 and 74, whereas the published sizes were 59, 63 and 83. There was very little intra and inter-chip variability in fragment sizes for the MboI digests; for species where the published profile was 47 and 139bp, the fragments observed were ranged from 58-59 and 131-134 (based of four separate chips). Similarly Bsi Yi produced fragments of 66-69 and 127bp with Thunnus alalunga whereas the published sizes were 57 and 119. For species in which there were no MboI and Bsi YI cutting sites, the observed fragment sizes were 180-184 bp, whereas the theoretical size was 176bp. Thunnus obesus samples produced two different DNA fragment patterns when digested with MboI, suggesting that different populations may carry a mutation in the cutting site.

The enzyme MnlI produced several small DNA fragments with each species. This tests the resolving power of the Bioanalyzer (Figure 7a). The fragments were not always separated and produced double peaks. The Bioanalyzer software automatically identifies fragments and sizes them. When small fragments are running together the accuracy of this automated calling becomes less accurate. In this case it is easier to interpret the profiles by looking at the shape of the electropherogram rather than by looking at the fragment sizes. Katsumonus pelamis produced an electropherogram profile which is different to the other tuna species ( Figure 7b). The observed fragment sizes were 27, 51, 55 and 63, whereas the published fragment sizes are 24, 43, 49 and 60 bp. The other species produced numerous fragments which were not always detected, but fragments were observed at 21, 25, 54 and 58 or at 21, 25 and 57, whereas the expected fragment sizes are 21, 25, 35, 43 and 52.

The overall results indicate that there are unique profiles for T. alalunga, T. thynnus, and Katsuwonus pelamis and that T.albacares and T.obesus could share the same profile as some of the samples of the T.obesus could not be discriminated from .T albacares. There are over 10 species of tuna and it is possible that some of these species may share profiles with the 5 species used in this study. However, the aim of this work was to enable authenticity testing of canned tuna products, which means that Skipjack, Yellowfin and Albacore should be identifiable as these are commonly found in canned tuna products on the UK market.

Table 12: Theoretical and experimental PCR-RFLP profiles for authentic fresh tuna species

Species Theoretical PCR-RFLP Experimental PCR-RFLP

MboI MnII BsiYI MboI MnII BsiYI Albacore tuna 129 52 119 132 55-57 127 Thunnus alalunga 47 43 57 59 24-25 66-69 35 21 25 21 Yellowfin tuna 129 52 176 133-134 58-59 182-183 Thunnus albacares 47 43 59 54-55 35 25 25 20-21 21 Bigeye tuna 176 52 176 131-132 57-58 184 Thunnus obesus 43 58 25 35 Or 21 25 181 21 Bluefin tuna 74 52 176 83 57 182 Thunnus thynnus 55 43 63 52 47 35 59 28 25 20 21 Skipjack tuna 176 60 176 181-182 63 184 Katsumonus 49 55 pelamis 43 51 24 27

3.3.2 Validation of tuna PCR-RFLP method on commercial products The assay was applied to eight canned and bottled tuna products, in order to asses whether PCR- RFLP profiles could be obtained. The products contained either brine, spring water or olive oil. DNA was extracted using the CTAB approach (2.2.1); however, the DNA obtained was lower in concentration and quality when compared to unprocessed tuna materials, due to the degradation caused by high temperature and pressure of the retorting process. In order to produce sufficient yield of PCR product, 45 cycles of PCR rather than the standard 40 were applied to the DNA. The results indicated that PCR products were obtained from virtually all the samples but that the concentration was less than expected. Even though the DNA was highly degraded in canned fish the 176bp amplicon was still amplified. Digests with the three enzymes were performed and profiles obtained (Figure 8). The results indicated that all products, with one possible exception, gave profiles which were consistent with the labelling of the product. Five products were labelled as containing tuna without specifying the species, and the profiles identified the presence of Skipjack in three of these and Yellowfin in the other two. The products labelled as containing Albacore and Skipjack gave profiles consistent with these species. The product labelled as containing Yellowfin tuna gave a profile more consistent with that of Skipjack. However, the amount of amplified product from these samples was low and the resulting PCR-RFLP profiles were difficult to interpret clearly.

Further analysis was carried out on replicate samples taken from three products containing Albacore, Yellowfin and Skipjack tuna.

Other fish species associated with canned products, mackerel and sardine , were also tested with the tuna PCR-RFLP assay. Details of RFLP fragments are found in Table 13. Results are compared to profiles obtained with tuna reference material. Although no amplification was achieved with the mackerel sample, a PCR product was produced with sardine. The sardine Mnl I PCR RFLP profile was distinct from that of the tuna species. The product remained uncut with the other two enzymes. Although the assay was originally designed for discriminating canned tuna species, there may be other species , like sardine, that can produce amplification products with the primers.

Table 13: Experimental PCR-RFLP profiles for unprocessed authentic tuna reference and canned tuna material, canned sardine and mackerel.

Species Experimental PCR-RFLP on authentic Experimental PCR-RFLP on canned unprocessed materials commercial samples MboI MnII BsiYI MboI MnII BsiYI Thunnus alalunga 132 55-57 127 134 56 129 Albacore 59 24-25 66-69 58 53 68 21 25 20 Thunnus albacares 133-134 58-59 182-183 134 57 186 Yellowfin 59 54-55 58 53 25 26 20-21 Katsuwonus 181-182 63 184 185 62 180 pelamis 55 54 Skipjack 51 49 27 Sardine Not performed 183 106 183 Sardinia pilchardus 52 33 Mackerel Not performed No amplification Scomber

3.3.3 Blind sample analysis

An SOP was prepared and given to an analyst along with blind samples of canned skipjack, albacore yellowfin, 50% skipjack/50% mackerel, 50% skipjack/50% albacore and 50% skipjack /50% yellowfin tuna samples (originating from commercial products). The analyst was asked to extract the DNA using the CTAB approach and carry out analysis to identify the species present in the samples. The analyst correctly identified 100% skipjack, albacore and yellowfin, and 50% skipjack in mackerel samples. Difficulties were encountered when trying to interpret the other mixtures. Only skipjack was identified in the skipjack and yellowfin sample and only albacore was identified in the skipjack and albacore sample. Reasons for the difficulty in identifying mixtures of species may relate to preferential amplification of one species over another species and the size of the PCR-RFLP fragments. When analysing canned fish products, in particular for detecting more than one species

in a sample, it is more appropriate to sample individual fish components (flakes of flesh and pieces)from different areas of the can, as the method is not suited to the analysis of mixtures.

3.4 Evaluation of PCR-RFLP approach for King and Queen scallop differentiation

The CTAB method (2.2.1) was used to prepare DNA extracts from Pecten maximus (King), Aequipecten opercularis (Queen - 2 different products; A and B) and Chlamys patagonica (Patagonian) species scallops. Up to four scallops from each commercial product were used. The DNA extracts were amplified using the primers detailed in the paper by Lopez-Pinon et al. (2002)18. Table 14 shows the published fragment sizes and experimentally derived fragments produced with Nla III. The table includes details of other species, Chlamys distorta and Minmachlamys varia, not tested in this study. The theoretical profile for Chlamys patagonica was not available.

The commercial samples were not traceable authentic samples. Experimental data of the product labelled as containing Pecten maximus (King) and one of the Aequipecten opercularis (Queen) products, product A, seemed to correlate with the published fragment sizes, although there appeared to be a double fragment ( 283/272) in the Queen profile for three of the four samples tested. However, scallops from the other Queen sample, product B, did not match the anticipated profile, but did match the profile from the commercial product stating it contained Chlamys patagonica (Patagonian) species. Upon inspection of the product packaging it was evident that this Queen scallop product had been mislabelled as the source of the scallops appeared to be similar to that of the Patagonian scallop.

Due to its size, the ITS-2 amplicon (about 370bp) could be suitable for detection in fresh and frozen scallop products, but further work is needed to establish whether it would be suitable for heat processed and canned products..

The Lopez-Pinon et al. (2002) paper also detailed use of a larger target in the ribosomal DNA spanning the 5.8 RNA gene and the flanking ITS-1 and ITS-2 regions. This region can be amplified in other bivalve species such as clams and mussels. It produces a range of different sized amplification products between 650-800bp depending on the species. Although not studied here this target has the potential to differentiate between bivalve species and would make an ideal target for further development of lab-on-a-chip CE PCR-RFLP methods for fresh or frozen seafood products.

Table 14: Theoretical and experimental Nla III profiles with commercial scallop samples

Species indicated Latin name Theoretical Theoretical Nla III Experimental by labelling on amplicon size* profile expected* profile obtained product from at least 3 samples

Queen Aequipecten 366 279, 87 283, 272, 96 Product A operculis Or 273, 97 Queen Aequipecten 366 279, 87 (153) 146, 95, 86, Product B operculis 53

King Pecten maximus 369 227, 142 219, 151

No product Chlamys 359 359 Not tested distorta

No product Minmachlamys 383 149, 146, 88 Not tested varia

Patagonian Chlamys unknown unknown 146, 92, 84, 47 patagonica

* based on information found in Lopez-Pinon et al. (2004)

3.5 Evaluation of the use of the cytochrome oxidase sub-unit (COI) barcoding amplicon as a secondary PCR-RFLP target

3.5.1 Production of COI sequence data from authentic fish materials PCR amplicons from up to three individuals from 31 fish species were amplified using the COI gene primers developed by Ward et al. (2005)19 ( Table 3). Amplification using a fourth PCR primer Fish-R1 (5’-TAGACTTCTGGGTGGCCAAAGAATCA-3’), which was also developed by Ward’s group, was attempted; however, poor or no amplification was obtained with this primer and the fish species analysed. This primer was not used further in this study. DNA sequence data from individual fish from a single species (generated by Lark Technologies from the amplified PCR products) was aligned using the MegAlign module of LaserGene and a consensus sequence was produced. Total sequence lengths for each species varied slightly depending on the primer pair used to amplify the samples; however, consensus sequence lengths were between 670bp and 709bp (Table 15). These sizes were similar to the sizes reported by Ward’s group for Australian fish species.

3.5.2 Development of theoretical COI PCR-RFLP profiles Theoretical PCR-RFLP profiles were produced using AnnHyb and DNA sequences generated from fish samples. Profiles for the different fish species are shown in Table 15. Several fish species were uncut with either enzyme HaeIII or enzyme NlaIII. Where cutting occurred the number of sites for each enzyme varied between 1 and 5 across the fish species. Each of the three different enzymes (DdeI, HaeIII, NlaIII) produced 20 unique profiles across the 31 fish species analysed. When used in combination it was possible to separate all fish species except Alaska pollock (Theragra chalcogramma) and Whiting (Merlangius merlangus). A number of the profiles, especially those produced with DdeI, revealed the presence of several small DNA fragments of around 20-30bp. It is unlikely that these small fragments would be resolved using the 2100 Bioanalyzer; therefore, the complex theoretical profiles are likely to produce simpler experimental profiles. Experimental profiling was not performed using this gene target during this study; however, the results of theoretical profiling indicate that profiling using this gene target could be achieved. Profiles generated using this barcoding gene target could be used as a complementary assay to the cyt b assay; however, the larger PCR target (~700bp) may make the use of this analytical method unfeasible in some processed fish products.

The Barcoding of Life fish COI sequence data base covers over 4000 species and is a major resource for fish species taxonomy. Further work could be carried out in order to design smaller amplicons within the 700bp COI sequence that are more suitable for use on processed fish products.

Table 15: Theoretical PCR-RFLP profiles generated using enzymes DdeI, HaeIII & NlaIII applied to the fish Barcoding target (COI gene).

Species COI PCR Enzyme Theoretical PCR-RFLP Fragment Primers amplicon sizes Alaska pollock (Theragra Fish-F1 Fish- 706 DdeI 482, 124, 51, 25, 24 chalcogramma) R1 HaeIII uncut NlaIII 387, 319 Monkfish/Anglerfish Fish-F2 Fish- 706 DdeI 589, 48, 25, 24, 20 (Lophius piscaorius) R2 HaeIII 273, 241, 192 NlaIII 324, 198, 106, 78 Black sea bream Fish-F2 Fish- 700 DdeI 602, 74, 24 (Spondyliosoma R2 HaeIII 341, 195, 164 cantharus) NlaIII 329, 210, 161 Bonito Fish-F1 Fish- 699 DdeI 602, 73, 24 (Sarda sarda) R2 HaeIII 545, 154 NlaIII 539, 110, 50 Chinook salmon/Pacific Fish-F1 Fish- 685 DdeI 302, 183, 107, 44, 25, 24 salmon (Oncorhynchus R2 HaeIII 319, 234, 132 tschawytscha) NlaIII 536, 149 Coho salmon Fish-F1 Fish- 689 DdeI 302, 187, 107, 44, 25, 24 (Oncorhynchus kisutch) R2 HaeIII 366, 323 NlaIII 511, 149, 29 Coley Fish-F1 Fish- 706 DdeI 482, 124, 51, 25, 24 (Pollachius virens) R2 HaeIII 453, 253 NlaIII uncut Cut-throat Fish-F1 Fish- 688 DdeI 596, 43, 25, 24 trout/Trout(Oncorhynch R2 HaeIII 320, 236, 132 us clarki clarki) NlaIII 302, 231, 155 Dolly varden (Salvelinus Fish-F1 Fish- 681 DdeI 467, 153, 36, 25 malma) R2 HaeIII 236, 229, 156, 60 NlaIII 329, 204, 148 Sole/Dover sole (Solea Fish-F2 Fish- 707 DdeI 482, 124, 52, 25, 24 solea) R2 HaeIII 366, 341 NlaIII 319, 231, 157 Hake (Merluccius Fish-F1 Fish- 702 DdeI 603, 75, 24 merluccius) F2 HaeIII 363, 252, 87 NlaIII 431, 247, 24 Plaice (Pleuronectes Fish-F1 Fish- 707 DdeI 607, 51, 25, 24 platessa) F2 HaeIII 391, 170, 71, 63, 12 NlaIII 485, 222 Flounder (Platichthys Fish-F2 Fish- 671 DdeI 482, 96, 44, 25, 24 flesus) R2 HaeIII 219, 170, 143, 64, 63, 12 NlaIII 265, 213, 193 Haddock Fish-F1 Fish- 707 DdeI 482, 124, 52, 49 (Melanogrammus R2 HaeIII uncut aeglefins) NlaIII 388, 319 Herring Fish-F2 Fish- 706 DdeI 609, 48, 25, 24 (Clupean harengus) R2 HaeIII 385, 249, 72 NlaIII 315, 231, 160

Lemon sole Fish-F2 Fish- 706 DdeI 434, 124, 51, 49, 48 (Microstomus kitt) R2 HaeIII 390, 241, 75 NlaIII uncut Ling Fish-F2 Fish- 676 DdeI 579, 48, 25, 24 (Molva molva) R2 HaeIII 336, 253, 87 NlaIII 252, 237, 187 Hoki Fish-F1 Fish- 707 DdeI 394, 215, 49 (Macuronus R2 HaeIII 594, 113 novaezelandiae) NlaIII 392, 217, 98 Pacific cod/Cod Fish-F1 Fish- 686 DdeI 482, 117, 38, 25, 24 (Gadus macrocephalus) R2 HaeIII uncut NlaIII 381, 305 Pink salmon Fish-F1 Fish- 700 DdeI 409, 193, 49, 25, 24 (Oncorhynchus R2 HaeIII 458, 242 garbuscha) NlaIII 539, 161 Pollock Fish-F2 Fish- 700 DdeI 332, 150, 123, 46, 25, 24 (Pollachius pollachius) R2 HaeIII 452, 248 NlaIII 267, 220, 213

Rainbow Fish-F1 Fish- 672 DdeI 409, 168, 46, 25, 24 trout/Steelhead trout/ R2 HaeIII uncut Trout (Oncorhynchus NlaIII 492, 151, 29 mykiss) Red mullet Fish-F2 Fish- 700 DdeI 602, 49 (Mullus surmuletus) R2 HaeIII 398, 164, 138 NlaIII 423, 161, 92, 24 Cape hake (Merluccius Fish-F1 Fish- 705 DdeI 605, 76, 24 paradoxus) R2 HaeIII 243, 241, 122, 99 NlaIII uncut Sardine Fish-F2 Fish- 706 DdeI 606, 51, 25, 24 (Sardina pilchardus) R2 HaeIII uncut NlaIII 221, 179, 115, 98, 93 Bass/Sea bass Fish-F2 Fish- 670 DdeI 585, 25, 24, 20, 16 (Dicentrarchus labrax) F2 HaeIII 269, 209, 192 NlaIII 324, 166, 102, 78 Red salmon/Sockeye Fish-F1 Fish- 709 DdeI 410, 196, 51, 27, 25 salmon (Oncorhynchus R2 HaeIII 377, 332 nerka) NlaIII 549, 160 Threadfin bream Fish-F2 Fish- 696 DdeI 246, 224, 129, 73, 19, 5 (Nemipterus delagoae) F2 HaeIII uncut NlaIII 214, 202, 115, 98, 43, 24 Whiting (Merlangius Fish-F1 Fish- 705 DdeI 482, 123, 51, 25, 24 merlangus) R2 HaeIII uncut NlaIII 387, 318 Torbay sole/Witch Fish-F2 Fish- 698 DdeI 482, 118, 49, 25, 24 (Glyptocephalus R2 HaeIII 219, 170, 162, 75, 72 cynoglossus) NlaIII uncut Yellow tailed snapper Fish-F2 Fish- 702 DdeI 434, 168, 76, 24 (Chrysurus ocyurus) R2 HaeIII 345, 171, 116, 52, 18 NlaIII 217, 213, 156, 54, 38, 24 uncut: no restriction site found in sequence data.

4 Acknowledgements

The financial support of the Food Standards Agency is gratefully acknowledged.

Campden BRI acknowledges the general support from Agilent Technologies, Waldbronn, Germany, with specific help from Tobias Preckle and Rainer Nitsche.

Campden BRI thanks the following people who have helped supply authentic fish materials.

Name Organisation Materials

Chris Leftwich Chris Leftwich, Fishmongers' Various certified species Company, Billingsgate Market, London, UK

Jim Ellis CEFAS :The Centre for North Sea fish species Environment Fisheries and Aquaculture Science, Lowestoft UK

Carmen Sotello Instituto de Investigaciones Tuna species Marinas, Vigo, Spain

Miguel Pardo AZTI - Tecnalia / Unidad de Further tuna species Investigación Alimentaria Txatxarramendi Ugartea z/g 48395 Sukarrieta (Bizkaia), Spain

Nancy Wendt John West Foods Canned salmon materials North American Technical Department, Kent ,Washington State, USA

5 References

1. Wolf, C., Hubner, P., & Luthy, J. (1999) Differentiation of sturgeon species by PCR-RFLP. Food Research International, 32, 699-705

2. Hold, G.L., Russell, J. R., Pryde, S.E., Rehbein, H., Quinteiro, J., Rey-Mendez, M., Sotelo, C.G., Perez- Martin, R.I., Santos, A.T., & Rosa, C. (2001) Validation of a PCR-RFLP based method for the identification of salmon species in food products. European Food Research and Technology. 212, 385-289

3. Sotelo, C. G., Calo-Mata, P., Chapela, M. J., Perez-Martin, R. I., Rehbein, H., Hold, G. L., Russell. V. J., Pryde, S., Quinteiro, J., Izquierdo, M., Rey-Mendez, M., Rosa, C., & Santos, A. T. (2001) Identification of flatfish (Pleuronectiforme) species using DNA-based techniques. Journal of Agricultural and Food Chemistry, 49 (10), 4562-4569. 4. Calo-Mata, P., Sotelo, C. G., Perez-Martin, R. I., Rehbein, H., Hold, G. L., Russell. V. J., Pryde, S., Quinteiro, J., Rey-Mendez, M., Rosa, C., & Santos, A. T. (2003) Identification of gadoid fish species using DNA-based techniques. European Food Research and Technol 217 (3), 259-264. 5. Wolf, C., Burgener, M., Hubner, P., & Luthy, J. (2000) PCR-RFLP analysis of mitochondrial DNA: Differentiation of fish species. Lebensmittel-Wissenschaft und -Technologie, 33, 144-150 6. Hold, G. L., Russell. V. J., Pryde, S., Rehbein, H., Quinteiro, J., Vidal, R., Rey-Mendez, M., Sotelo, C. G., Perez-Martin, R. I., Santos, A. T., & Rosa, C. (2001) Development of a DNA-based method aimed at identifying the fish species present in food products. Journal of Agricultural Food Chemistry, 49 (3) 1175-1179. 7. Dooley, J.D., Garrett, S.D., Sage, H.D., Clarke, M-A., & Brown, H.M. (2004) Final Technical Report for Food Standards Agency project Q01069 -Application of a chip-based capillary electrophoresis system to enable simple PCR-RFLP identification of fish species. 8. Dooley, J.J., Sage, H.D., Brown, H.M. & Garrett, S.D. (2005). Improved fish species identification by use of lab-on-a-chip technology. Journal of Food Control, 16, 601–607 9. Dooley, J.J., Sage, H.D., Clark, M.A., Brown, H.M. & Garrett, S.D. (2005). Fish species identification using PCR-RFLP analysis and lab-on-a-chip capillary electrophoresis: application to detect white fish species in food products and an inter-laboratory study. Journal of Agricultural and Food Chemistry, 53(9),: 3348 – 3357. 10. www.fishtrace.org

11. www.azti.es/dna_database/

12. www mitofish.ori.u-tokyo.ac.jp/

13. www.fishbol.org/

14. www.ncbi.nlm.nih.gov/

15. Quinteiro, J., Sotelo, C. G., Rehbein, H., Pryde, S. E., Medina, I., Perez-Martin, R. I.,Rey-Mendez, M., & Mackie, I. M. (1998) Use of mtDNA direct polymerase chain reaction (PCR) sequencing and PCR-restriction fragment length polymorphism methodologies in species identification of canned tuna. Journal of Agricultural Food Chemistry, 46(4), 1662-1669. 16. Wen-Feng, L. & Deng-Fwu, H. (2007) Application of PCR-RFLP analysis on species identification of canned tuna. Food Control, 18 (9), 1050-1057 17. Yang, D. Y., Cannon, A., & Saunders, S. H. (2004) DNA species identification of archaeological salmon bone from the Pacific Northwest Coast of North America. Journal of Archaeological Science 31, 619-631 18. Lopez-Pinon, M. J., Insua, A., & Mendez, J. (2002) Identification of four scallop species using PCR and restriction analysis of the ribosomal DNA internal transcribed spacer region. Marine Biotechnology, 4(5), 495-502.

19. Ward, R. D., Zemlak, T. S., Innes, H. B., Last, P. R., & Hebert, P. D. N. (2005) DNA barcoding Australia’s fish species. Philosophical Transactions of The Royal Society. Series B, Biological Sciences, 360(1462),1847-57.

20. Q01084 (87/88/89/90): Final optimisation and evaluation of DNA based methods for the authentication and quantification of meat species. Final Report.

6 FIGURES

Figure 1: Alignment of the consensus sequences from the 464bp region of the cytochrome b gene from fish species sequenced by Campden BRI

------+------+------+------+------+------+------+------+------+------+------+ ----AAAACCACCGTTGTTATTCAACTACAAGAACC--CTAATGACAAGCCTCCGTAAAACACACCCCCTATTAAAAATTGCTAATGACGCTTTAGTAGACCTACCCGCC Anglerfish ----AAAACCACCGTTGTTATTCAACTACAGAAACC--TTAATGACAAGCCTTCGAAAGACACACCCCCTGTTAAAAATTGCTAACCACGCACTAGTTGACCTCCCCGCG Black sea bream --TAAAAACCACCGTTGTTATTCAACTACAGGAAC-----AATGACTAGTCTACGAAAATCCCACCCTTTAATTAAAATCATTAACAGCTCCGTTATTGATCTCCCAGCC Dover sole ---AAAAACCACCGTTGTTATTCAACTACAAGAACC--CTAATGGCCAATCTACGAAAATCTCACCCCCTTCTAAAAATCGCAAACGATGCTTTAGTTGACCTCCCCGCC Lemon sole GTAAAAAACCACCGTTGTTATTCAACTACAAGAACC--TTAATGGCCAGCCTTCGGAAAACCCATCCAATTCTAAAAATTGCTAACGATGCACTAGTCGATCTTCCCGCC Pollock ----AAAACCACCGTTGTTATTCAACTAAGGGAGCA--TTAATGGCCGCCCTCCGTAAAACACACCCCTTATTAAAAATCGCAAATCATGCACTTGTTGATCTGCCGGCC Sea bass --TAAAAACCACCGTTGTTATTCAACTACAAGAACC--CTCATGGCCAGCCTACGCAAAACCCACCCACTGATTAAGATTGCAAATGATGCTTTAGTAGACCTYCCCGCT Red mullet --TAAAAACCACCGTTGTTATTCAACTATGGGAACC--CTAATGGCAAGCCTGCGAAAGACTCACCCACTTATAAAAATCGCCAACGACGCACTAGTCGACCTCCCGGCC Sardine ---AAAAACCACCGTTGTTATTCAACTACAAGAACC--CTAATGGCTAACCTACGAAAATCTCACCCCCTTCTAAAAATCGCAAACGATGCTTTAGTCGACCTCCCAGCC Witch --TAAAAACCACCGKTGTTATTCAACTATAAGAACT--TTAATGGCCAGCCTCCGAAAAACCCACCCAATTCTAAAAATTGCCAATGACGCACTAGTAGATCTCCCAGCC Ling --TAAAAACCACCGTTGTTATTCAACTACAAGAACCTTCTAATGGCAAGCCTACGCAAAACCCACCCACTACTAAAAATTGCTAACAACGCTCTAGTCGACCTTCCCGCA YT snapper --TAAAAACCACCGTTGTTATTCAACTACAAGAACC--CTAATGGCAAGCCTCCGAAAAACTCACCCATTATTAAAAATCGCTAACGACGCACTAGTTGACCTACCCACC Bonito --TAAAAACCACCGTTGTTATTCAACTACAAGAACC--CTAATGGCTAGCTTACGCAAAACGCATCCCCTCCTAAAAATTGCAAACGACGCAGTCGTCGACCTTCCAGCC Emperor --TAAAAACCACCGTTGTTATTCAACTACAAGAACC--CTAATGGCCAATCTCCGTAAATCCCACCCCCTTCTTAAAATCGCAAACGATGCTTTAGTTGATCTCCCAGCC Flounder --TAAAAACCACCGTTGTTATTCAACTATAGAAACC--CTAATGGCAAGCCTACGAAAAACCCACCCCCTTCTGAAGATTGCTAACGGCGCACTAGTGGACCTCCCGGCT Herring --TAAAAACCACCGTTGTTATTCAACTACAAGAAC---CTAATGGCCAACCTCCGAAAAACCCACCCTCTCCTAAAAATCGCTAATGACGCACTAGTCGACCTCCCAGCA Rainbow trout --TAAAAACCACCGTTGTTATTCAACTATAGAAACT--CTAATGGCTAGCCTACGCAAAACCCACCCACTCCTAAAAATCGCAAACGACGCCCTTGTTGACCTCCCTGCC Thread fin --TAAAAACCACCGTTGTTATTCAACTATAGGAACC--TTAATGACCAGCCTACGAAAATCCCACCCTATCCTAAAGATCGCAAATGATGCTTTAGTAGATCTCCCTGCC Turbot

------+------+------+------+------+------+------+------+------+------+------+ CCCTCCAATATCTCTGCATGATGGAACTTTGGCTCCTTACTAGCGCTCTGCTTAATTGCCCAAATCTTAACAGGACTATTTCTAGCCATACACTACACCTCTGATATCGC Anglefish CCCGCTAATATTTCTGTCTGATGAAATTTTGGATCCCTACTTGGTCTTTGCCTAATTTCCCAACTCCTCACAGGACTTTTCCTTGCCATACATTACACCTCAGACATCGC Blk sea bream CCTTCGAACATTTCTGCATGATGAAACTTTGGCTCCCTATTAGGCCTCTGCCTAATTACCCAAATTGTCACAGGACTCTTACTCGCAATGCACTATACAGCAGATGCCTC Dover sole CCCTCTAACATTTCTGTTTGATGAAACTTCGGGTCTCTTCTAGGACTCTGTTTAGTAACCCAAATTGCAACCGGCTTATTTCTAGCCATGCATTACACATCTGATATCGC Lemon sole CCCTCTAATATTTCAGTATGATGAAACTTTGGCTCTCTTTTAGGCCTTTGCTTAATCACTCAACTTCTAACAGGACTATTTCTAGCTATACACTACACTTCAGACATTGA Pollock CCTTCAAATATTTCAGTTTGATGAAATTTCGGTTCGCTCTTAGGCCTATGCTTGATTTCCCAAATTCTTACAGGTCTATTTTTAGCTATACATTATACCTCAGATATCGC Sea bass CCCTCCAACATCTCGGTATGATGAAACTTCGGCTCTCTGCTAGGCCTCTGCTTAGCCACTCAAATTGTAACAGGACTCTTCCTGGCAATACACTACACCTCTGATATCGC Red mullet CCCTCGAACATCTCGGTCTGATGAAACTTCGGATCGCTTCTTGGCCTCTGTCTAGCGGCCCAGATTCTGACAGGGTTGTTCTTAGCCATGCACTACACCTCTGACATCGC Sardine CCCTCTAACATCTCTGTTTGATGAAACTTCGGGTCTCTTCTGGGACTCTGCTTAGTAACTCAGATTGCAACTGGCTTATTTCTAGCCATACACTATACGTCCGATATTGC Witch CCTTCCAACATTTCAGTATGATGAAATTTCGGCTCTCTCCTGGGCCTCTGCTTAATTACTCAAATTTTAACAGGACTGTTTTTAGCAATACACTATACCTCAGATATCGA Ling CCCTCCAATATTTCAGTATGATGAAACTTTGGCTCCCTACTTGGCCTTTGCTTAATTGCCCAAATCCTAACAGGGCTTTTCCTCGCTATACATTACACCTCCGACATCAC YT snapper CCTTCCAATATCTCTGCATGATGAAATTTTGGCTCACTACTTGGCCTTTGCCTGATTTCCCAGATCCTCACAGGACTATTCCTAGCAATACATTATACCCCTGATGTCGA Bonito CCTTCAAACATCTCAGTTTGATGAAACTTTGGCTCCCTCCTTGGTCTCTGCTTAATTGCCCAGATTTTAACCGGGCTCTTCCTCGCAATACACTACACTTCCGACATCGC Emperor CCCTCAAACATCTCTGTCTGATGAAACTTTGGGTCCCTCTTAGGACTCTGTTTGGTAACCCAAATTGCCACCGGCTTATTCCTAGCTATACACTACACATCTGATATTGC Flounder CCCTCCAATATTTCAGTATGATGAAACTTTGGGTCCCTGCTCGGATTATGCCTAGCGGCACAAATCTTAACAGGACTGTTTTTAGCTATACACTACACTTCCGACATCGC Herring CCTTCTAATATCTCAGTCTGATGAAACTTTGGCTCACTACTAGGCCTATGTTTAGCTACCCAAATTCTTACCGGGCTCTTCCTAGCCATGCACTATACCTCCGACATTTC Rainbow trout CCCTCCAACATCTCGGCCTGGTGAAATTTTGGGTCTCTCCTAGGACTTTGTCTAGCCGCTCAAATCCTAACAGGTCTATTCCTCGCCATGCACTACACGTCTGATATCGC Thread fin CCCTCTAATATCTCAGTTTGATGAAACTTTGGCTCTCTTCTTGGCCTCTGCTTAGCCACTCAACTCATTACCGGACTCTTTTTAGCTATGCACTATACCGCGGATATCGC Turbot

------+------+------+------+------+------+------+------+------+------+------+ CACAGCTTTCTCCTCAGTAGCACACATCTGTCGAGACGTAAACTACGGATGACTAATCCGCAACCTTCATGCCAATGGGGCCTCCTTCTTCTTTATTTGCATCTATATGC Anglerfish CACAGCCTTTTCTTCTGTCGCACACATCTGCCGAGATGTAAATTACGGCTGACTCATCCGAAATCTTCACGCCAACGGAGCATCTTTCTTTTTTATTTGCATTTACCTTC Black sea bream TACCGCATTTTCCTCCGTCGTGCACATCTGCCGGGACGTTAATTATGGATGATTAATCCGAAATGTCCACGCCAACGGCGCATCATTCTTCTTTATTTGCATTTACCTTC Dover sole TACCGCTTTCACCTCCGTCGCCCACATCTGCCGGGACGTCAACTACGGCTGACTCATTCGAAGCATTCATGCCAATGGCGCATCATTCTTCTTCATTTGCATTTACCTCC Lemon sole AACAGCCTTCTCATCTGTGGTTCATATTTGCCGTGATGTAAATTACGGCTGATTGATCCGAAATATACACGCCAATGGCGCCTCTTTCTTCTTTATTTGCCTCTATATAC Pollock AACAGCCTTCTCCTCCATCGCACACATTTGTCGAGATGTTAACTATGGCTGACTTATCCGTAATCTTCACGCCAATGGTGCATCTTTCTTCTTTATTTGTATTTATCTTC Sea bass CACAGCTTTCTCCTCCGTTGCCCACATCTGCCGCGACGTTAACTATGGATGATTTATCCGTAACATACATGCAAACGGAGCATCCTTCTTCTTCATCTGCATCTACATGC Red mullet AACCGCCTTCTCTTCTGTTGCCCACATTTGTCGTGACGTAAACTACGGATGACTGATTCGAAGTATGCACGCAAATGGAGCATCTTTTTTCTTTATTTGTATTTACGCCC Sardine TACTGCTTTTACCTCCGTGGCCCACATCTGCCGAGACGTCAACTACGGCTGACTCATCCGAAGCATTCATGCCAACGGCGCATCCTTCTTTTTCATTTGCATCTACCTTC Witch AACAGCCTTTTCATCTGTTGTACACATCTGTCGTGATGTAAATTATGGATGACTAATCCGCAACATACATGCCAACGGTGCTTCTTTCTTCTTTATTTGCCTTTATATAC Ling AATGGCCTTCTCATCAGTTGCCCATATCTGCCGAGACGTAAACTACGGATGACTAATCCGTAACCTCCACGCCAACGGTGCCTCCTTCTTCTTCATCTGCATCTACCTCC YT snapper ATCAGCCTTCGCCTCAGTCGCCCACATTTGCCGAGACGTTAATTTCGGCTGACTAATCCGAAACCTCCACGCAAACGGCGCTTCCTTCTTCTTCATCTGCATCTACTTCC Bonito TACCGCTTTTTCCTCCGTTGCCCACATTTGCCGAGACGTCAACTACGGCTGACTCATCCGCAACCTTCATGCAAACGGAGCCTCCTTCTTCTTCATTTGCATCTACCTCC Emperor TACTGCCTTCACCTCCGTTGCACACATCTGTCGGGACGTCAACTACGGTTGACTCATCCGAAGCATTCATGCCAACGGTGCATCATTCTTTTTCATTTGCATTTACCTTC Flounder AACCGCATTCTCCTCTGTAATACACATTTGCCGAGATGTAAACTATGGGTGATTAATCCGAAACATACACGCAAACGGAGCATCATTCTTCTTCATCTGCATTTATGCAC Herring AACAGCTTTCTCCTCTGTTTGCCACATCTGCCGAGATGTTAGTTACGGCTGACTCATTCGAAACATCCATGCCAACGGAGCATCTTTCTTTTTTATCTGTATTTATATAC Rainbow trout AACAGCCTTTTCTTCCGTCGCCCACATCTGCCGAGACGTGAACTACGGCTGACTAATCCGGAATCTCCATGCAAATGGAGCATCCTTCTTCTTTATCTGCATCTACCTAC Thread fin AACAGCCTTTACCTCCGTCGCCCATATCACCCGAGACGTTAATTACGGTTGATTAATCCGAAACCTACACGCCAACGGCGCATCCTTCTTCTTCTTATGTATTTATGCAC Turbot

------+------+------+------+------+------+------+------+------+------+------+ ATATTGGACGAGGCTTGTATTACGGCTCTTACCTCTACAAAGAAACATGAAACGTTGGAGTAGTCCTTCTCCTCCTAGTTATAATGACAGCATTCGTAGGCTACGTTCTA Anglerfish ACATCGGACGAGGACTTTACTATGGTTCATATCTCTATAAAGAAACATGAAACATCGGAGTCGTTCTTCTCCTACTCGTTATAGGAACCGCCTTTGTGGGCTATGTCCTC Blk sea bream ACATCGGACGAGGACTTTACTACGGATCATATGTCAACAAAGAGACCTGAAACATCGGAGTTATCCTACTTATACTAGTTATAGCCACGGCCTTCGTAGGATACGTCCTC Dover sole ATATTGGTCGAGGCCTCTACTATGGCTCTTACCTCTATAAAGAGACATGAACTATCGGCGTTGTTCTTCTCCTCCTCGTAATAATAACCGCYTTCGTTGGTTACGTCCTC Lemon sole ATATTGCTCGAGGACTTTATTACGGCTCTTATCTCTTTGTAGAGACATGAAATATCGGCGTTGTTCTCTTCCTTTTAGTCATAATAACCTCTTTCGTAGGTTACGTTCTC Pollock ACATTGGCCGAGGCCTGTACTACGGCTCATACCTGTATAAAGAAACATGAAACATTGGGGTAATCCTTCTCCTCTTAGTAATAATGACAGCCTTCGTAGGCTATGTGCTG Sea bass ACATCGGACGAGGCCTCTACTACGGCTCATATCTATACAAAGAGACATGAAACGTCGGCGTTATTCTCCTCCTCCTAGTTATGATGACTGCCTTCGTRGGCTACGTCCTT Red mullet ACATTGGGCGAGGGCTCTATTATGGCTCCTATCTCTACAAGGAAACATGAAACATTGGAGTTGTCCTCCTTCTTTTGGTCATGATAACTGCCTTTGTTGGTTATGTCTTA Sardine ACATCGGCCGTGGCCTCTACTATGGCTCCTACCTCTATAAAGAGACATGAACCATCGGCGTTGTTCTCCTCCTCCTAGTAATAATGACAGCCTTTGTAGGCTACGTCCTA Witch ATATTGCCCGAGGACTCTACTATGGTTCCTACCTTTATGTAGAAACATGAAATATTGGAGTCGTTCTTTTCCTCCTAGTAATAATGACCTCCTTCGTAGGCTACGTACTT Ling ACATCGGCCGAGGCCTTTATTATGGCTCCTATCTCTATAAAGAAACATGAAACATTGGAGTTGTCCTCCTTCTCCTAGTGATAGCAACTGCCTTCGTAGGCTACGTCCTT YT snapper ATATTGGTCGAGGCCTTTACTACGGCTCCTACCTCTACAAAGAAACATGAAACATTGGCGTAGTCCTCCTACTTTTAGTAATGATGACCGCTTTCGTCGGCTACGTTCTT Bonito ACATCGGCCGAGGCCTGTACTATGGGTCTTACCTTTACAAAGAAACTTGAAACATCGGAGTTGTCCTGCTTCTTCTAGTAATGATGACCGCCTTCGTAGGATATGTCCTT Emperor ATATCGGCCGAGGTCTATACTATGGCTCTTACCTTTATAAGGAAACATGAACTATTGGAGTTGTACTACTGCTTCTCGTTATAATGACCGCCTTCGTTGGATACGTCCTC Flounder ATATCGCCCGAGGACTATACTACGGATCATACCTTTACAAGGAAACATGAACCATCGGGGTCGTCCTTCTCCTTCTAGTTATGATAACTGCCTTTGTAGGATACGTCCTA Herring ATATCGCCCGAGGACTTTACTACGGCTCGTACCTCTACAAAGAAACCTGGAATATCGGAGTTGTACTTTTACTTCTCACTATAATAACTGCCTTTGTAGGCTACGTCCTC Rainbow trout ACATTGGCCGAGGCCTATACTATGGCTCATACCTCTACATAGAAACATGAAACATTGGAGTAATCCTCTTACTATTGGTTATAATGACAGCCTTTGTAGGTTACGTCCTT Thread fin ATATCGGCCGAGGTCTGTACTACGGCTCTTACCTTTATAAAGAAACCTGAAACGTGGGAGTTATCCTTCTTCTTCTCGTTATAGCAACTGCCTTCGTCGGCTATGTTCTT Turbot

------+------+------+-- CCGTGAGGACAAATAGTCATTYTGAGG Anglerfish CCCTGAGGACAAATAGTCATTYTGAGGG Blk sea bream CCCTGAGGACAAATAGTCATTYTGAGGC-GC Dover_sole CCTTGAGGACAAATR-TCATTTTGAGGGCGCA Lemon sole CCCTGAGGACAAATG-TCATTYTGGGGG-GCA Pollock CCCTGAGGACAAATR-TCATTYTGAGGC-GCA Sea bass CCCTGAGGACAAATR-TCATTYTGAG Red mullet CCATGAGGACAAATR-TCATTYTGAGGC-GCA Sardine CCTTGAGGACAAATR-TCATTYTGAGGG-GC Witch CCCTGAGGACAAATR-TCATTCTGAGGC-GCA Ling CCCTGAGGACAAATR-TCATTYTGAGGCCGCA YT snapper CCCTGAGGACAAATR-TCATTYTGAGGCGCA Bonito CCATGAGGACAAATR-TCATTYTGAGGGCGCA Emperor CCTTGAGGACAAATR-TCATTYTGAGGCCGCA Flounder CCATGAGGACAAATR-TCATTYTGAGGC-GCA Herring CCGTGAGGACAAATR-TCATTYTGAGGC-GCA Rainbow trout CCCTGAGGACAAATR-TCATTYTGAGGC-GCA Thread fin CCCTGAGGACAAATR-TCATTYTGAGGGCGCA Turbot

Figure 2: Alignment of the 464bp region of the cytochrome b gene from tuna species. Complete mitochondrial sequence data from GenBank was trimmed to produce the 464bp region. Sequences were from Bullet tuna (Auxis rochei; AB103468, NC_005313), Frigate tuna (A. thazard; NC_005318), Skipjack tuna (Katsuwonus pelamis; NC_005316), Bluefin tuna (T. thynnus; NC_004901, AB097669) and Albacore tuna (T. alalunga; NC_005317).

15186 AAAAACCACCGTTGTAATTCAACTACAAGAACCCTAATGGCAAGCCTACGAAAAACTCACCCACTACTAAAAATCGCTAACGACGCACTAGTCGACCTCC AB103468 15184 AAAAACCACCGTTGTAATTCAACTACAAGAACCCTAATGGCAAGCCTACGAAAAACTCACCCACTACTAAAAATCGCTAACGACGCACTAGTCGACCTCC NC_005313 15189 AAAAACCACCGTTGTAATTCAACTACAAGAACCCTAATGGCAAGCCTACGAAAAACCCACCCACTACTAAAAATCGCTAACGACGCACTAGTTGACCTCC NC_005318 15198 AAAAACCACCGTTGTAATTCAACTACAAGAACCCTAATGGCAAGCCTCCGAAAAACCCACCCACTACTAAAAATCGCTAACGACGCACTAGTTGACCTCC NC_005316 14344 AAAAACCACCGTTGTAATTCAACTACAAGAACCTTAATGGCAAGCCTCCGAAAAACTCACCCGCTACTAAAAATCGCTAACGACGCACTAGTTGACCTTC NC_004901 15209 AAAAACCACCGTTGTAATTCAACTACAAGAACCCTAATGGCAAGCCTCCGAAAAACTCACCCGCTACTAAAAATCGCTAACGACGCACTAGTTGACCTTC AB097669 15210 AAAAACCACCGTTGTAATTCAACTACAAGAACCCTAATGGCAAGCCTCCGAAAAACTCACCCGCTACTAAAAATCGCTAACGACGCACTAGTTGACCTCC NC_005317

15286 CCACCCCCTCCAATATTTCCGCATGATGAAACTTTGGCTCACTACTTGGTCTCTGCCTTATTTCCCAAATCCTTACAGGCCTATTCCTTGCAATGCACTA AB103468 15284 CCACCCCCTCCAATATTTCCGCATGATGAAACTTTGGCTCACTACTTGGTCTCTGCCTTATTTCCCAAATCCTTACAGGCCTATTCCTTGCAATGCACTA NC_005313 15289 CCACCCCCTCCAATATTTCCGCATGATGAAACTTTGGCTCACTACTTGGTCTCTGCCTTATTTCCCAAATTCTTACAGGCCTATTCCTTGCAATACACTA NC_005318 15298 CCACCCCCTCTAACATTTCCGCATGATGAAACTTTGGCTCACTACTTGGTCTCTGCCTTATTTCCCAAATCCTAACAGGACTATTCCTCGCAATACACTA NC_005316 14444 CTACCCCCTCTAATATCTCTGCATGATGAAACTTTGGTTCACTACTTGGCCTTTGCCTTATTTCTCAGATCCTTACAGGACTATTCCTCGCAATACACTA NC_004901 15309 CTACCCCCTCTAATATCTCTGCATGATGAAACTTTGGCTCACTACTTGGCCTTTGCCTTATTTCTCAGATCCTTACAGGACTATTCCTCGCAATACACTA AB097669 15310 CTACCCCCTCTAATATCTCTGCATGATGAAACTTTGGCTCACTACTTGGCCTTTGCCTTATTTCTCAAATCCTTACAGGACTATTCCTCGCAATACACTA NC_005317

15386 CACCCCTGATGTCGAATCAGCCTTCGCCTCAGTCGCCCACATTTGCCGAGATGTAAACTTCGGCTGACTAATCCGAAACCTCCACGCCAACGGTGCTTCC AB103468 15384 CACCCCTGATGTCGAATCAGCCTTCGCCTCAGTCGCCCACATTTGCCGAGACGTAAACTTCGGCTGACTAATCCGAAACCTCCACGCCAACGGCGCTTCC NC_005313 15389 CACCCCTGATGTCGAATCAGCCTTCGCTTCAGTAGCCCACATTTGCCGAGATGTAAACTTTGGTTGACTTATCCGAAACCTCCACGCCAACGGCGCCTCC NC_005318 15398 TACCCCTGACGTAGAATCAGCCTTCGCCTCAGTAGCCCATATCTGCCGAGACGTAAACTTCGGATGACTCATCCGAAACCTCCATGCCAACGGCGCTTCC NC_005316 14544 CACCCCTGATGTCGAATCAGCCTTCGCCTCAGTAGCCCACATTTGCCGAGATGTCAACTTCGGTTGACTTATCCGGAACCTCCACGCAAACGGGGCCTCT NC_004901 15409 CACCCCTGATGTCGAATCAGCCTTCGCCTCAGTAGCCCACATTTGCCGAGATGTCAACTTCGGTTGACTTATCCGGAACCTCCACGCAAACGGGGCCTCT AB097669 15410 TACCCCTGATGTCGAATCAGCCTTCGCCTCAGTAGCCCACATTTGCCGAGATGTCAACTTCGGTTGACTCATCCGGAACCTCCACGCAAACGGGGCCTCT NC_005317

15486 TTCTTCTTCATCTGCATCTACTCACACATCGGACGAGGCCTTTACTACGGCTCTTACCTCTACAAAGAAACATGAAACATCGGTGTAGTCCTTCTACTAC AB103468 15484 TTCTTCTTCATCTGCATCTACTCACACATCGGACGAGGCCTTTACTACGGCTCTTACCTCTACAAAGAAACATGAAACATCGGTGTAGTCCTCCTTCTAC NC_005313 15489 TTCTTCTTCATCTGCATCTACTCACACATCGGACGAGGCCTTTACTACGGCTCCTACCTCTACAAAGAAACATGAAACATCGGCGTAGTTCTTCTACTGC NC_005318 15498 TTCTTCTTCATCTGCATTTACTCCCACATTGGCCGAGGTCTCTACTACGGTTCCTACCTCTACAAAGAAACATGAAACATCGGTGTAGTCCTACTTCTCC NC_005316 14644 TTCTTCTTTATCTGTATCTACTTCCACATCGGCCGAGGACTTTACTACGGCTCTTACCTATACAAAGAAACATGAAACATCGGAGTAGTACTCCTGCTCC NC_004901 15509 TTCTTCTTTATCTGTATCTACTTCCACATCGGCCGAGGACTTTACTACGGCTCTTACCTATACAAAGAAACATGAAACATCGGAGTAGTACTCCTACTCC AB097669 15510 TTCTTCTTTATCTGCATCTACTTCCACATCGGCCGAGGCCTTTACTACGGCTCTTACCTGTACAAAGAAACATGAAACATCGGAGTAGTACTCCTACTTC NC_005317

15586 TGGTCATGATGACTGCATTCGTCGGCTACGTACTCCCATGAGGACAAATGTCATTCTGAGGTGC AB103468 15584 TGGTCATGATAACTGCATTCGTCGGCTACGTACTCCCATGAGGACAAATGTCATTCTGAGGTGC NC_005313 15589 TAGTCATGATGACTGCATTCGTCGGCTACGTACTTCCATGAGGGCAAATGTCATTTTGAGGTGC NC_005318 15598 TAGTAATGATGACTGCTTTCGTCGGTTACGTACTTCCCTGAGGACAAATGTCATTCTGAGGAGC NC_005316 14744 TAGTTATGATGACCGCCTTCGTTGGCTACGTCCTTCCCTGAGGACAAATGTCTTTCTGAGGAGC NC_004901 15609 TAGTTATGATGACCGCCTTCGTTGGCTACGTCCTTCCCTGAGGACAAATGTCTTTCTGAGGAGC AB097669 15610 TAGTTATGATGACCGCCTTCGTTGGCTACGTCCTTCCCTGAGGACAAATGTCCTTCTGAGGAGC NC_005317 49

Figure 3: Alignment of 1200bp region of the cytochrome b gene from Salmonids. Sequence data obtained from GenBank. Accession codes correspond to NC_006897 Cut-throat trout(O. clarkii), NC_001717 Rainbow trout(O. mykiss), NC_002980 Chinook salmon(O. tshawytscha), NC_000861 Arctic char(S. alpinus), NC_000860 Brook trout(S. fontinalis) and NC_001960 Atlantic salmon(S. salar).

------+------+------+------+------+------+- A T G G C C A A C C T C C G A A A A A C C C A C C C A C T C C T A A A A A T C G C T A A T G A C G C A C T A G T C G A C NC_006897 A T G G C C A A C C T C C G A A A A A C C C A C C C T C T C C T A A A A A T C G C T A A T G A C G C A C T A G T C G A C NC_006897 A T G G C C A A C C T C C G A A A A A C C C A T C C T C T C C T A A A A A T C G C T A A T G A C G C A C T A G T C G A C NC_002980 A T G G C C A A C C T C C G A A A A A C C C A C C C A C T C C T A A A A A T T G C T A A T G A C G C A C T A G T C G A C NC_000861 A T G G C C A A C C T C C G A A A A A C C C A C C C A C T C C T A A A A A T T G C T A A T G A C G C A C T A G T C G A C NC_000860 A T G G C C A A C C T C C G A A A A A C T C A C C C G C T C C T A A A A A T T G C T A A T G A C G C A C T A G T C G A T NC_001960

------+------+------+------+------+------+- C T C C C A G C A C C T T C T A A C A T C T C A G T C T G A T G A A A C T T T G G C T C A C T C C T A G G C C T A T G T NC_006897 C T C C C A G C A C C T T C T A A T A T C T C A G T C T G G T G A A A C T T T G G C T C A C T A C T A G G C C T A T G T NC_001717 C T C C C A G C A C C C T C T A A C A T T T C A G T C T G A T G A A A C T T T G G C T C A C T C C T A G G C C T A T G T NC_002980 C T C C C T G C C C C C T C T A A T A T C T C A G T C T G A T G A A A C T T T G G T T C A C T C T T A G G C C T A T G T NC_000861 C T C C C T G C C C C C T C T A A T A T C T C A G T C T G A T G A A A C T T T G G T T C A C T C C T A G G C C T A T G T NC_000860 C T C C C A G C A C C A T C T A A C A T C T C A G T T T G A T G A A A C T T T G G C T C A C T C T T A G G C C T A T G T NC_001960

------+------+------+------+------+------+- T T A G C T A C C C A A A T T C T T A C C G G G C T C T T C C T A G C C A T G C A C T A T A C C T C C G A C A T T T C A NC_006897 T T A G C T A C C C A A A T T C T T A C C G G G C T C T T C C T A G C C A T G C A C T A T A C C T C C G A C A T T T C A NC_001717 T T A G C C A C C C A A A T T C T T A C C G G G C T C T T C T T A G C C A T A C A C T A T A C C T C C G A C A T T T C A NC_002980 T T G G C C A C C C A A A T T C T T A C C G G A C T C T T C C T A G C C A T A C A C T A C A C C T C C G A T A T T T C A NC_000861 T T A G C C A C C C A A A T T C T T A C C G G A C T C T T C C T A G C C A T A C A C T A C A C C T C C G A T A T T T C G NC_000860 C T A G C C A C C C A A A T C C T T A C C G G G C T C T T C C T A G C C A T A C A C T A C A C C T C C G A T A T C T C A NC_001960

------+------+------+------+------+------+- A C A G C T T T C T C C T C T G T C T G C C A C A T C T G C C G A G A T G T A A G T T A C G G C T G G C T C A T T C G A NC_006897 A C A G C T T T C T C C T C T G T T T G C C A C A T C T G C C G A G A T G T T A G T T A C G G C T G A C T C A T T C G A NC_001717 A C A G C T T T T T C C T C T G T C T G C C A C A T T T G C C G A G A T G T T A G T T A C G G C T G A C T C A T T C G A NC_002980 A C A G C T T T T T C C T C T G T G T G C C A T A T C T G C C G A G A T G T A A G T T A C G G C T G A C T C A T C C G G NC_000861 A C A G C T T T T T C C T C T G T A T G C C A C A T T T G T C G A G A T G T A A G T T A C G G C T G G C T C A T C C G A NC_000860 A C A G C T T T T T C C T C T G T T T G C C A C A T T T G C C G A G A T G T T A G C T A T G G C T G A C T C A T C C G T NC_001960

------+------+------+------+------+------+- A A C A T C C A T G C C A A C G G A G C A T C T T T C T T T T T T A T T T G T A T T T A T A T A C A T A T C G C C C G A NC_006897 A A C A T C C A T G C C A A C G G A G C A T C T T T C T T T T T T A T C T G T A T T T A T A T A C A T A T C G C C C G A NC_001717 A A T A T C C A C G C C A A C G G G G C A T C T T T C T T T T T T A T T T G C A T T T A T A T A C A T A T C G C C C G A NC_002980 A A T A T C C A C G C T A A C G G A G C A T C T T T C T T C T T T A T C T G T A T T T A T A T A C A T A T C G C C C G A NC_000861 A A T A T C C A C G C T A A C G G A G C A T C T T T C T T C T T T A T C T G T A T T T A T A T G C A T A T C G C C C G A NC_000860 A A C A T T C A C G C T A A C G G A G C A T C T T T C T T C T T T A T C T G T A T T T A T A T A C A C A T C G C C C G A NC_001960

------+------+------+------+------+------+- G G A C T T T A T T A C G G T T C A T A C C T G T A C A A A G A A A C C T G G A A T A T C G G A G T T G T A C T T T T A NC_006897 G G A C T T T A C T A C G G C T C G T A C C T C T A C A A A G A A A C C T G G A A T A T C G G A G T T G T A C T T T T A NC_001717 G G A C T T T A T T A T G G C T C T T A C C T C T A C A A A G A A A C C T G A A A T A T T G G G G T G G T A C T T C T A NC_002980 G G A C T C T A C T A C G G G T C C T A C C T A T A T A A A G A A A C C T G A A A T A T T G G A G T A G T A T T A C T A NC_000861 G G A C T A T A C T A C G G G T C C T A C C T A T A T A A A G A A A C C T G A A A T A T T G G G G T A G T A T T A T T A NC_000860 G G A C T T T A T T A T G G T T C C T A T C T A T A T A A A G A A A C C T G A A A T A T C G G A G T T G T A C T T C T A NC_001960

------+------+------+------+------+------+- C T T C T C A C T A T A A T A A C T G C C T T T G T A G G C T A C G T T C T C C C G T G A G G A C A A A T A T C G T T C NC_006897 C T T C T C A C T A T A A T A A C T G C C T T T G T A G G C T A C G T C C T C C C G T G A G G A C A A A T A T C A T T C NC_001717 C T T C T C A C T A T A A T A A C C G C C T T T G T A G G C T A C G T C C T C C C A T G A G G A C A A A T A T C C T T C NC_002980 C T T C T A A C T A T A A T G A C T G C C T T T G T A G G C T A C G T T C T T C C A T G A G G G C A A A T A T C C T T C NC_000861 C T T C T C A C T A T A A T G A C A G C T T T T G T A G G C T A C G T T C T C C C A T G A G G G C A A A T A T C C T T C NC_000860 C T T C T C A C T A T A A T A A C T G C C T T C G T A G G C T A C G T T C T T C C A T G A G G A C A A A T A T C C T T C NC_001960

------+------+------+------+------+------+- T G A G G G G C C A C T G T A A T T A C A A A C C T C C T C T C A G C T G T A C C C T A C G T A G G G G G C G C C C T A NC_006897 T G A G G G G C C A C T G T A A T T A C A A A C C T C C T C T C A G C T G T A C C A T A C G T A G G A G G C G C C C T A NC_001717 T G A G G G G C C A C T G T A A T C A C A A A C C T C C T C T C C G C T G T C C C G T A C G T A G G A G G C G C C C T A NC_002980 T G A G G A G C C A C T G T A A T C A C A A A C C T C C T C T C C G C T G T C C C T T A C G T A G G A G G T G C C C T T NC_000861 T G A G G G G C C A C T G T A A T T A C A A A C C T C C T C T C T G C T G T A C C C T A T G T A G G A G G T G C C C T T NC_000860 T G A G G A G C C A C T G T A A T T A C A A A C C T C C T C T C C G C T G T C C C C T A C G T A G G A G G C G C C C T T NC_001960

------+------+------+------+------+------+- G T A C A A T G A A T T T G A G G G G G G T T C T C T G T T G A C A A T G C C A C T C T A A C A C G A T T T T T C G C C NC_006897 G T A C A A T G A A T T T G A G G G G G C T T C T C C G T T G A C A A C G C C A C T C T A A C A C G A T T T T T C G C C NC_001717 G T A C A A T G A A T C T G A G G C G G G T T C T C T G T T G A C A A C G C T A C T C T A A C A C G A T T T T T C G C C NC_002980 G T A C A A T G A A T T T G A G G C G G A T T T T C T G T A G A C A A C G C C A C C C T A A C C C G A T T T T T C G C C NC_000861 G T A C A A T G A A T T T G A G G C G G A T T T T C T G T A G A C A A C G C C A C C C T A A C C C G A T T T T T C G C C NC_000860 G T A C A A T G A A T T T G A G G A G G A T T T T C T G T A G A C A A C G C C A C C C T A A C A C G A T T T T T C G C C NC_001960

------+------+------+------+------+------+- T T T C A C T T C C T A T T C C C T T T C G T C A T T G C A G C C G C T A C A G T C C T T C A C C T T C T G T T C C T T NC_006897 T T T C A C T T C C T A T T C C C C T T C G T C A T T G C A G C C G C T A C G G T C C T T C A C C T T C T G T T C C T T NC_001717 T T T C A C T T C C T A T T C C C C T T C G T C A T T G C A G C T G C T A C A G T C C T C C A C C T T C T G T T C C T T NC_002980 T T T C A C T T C C T A T T C C C C T T C G T T A T T G C A G C C G C C A C A G T A C T T C A C C T T C T A T T T C T G NC_000861 T T T C A C T T C C T A T T C C C A T T C G T T A T T G C A G C C G C C A C A G T G C T T C A C C T T C T A T T T C T A NC_000860 T T C C A C T T C C T A T T C C C A T T C G T T A T T G C A G C T G C C A C A G T A C T C C A T C T T C T A T T T T T A NC_001960

------+------+------+------+------+------+- C A T G A A A C A G G A T C T A A C A A C C C T G C A G G A A T T A A C T C C G A T G C C G A T A A A A T C T C G T T C NC_006897 C A T G A A A C A G G A T C T A A T A A C C C T G C A G G G A T T A A C T C T G A T G C T G A T A A A A T C T C A T T C NC_001717 C A T G A G A C A G G A T C T A A C A A C C C A G C A G G C A T T A A C T C C G A T G C C G A T A A A A T C T C C T T C NC_002980 C A T G A A A C C G G G T C C A A T A A C C C A G C A G G G A T T A A C T C C G A C G C C G A C A A A A T C T C A T T C NC_000861 C A T G A A A C C G G G T C C A A T A A C C C A G C A G G G A T T A A C T C C G A C G C T G A C A A A A T C T C A T T C NC_000860 C A T G A A A C C G G G T C T A A T A A C C C A G C A G G C A T C A A C T C C G A T G C C G A T A A A A T C T C A T T C NC_001960

------+------+------+------+------+------+- C A T C C T T A C T T C T C A T A C A A A G A T C T C C T A G G A T T C G T A G C C A T A C T T C T T G G T C T A A C A NC_006897 C A C C C T T A C T T C T C A T A C A A A G A T C T C C T A G G A T T C G T A G C C A T A C T C C T A G G C C T A A C A NC_001717 C A T C C C T A C T T C T C A T A C A A A G A T C T C C T A G G A T T C G T A G C C A T A C T T C T C G G T T T A A C A NC_002980 C A C C C C T A C T T C T C G T A C A A A G A C C T C C T C G G T T T C G T A G C T A T A T T G C T T G G C C T A A C A NC_000861 C A C C C C T A C T T C T C G T A C A A A G A T C T A T T A G G T T T T G T A G C T A T A T T A C T T G G C C T A A C A NC_000860 C A C C C T T A C T T C T C A T A T A A A G A C C T C C T C G G A T T T G T A G C C A T A C T A C T T G G C C T A A C A NC_001960

------+------+------+------+------+------+- T C C T T A G C T C T C T T T G C A C C A A A T C T C C T A G G G G A C C C A G A C A A T T T T A C T C C A G C C A A C NC_006897 T C C T T A G C T C T T T T T G C A C C A A A T C T C C T A G G G G A C C C A G A C A A T T T T A C G C C T G C C A A C NC_001717 T C C T T A G C T C T T T T T G C A C C A A A C C T C C T G G G G G A C C C G G A C A A T T T T A C G C C C G C C A A C NC_002980 A C C C T A G C T C T T T T C G C A C C T A A C C T C C T A G G A G A C C C G G A C A A T T T C A C A C C A G C C A A C NC_000861 A C C C T A G C T C T T T T C G C G C C T A A C C T C C T A G G A G A C C C A G A C A A T T T C A C G C C C G C C A A C NC_000860 T C C T T A G C T C T A T T C G C A C C C A A C C T C C T C G G G G A C C C A G A C A A T T T T A C A C C T G C C A A C NC_001960

------+------+------+------+------+------+- C C C C T A G T C A C C C C A C C T C A T A T T A A A C C A G A G T G G T A C T T C C T A T T C G C T T A C G C A A T C NC_006897 C C C C T A G T G A C C C C A C C T C A T A T T A A A C C C G A A T G A T A C T T C C T A T T C G C T T A C G C A A T C NC_001717 C C C C T G G T C A C C C C A C C T C A T A T C A A A C C C G A A T G A T A C T T C T T A T T C G C T T A C G C A A T C NC_002980 C C C C T A G T T A C C C C G C C A C A C A T C A A G C C C G A A T G G T A C T T C T T A T T C G C C T A T G C A A T T NC_000861 C C C C T A G T T A C C C C A C C C C A C A T C A A G C C C G A A T G G T A C T T C T T A T T C G C C T A C G C A A T T NC_000860 C C C C T A G T T A C T C C A C C T C A T A T C A A G C C T G A A T G A T A C T T C C T A T T C G C C T A C G C A A T C NC_001960

------+------+------+------+------+------+- T T A C G C T C C A T C C C C A A C A A G C T A G G A G G G G T A C T C G C C C T T T T A T T C T C A A T C C T T G T C NC_006897 C T A C G A T C C A T C C C C A A C A A G C T G G G A G G A G T A C T T G C C C T T T T A T T C T C G A T C C T T G T C NC_001717 C T A C G A T C T A T T C C C A A C A A A C T A G G A G G G G T A C T C G C C C T T T T A T T C T C G A T C C T T G T C NC_002980 C T C C G A T C T A T C C C C A A T A A A C T A G G A G G G G T A C T C G C C C T T T T A T T C T C A A T C C T C G T C NC_000861 C T A C G A T C T A T T C C C A A T A A G C T A G G A G G A G T A C T C G C C C T T T T A T T C T C G A T C C T T G T C NC_000860 C T A C G C T C C A T T C C T A A C A A A C T A G G C G G A G T A C T C G C C C T C T T A T T C T C G A T C C T G G T C NC_001960

------+------+------+------+------+------+- C T T A T G G T T G T C C C T A T T C T A C A C A C T T C T A A A C A A C G A G G A C T A A C C T T T C G A C C A C T A NC_006897 C T C A T G G T T G T C C C C A T C C T A C A C A C T T C T A A A C A A C G A G G A C T T A C C T T T C G A C C A C T C NC_001717 C T T A T A G T T G T T C C T A T C T T A C A C A C T T C C A A A C A A C G A G G A C T A A C C T T T C G A C C A C T G NC_002980 C T C A T A G T T G T C C C G A T C C T C C A C A C C T C T A A A C A G C G C G G A C T A A C C T T T C G A C C A C T A NC_000861 C T C A T A G T T G T G C C A A T C C T C C A C A C C T C C A A A C A G C G C G G A C T A A C C T T T C G A C C A C T A NC_000860 C T T A T A G T C G T C C C C A T C C T C C A T A C C T C T A A A C A A C G A G G A C T G A C C T T T C G C C C A C T C NC_001960

------+------+------+------+------+------+- A C C C A A T T C T T A T T T T G G G C C C T A G T A G C A G A T A T A C T T A T C C T C A C C T G A A T C G G A G G C NC_006897 A C C C A A T T C T T A T T T T G G G C C T T A G T A G C A G A T A T A C T C A T C C T C A C C T G A A T C G G A G G C NC_001717 A C C C A A T T C T T A T T T T G G G C C C T A G T A G C A G A T A T A C T T A T C C T C A C C T G A A T C G G A G G C NC_002980 A C T C A A T T C T T A T T C T G A A C C C T G G T A G C A G A C A T A C T A A T C C T C A C C T G A A T T G G G G G C NC_000861 A C T C A A T T C T T A T T C T G A A C C C T A G T A G C G G A C A T A C T T A T C C T C A C C T G A A T T G G G G G C NC_000860 A C C C A A T T C T T A T T C T G G A C C C T G G T A G C G G A C A T A C T A A T C C T T A C C T G A A T T G G A G G C NC_001960

------+------+------+------+------+------+- A T A C C C G T A G A A C A C C C C T T C A T T A T T A T T G G C C A A G T T G C C T C T G T A A T T T A C T T C G C C NC_006897 A T A C C T G T A G A A C A C C C C T T C A T T A T T A T C G G A C A A G T C G C C T C T G T A A T T T A C T T C A C C NC_001717 A T G C C C G T A G A A C A C C C A T T C A T C A T C A T C G G C C A A A T T G C C T C T G T A A T C T A C T T C A C C NC_002980 A T G C C T G T A G A A C A C C C A T T T A T C A T T A T C G G C C A A G T T G C C T C T G T G A T T T A C T T C A C C NC_000861 A T G C C C G T A G A A C A C C C A T T C A T C A T T A T C G G C C A A G T T G C C T C T G T G A T T T A C T T C A C C NC_000860 A T A C C C G T G G A A C A C C C A T T C A T T A T C A T T G G T C A A A T T G C C T C T G T A A T T T A C T T T A C T NC_001960

------+------+------+------+------+------+- A T C T T C C T A G T T C T T T C C C C C T T A G C C G G C T G G G C C G A A A A T A A A G C C C T C C A A T G A G C C NC_006897 A T C T T C C T A G T T C T T T C C C C C T T A G C C G G C T G G G C C G A A A T T A A A G C C C T C C A A T G A G C C NC_001717 A T C T T C C T A A T T C T T T C G C C C T T A G C C G G C T G G G C C G A G A A T A A A G C C C T C C A A T G A G C C NC_002980 A T C T T C C T A G T C C T C G C C C C C T T A G C C G G T T G G G C C G A A A A T A A A G C C C T T G A A T G A G C C NC_000861 A T C T T C C T A G T C C T T G C C C C A T T A G C C G G C T G G G C T G A A A A T A A A G C C C T T G A A T G A G C C NC_000860 A T C T T C C T A G T C C T T G C C C C C C T G G C T G G C T G A G C T G A A A A T A A A G C T C T T G A A T G A A C C NC_001960

------+------+------+------+------+------T G C C C T A G T A G C T C A G C G C C A G A G C G C C G G T C T T G T A A T C C G G A A G T C G G A G G T T NC_006897 T NC_001717 T NC_002980 T NC_000861 T NC_000860 T NC_001960

Figure 4: Alignment of 168bp region of the cytochrome b gene from Salmonids corresponding to the region defined by Yang et al, 200417. Sequence data obtained from GenBank. Restriction enzyme sites for Bfa1 (CTAG), CviKl-1 (RGCY) and Dde1 (CTNAG) are shown in bold, underlined and bold italics respectively.

AAAATCGCTAATGACGCACTAGTCGACCTCCCAGCACCCTCTAACATCTCAGTCTGATGAAACTTTGGCTCACTCCTAGGCCTATGTTTAGCCACCCAAATT O kisutch AAAATCGCTAATGACGCACTAGTCGACCTCCCAGCACCATCTAACATCTCAGTCTGATGAAACTTTGGCTCACTACTAGGCCTATGTTTAGCCACCCAAATT O nerka AAAATCGCTAATGACGCACTAGTCGACCTCCCAGCACCTTCTAACATCTCAGTCTGATGAAACTTTGGCTCACTCCTAGGCCTATGTTTAGCTACCCAAATT O clarki AAAATCGCTAATGACGCACTAGTCGACCTCCCAGCACCATCTAACATCTCAGTCTGATGAAACTTTGGCTCACTCCTAGGCTTATGCCTAGCCACCCAAATT O gorbuscha AAAATCGCCAATGACGCACTAGTCGACCTCCCAGCACCATCTAACATCTCAGTCTGATGAAACTTTGGTTCACTCCTGGGCTTATGCCTAGCCACCCAAATT O keta AAAATCGCTAATGACGCACTAGTCGATCTACCAACACCATCCAACATCTCCGTCTGATGAAACTTTGGCTCACTTTTAGGCCTATGTCTAGCCACCCAAATT O masou AAAATCGCTAATGACGCACTAGTCGACCTCCCAGCACCTTCTAATATCTCAGTCTGATGAAACTTTGGCTCACTACTAGGCCTATGTTTAGCTACCCAAATT O mykiss AAAATTGCTAATGACGCACTAGTCGACCTCCCTGCCCCCTCTAATATCTCAGTCTGATGAAACTTTGGTTCACTCTTAGGCCTATGTTTGGCCACCCAAATT S alpinus AAAATTGCTAATGACGCACTAGTCGACCTCCCTGCCCCCTCTAATATCTCAGTATGATGAAACTTTGGTTCACTCTTAGGCCTATGTTTGGCCACCCAAATT S boganidae AAAATTGCTAATGACGCACTAGTCGACCTCCCTGCCCCCTCTAATATCTCAGTCTGATGAAACTTTGGTTCACTCCTAGGCCTATGTTTAGCCACCCAAATT S fontinalis AAAATTGCTAATGACGCACTAGTCGACCTCCCTGCCCCCTCTAACATCTCAGTCTGATGAAACTTTGGTTCACTCTTAGGCCTGTGTTTAGCCACCCAAATT S leucomaenis AAAATTGCTAATGACGCACTAGTCGACCTACCTGCCCCCTCCAATATTTCCGTCTGATGAAACTTTGGTTCACTCTTGGGCCTATGTTTAGCCACCCAAATT S levanidovi AAAATTGCTAATGACGCACTAGTCGACCTCCCTGCCCCCTCTAATATCTCAGTCTGATGAAACTTTGGTTCACTCTTAGGCCTATGTTTGGCCACCCAAATT S namaycush AAAATTGCTAATGACGCACTAGTCGATCTCCCAGCACCATCTAACATCTCAGTTTGATGAAACTTTGGCTCACTATTAGGCCTATGTCTAGCCACCCAAATC S salar AAAATCGCTAACGACGCACTAGTCGACCTCCCTGCCCCCTCTAATATCTCAGTCTGATGAAACTTTGGTTCACTCTTAGGCCTATGTTTGGCCACCCAAATT S taranetzi AAAATTGCTAATGACGCACTAGTCGATCTCCCAGCACCATCTAACATCTCAGTTTGATGAAACTTTGGCTCACTCTTAGGCTTRTGTCTAGCCACCCAAATT S trutta

CTTACCGGGCTCTTCTTAGCCATGCACTATACCTCCGACATTTCAACAGCTTTTTCCTCTGTCTGC O kisutch CTTACCGGGCTCTTCCTAGCCATACACTATACCTCCGACATTTCAACAGCTTTTTCCTCCGTCTGC O nerka CTTACCGGGCTCTTCCTAGCCATGCACTATACCTCCGACATTTCAACAGCTTTCTCCTCTGTCTGC O clarki CTTACCGGGCTATTCCTAGCCATGCACTACACTTCCGACATTTCAACAGCTTTTTCCTCTGTCTGC O gorbuscha CTTACCGGGCTCTTCCTAGCCATGCACTACACCTCCGACATTTCAACAGCTTTTTCCTCTGTCTGC O keta CTTACCGGACTCTTCTTAGCCATGCACTACACCTCAGATATTTCAACAGCTTTTTCCTCTGTCTGC O masou CTTACCGGGCTCTTCCTAGCCATGCACTATACCTCCGACATTTCAACAGCTTTCTCCTCTGTTTGC O mykiss CTTACCGGACTCTTCCTAGCCATACACTACACCTCCGATATTTCAACAGCTTTTTCCTCTGTGTGC S alpinus CTTACCGGACTCTTCCTAGCCATACACTACACCTCCGATATTTCAACAGCTTTTTCCTCTGTATGC S boganidae CTTACCGGACTCTTCCTAGCCATACACTACACCTCCGATATTTCGACAGCTTTTTCCTCTGTATGC S fontinalis CTTACCGGGCTCTTCCTAGCCATACACTACACCTCCGATATTTCAACAGCTTTTTCCTCTGTGTGC S leucomaenis CTTACCGGACTCTTCCTAGCCATACACTATACCTCCGATATTTCAACAGCTTTTTCCTCTGTGTGC S levanidovi CTTACCGGACTCTTCCTAGCCATACACTATACCTCCGATATTTCAACAGCTTTCTCCTCTGTGTGC S namaycush CTTACCGGGCTCTTCCTAGCCATACACTACACCTCCGATATCTCAACAGCTTTTTCCTCTGTTTGC S salar CTTACCGGACTCTTCCTAGCCATACACTACACCTCCGATATTTCAACAGCTTTTTCCTCTGTATGC S taranetzi CTTACCGGACTCTTCCTAGCCATACACTACACCTCCGATATCTCAACAGCCTTTTCCTCTGTTTGC S trutta

Figure 5: Electropherogram of a Coho salmon PCR product digest with CvikI-I

The enzyme Cvik-I produced several small fragments which co-migrated with the marker. The Bioanalyzer automatically assigns the lower marker fragment. In this case it assigned the 15bp marker as the wrong peak and this led to incorrect sizing of the PCR RFLP fragments.

Figure 6: Electropherogram showing Bfa I digest of canned salmon species

Food and Safety with 1 2 3 4 5 6 the7 2100 bioanalyzer8 9

Partial digests 92

57 57 57 50 50 50

30 30 PCR artefact band LSCA / Bioanalyzer Fish ID Russell McInnes, 11-Sep-05 Page 13

Key Lanes 1& 2-Chum lanes 3& 4-Red lanes 5& 6-Pink, lanes 7& 8-Coho lane 9-Chinook

This figure shows the Bioanlyzer generated gel-like image from the 5 salmon species Bfa I digests that has been magnified to show the DNA fragment below 100bp. Theoretical fragment sizes are marked in red. Artefact band and partial digest DNA bands are also marked. The green spots indicate DNA fragments which are unique to thespecies. Coho and Chinook salmon species gives the same Bfa I profile.

Page 57 of 153

Last printed 14/08/2013 09:50:00

L:\Food Authenticity\Archive\AUTHENTICITY\Research Projects\Final reports\Reports\Q01099 Fish _CCFRA\FINAL VERSIONS AUGUST 2010\Q01099 Final Report August 2010.doc

Figure 7a: PCR amplification of 178bp target and Mnl I digest of authentic unprocessed tuna species

L 1 2 3 4 5 6 7 8 9 10 11 12

)

Key L-ladder lanes 1& 2-undigested PCR product lanes 3 & 12- controls lanes 4 &5-T. alalunga, 6-7-T. albacares lanes 8 & 9- T. obesus lanes 10 & 11-K. pelamis

Figure 7b: Electropherogram images from the Mnl I digest of the four tuna species

Thunnus alalunga (Albacore)

Thunnus albacares (Yellowfin)

Thunnus obesus (Bigeye)

Katsuwonus pelamis (Skipjack)

Page 58 of 153

Last printed 14/08/2013 09:50:00

L:\Food Authenticity\Archive\AUTHENTICITY\Research Projects\Final reports\Reports\Q01099 Fish _CCFRA\FINAL VERSIONS AUGUST 2010\Q01099 Final Report August 2010.doc

Figure 8: PCR-RFLP analysis of eight commercial canned tuna products

1 2 3 4 5 6 7 8 9

BsiYI digest

MnlI digest

MboI digest

Key- lane 1, 3, 4, 5 & 6 products labelled as tuna lane 2 product labelled as Yellowfin tuna lane 7 product labelled as Skipjack tuna lane 8 product labelled as Albacore tuna lane 9 control reference sample of Albacore tuna

Page 59 of 153

Last printed 14/08/2013 09:50:00

L:\Food Authenticity\Archive\AUTHENTICITY\Research Projects\Final reports\Reports\Q01099 Fish _CCFRA\FINAL VERSIONS AUGUST 2010\Q01099 Final Report August 2010.doc Figure shows the Bioanalyzer generated gel-like images for digests with the three enzymes. The actual images shown were prepared by zooming into the regions below 200bp . These have been aligned on top of each other to allow easy comparison.

7 Appendix

A. Species covered by the FishTrace Database

B. 464bp cyt b PCR-RFLP profiles generated by Campden BRI from FishTrace sequence data

C. Comparison of experimental PCR-RFLP profiles to theoretical profiles produced from FishTrace sequence data and Campden BRI sequence data

D. Standard operating procedure for canned salmon

E. Standard operating procedure for canned tuna

F. Standard operating procedure for scallops

Page 60 of 153

Last printed 14/08/2013 09:50:00

L:\Food Authenticity\Archive\AUTHENTICITY\Research Projects\Final reports\Reports\Q01099 Fish _CCFRA\FINAL VERSIONS AUGUST 2010\Q01099 Final Report August 2010.doc

Appendix A: Species covered by the FishTrace Database

Latin Name Family Common name Abudefduf luridus Pomacentridae Canary damsel Agonus cataphractus Agonidae Hooknose Alosa fallax Clupeidae Alosa Aluterus scriptus Monacanthidae Scrawled filefish Anarhichas lupus Anarhichadidae Wolf-fish Anguilla anguilla Anguillidae European eel Aphanopus carbo Trichiuridae Black scabbardfish Argentina sphyraena Argentinidae Argentine Argyrosomus regius Scienidae Meagre, corvina Aspitrigla cuculus Triglidae Red gurnard Atherina boyeri Atherinidae Big-scale sand smelt Atherina presbyter Atherinidae Sand smelt Auxis rochei Scombridae Bullet tuna Balistes capriscus Balistidae Grey triggerfish Belone belone Belonidae Garpike Beryx decadactylus Berycidae Alfonsino Boops boops Sparidae Bogue Brama brama Bramidae Atlantic pomfret Brosme brosme Lotidae Tusk Brotula barbata Ophidiidae Bearded brotula Buglossidium luteum Soleidae Solenette Caranx crysos Carangidae Blue runner Centrolophus niger Centrolophidae Blackfish Cephalopholis taeniops Serranidae African hind Chelidonichthys gurnadus Triglidae Grey gurnard Chelidonichthys lastoviza Triglidae Streaked gurnard Chelidonichthys lucernus Triglidae Tub gurnard Chelidonichthys obscurus Triglidae Longfin gurnard Chlorophthalmus agassizi Chlorophthalmidae Shortnose greeneye Chromis limbata Pomacentridae Azores chromis Ciliata septentrionalis Lotidae Northern rockling Citharus linguatula Citharidae Spotted flounder Clupea harengus Clupeidae Atlantic herring Coryphaena equiselis Coryphaenidae Pompano dolphinfish Coryphaena hippurus Coryphaenidae Common dolphinfish Cyclopterus lumpus Cyclopteridae Lumpfish Page 61 of 153

Last printed 14/08/2013 09:50:00

L:\Food Authenticity\Archive\AUTHENTICITY\Research Projects\Final reports\Reports\Q01099 Fish _CCFRA\FINAL VERSIONS AUGUST 2010\Q01099 Final Report August 2010.doc Dactylopterus volitans Dactylopteridae Flying gurnard Dentex dentex Sparidae Common dentex Dentex macrophthalmus Sparidae Large-eye dentex Dicentrarchus labrax Moronidae European seabass Dicologlossa cuneata Soleidae Wedge sole Diplodus annularis Sparidae Annular seabream Diplodus cervinus Sparidae Zebra seabream Diplodus puntazzo Sparidae Sharpsnout seabream Diplodus sargus Sparidae White seabream Diplodus vulgaris Sparidae Common two-banded seabream Echiichthys vipera Trachinidae Lesser weever Enchelycore anatina Muraenidae Fangtooth moray Enchelyopus cimbrius Lotidae Fourbeard rockling Engraulis encrasicolus Engraulidae European anchovy Epinephelus caninus Serranidae Dogtooth grouper Epinephelus costae Serranidae Goldblotch grouper Epinephelus marginatus Serranidae Dusky grouper Epinephelus tauvina Serranidae Greasy grouper Erythrocles monodi Emmelichthyidae Atlantic rubyfish Euthynnus alletteratus Scombridae Little tunny Gadiculus argenteus Gadidae Silvery pout Gadus morhua Gadidae Atlantic cod Glyptocephalus cynoglossus Pleuronectidae Witch Gymnothorax afer Muraenidae Dark moray Helicolenus dactylopterus Sebastidae Blackbelly rosefish Heteropriacanthus cruentatus Priacanthidae Glasseye Hippoglossoides platessoides Pleuronectidae American plaice Hippoglossus hippoglossus Pleuronectidae Atlantic halibut Hyperoplus lanceolatus Ammodytidae Greater sandeel Katsuwonus pelamis Scombridae Skipjack tuna Lepidorhombus boscii Scophthalmidae Fourspotted megrim Lepidorhombus whiffiagonis Scophthalmidae Megrim Lepidotrigla cavillone Triglidae Large-scaled gurnard Lichia amia Carangidae Leerfish Limanda limanda Pleuronectidae Dab Liparis liparis Liparidae Striped seasnail Lithognathus mormyrus Sparidae Striped seabream Liza aurata Mugilidae Golden grey mullet Liza ramado Mugilidae Thinlip mullet Lophius budegassa Lophiidae Black-bellied angler Lophius piscatorius Lophiidae Angler Makaira nigricans stiophoridae Atlantic blue marlin Melanogrammus aeglefinus Gadidae Haddock Merlangius merlangus Gadidae Whiting Merluccius australis Merlucciidae Southern hake Merluccius capensis Merlucciidae Cape hake Merluccius merluccius Merlucciidae European hake Merluccius polli Merlucciidae Benguela hake

Page 62 of 153

Last printed 14/08/2013 09:50:00

L:\Food Authenticity\Archive\AUTHENTICITY\Research Projects\Final reports\Reports\Q01099 Fish _CCFRA\FINAL VERSIONS AUGUST 2010\Q01099 Final Report August 2010.doc Microchirus theophila Soleidae Bastard Sole Microchirus variegatus Soleidae Thickback sole Micromesistius poutassou Gadidae Blue whiting Microstomus kitt Pleuronectidae Lemon sole Molva molva Lotidae Ling Mugil cephalus Mugilidae Flathead grey mullet Mullus barbatus Mullidae Striped mullet Mullus surmuletus Mullidae Red mullet Muraena augusti Muraenidae Muraena augusti Muraena robusta Muraenidae Stout moray Myoxocephalus scorpius Cottidae Shorthorn sculpin Oblada melanura Sparidae Saddled seabream Osmerus eperlanus Osmeridae European smelt Pagellus acarne Sparidae Axillary seabream Pagellus bellottii Sparidae Red pandora Pagellus bogaraveo Sparidae Blackspot seabream Pagellus erythrinus Sparidae Common pandora Pagrus pagrus Sparidae Common seabream Pegusa lascaris Soleidae Sand sole Phrynorhombus norvegicus Scophthalmidae Norwegian topknot Phycis blennoides Phycidae Greater forkbeard Phycis phycis Phycidae Forkbeard Platichthys flesus Pleuronectidae European flounder Pleuronectes platessa Pleuronectidae European plaice Pollachius pollachius Gadidae Pollack Pollachius virens Gadidae Pollock Polyprion americanus Polyprionidae Wreckfish Pomadasys incisus Haemulidae Bastard grunt Pomatomus saltatrix Pomatomidae Bluefish Psetta maxima Scophthalmidae Turbot Pseudocaranx dentex Carangidae White trevally Ranzania laevis Molidae Slender sunfish Ruvettus pretiosus Gempylidae Oilfish Salmo salar Salmonidae Atlantic salmon Salmo trutta Salmonidae Sea trout Sarda sarda Scombridae Atlantic bonito Sardina pilchardus Clupeidae European pilchard Sardinella aurita Clupeidae Round sardinella Sardinella maderensis Clupeidae Madeiran sardinella Sarpa salpa Sparidae Salema Scarus hoefleri Scaridae Guinean parrotfish Schedophilus ovalis Centrolophidae Imperial blackfish Schedophilus velaini Centrolophidae African barrelfish Scomber colias Scombridae Scombro Scomber scombrus Scombridae Atlantic mackerel Scophthalmus rhombus Scophthalmidae Brill Scorpaena elongata Scorpaenidae Slender rockfish Scorpaena porcus Scorpaenidae Black scorpionfish

Page 63 of 153

Last printed 14/08/2013 09:50:00

L:\Food Authenticity\Archive\AUTHENTICITY\Research Projects\Final reports\Reports\Q01099 Fish _CCFRA\FINAL VERSIONS AUGUST 2010\Q01099 Final Report August 2010.doc Scorpaena scrofa Scorpaenidae Largescaled scorpionfish Sebastes viviparus Sebastidae Norway redfish Seriola carpenteri Carangidae Guinean amberjack Seriola dumerili Carangidae Greater amberjack Seriola fasciata Carangidae Lesser amberjack Seriola rivoliana Carangidae Almaco jack Serranus atricauda Serranidae Blacktail comber Serranus cabrilla Serranidae Comber Serranus hepatus Serranidae Brown comber Serranus scriba Serranidae Painted comber Solea senegalensis Soleidae Senegalese sole Solea solea Soleidae Common sole Sparisoma rubripinne Scaridae Redfin parrotfish Sparus aurata Sparidae Gilthead seabream Sphoeroides pachygaster Tetraodontidae Blunthead puffer Sphyraena sphyraena Sphyraenidae European barracuda Spicara maena Centracanthidae Blotched picarel Spicara smaris Centracanthidae Picarel Spondyliosoma cantharus Sparidae Black seabream Sprattus sprattus Clupeidae European sprat Synaptura lusitanica Soleidae Portuguese sole Synaptura sp. Soleidae Lenguado sp. Synapturichthys kleinii Soleidae Klein's sole Taractichthys longipinnis Bramidae Bigscale pomfret Taurulus bubalis Cottidae Longspined bullhead Thunnus alalunga Scombridae Albacore Thunnus albacares Scombridae Yellowfin tuna Thunnus obesus Scombridae Bigeye tuna Thunnus thynnus Scombridae Northern bluefin tuna Trachinus draco Trachinidae Greater weever Trachinus radiatus Trachinidae Starry weever Trachurus mediterraneus Carangidae Mediterranean horse mackerel Trachurus picturatus Carangidae Blue jack mackerel Trachurus trachurus Carangidae Atlantic horse mackerel Trigla lyra Triglidae Piper gurnard Triglopsis quadricornis Cottidae Fourhorn sculpin Trisopterus esmarkii Gadidae Norway pout Trisopterus luscus Gadidae Pouting Trisopterus minutus Gadidae Poor cod Umbrina canariensis Scienidae Canary drum Uranoscopus scaber Uranoscopidae Atlantic stargazer Xiphias gladius Xiphiidae Swordfish Xyrichthys novacula Labridae Pearly razorfish Zeus faber Zeidae John dory Zoarces viviparus Zoarcidae Viviparous blenny

Page 64 of 153

Last printed 14/08/2013 09:50:00

L:\Food Authenticity\Archive\AUTHENTICITY\Research Projects\Final reports\Reports\Q01099 Fish _CCFRA\FINAL VERSIONS AUGUST 2010\Q01099 Final Report August 2010.doc

Appendix B - 464bp Cyt b PCR-RFLP profiles from FishTrace sequence data ISSUED 01/05/07

FISHTRACE DB ID FISH SPECIES DdeI FRAGMENTS HaeIII FRAGMENTS NlaIII FRAGMENTS CODE

Abudefduf luridus AbuLur-MA-01 uncut 157, 137, 126, 40 193, 152, 89, 26

Abudefduf luridus AbuLur-MA-02 uncut 157, 137, 126, 40 193, 152, 89, 26

Agonus cataphractus AgoCat-NS-01 439, 24 236, 126, 100 284, 180

Agonus cataphractus AgoCat-NS-02 439, 24 236, 126, 100 284, 180

Alosa alosa AloAlo-CB-02 439, 24 332, 132 280, 92, 90

Alosa alosa AloAlo-CB-03 439, 24 332, 132 280, 92, 90

Alosa fallax AloFal-NS-01 439, 24 332, 132 280, 92, 90

Alosa fallax AloFal-NS-02 439, 24 332, 132 280, 92, 90

Alosa fallax AloFal-CB-01 439, 24 332, 132 280, 92, 90

Alosa fallax AloFal-CB-02 439, 24 332, 132 280, 92, 90

Alosa fallax AloFal-SB-01 439, 24 332, 126, 4 280, 92, 90

Alosa fallax AloFal-SB-02 439, 24 332, 132 280, 92, 90

Aluterus scriptus AluScr-CI-02 258, 205 179, 157, 126 284, 92, 86

Anarhichas lupus AnaLup-EE-01 318, 118, 24 149, 132, 94, 85 284, 92, 48, 36

Anarhichas lupus AnaLup-NS-01 318, 118, 24 149, 132, 94, 85 284, 92, 48, 36

Anarhichas lupus AnaLup-NS-02 318, 118, 24 149, 132, 94, 85 284, 92, 48, 36

Anarhichas lupus AnaLup-SB-01 318, 118, 24 149, 132, 94, 85 284, 92, 48, 36

Anarhichas lupus AnaLup-SB-02 318, 118, 24 149, 132, 94, 85 284, 92, 48, 36

Anarhichas minor AnaMin-EE-01 318, 118, 24 149, 132, 94, 85 284, 92, 48, 36

Anarhichas minor AnaMin-EE-02 318, 118, 24 149, 132, 94, 85 284, 92, 48, 36

Anguilla anguilla AngAng-CS-01 234, 229 295, 169 159, 123, 86, 64, 26

Anguilla anguilla AngAng-CS-02 234, 229 295, 169 159, 123, 86, 64, 26

Anguilla anguilla AngAng-CB-01 234, 229 295, 169 159, 123, 86, 64, 26

Anguilla anguilla AngAng-CB-02 234, 229 uncut 159, 123, 86, 64, 26

Anguilla anguilla AngAng-SB-01 234, 229 uncut 159, 123, 86, 64, 26

Anguilla anguilla AngAng-SB-02 234, 229 295, 169 159, 123, 86, 64, 26

Page 65 of 153

Last printed 14/08/2013 09:50:00

Aphanopus carbo AphCar-CI-02 439, 24 332, 132 284, 92, 86

Aphanopus carbo AphCar-MA-01 439, 24 332, 132 284, 92, 86

Aphanopus carbo AphCar-MA-02 439, 24 332, 132 284, 92, 86

Argentina sphyraena ArgSph-SB-01 uncut 290, 132, 40 193, 114, 89, 36, 26

Argentina sphyraena ArgSph-SB-02 uncut 290, 132, 40 193, 114, 89, 36, 26

Argyrosomus regius ArgReg-EE-01 279, 118, 36, 24 149, 126, 110, 69, 4 217, 153, 92

Argyrosomus regius ArgReg-EE-02 279, 118, 36, 24 149, 126, 110, 69, 4 217, 153, 92

Aspitrigla cuculus AspCuc-WM-01 uncut 149, 140, 126, 28, 9, 4 322, 114, 26

Aspitrigla cuculus AspCuc-WM-02 uncut 149, 140, 126, 28, 9, 4 284, 114, 36, 26

Aspitrigla cuculus AspCuc-CS-01 uncut 149, 140, 126, 28, 9, 4 284, 114, 36, 26

Aspitrigla cuculus AspCuc-CS-02 uncut 149, 140, 126, 28, 9, 4 284, 114, 36, 26

Aspitrigla cuculus AspCuc-NS-01 uncut 149, 140, 126, 28, 9, 4 284, 114, 36, 26

Aspitrigla cuculus AspCuc-NS-02 uncut 149, 140, 126, 28, 9, 4 284, 114, 36, 26

Aspitrigla cuculus AspCuc-CB-01 uncut 149, 140, 126, 28, 9, 4 284, 114, 36, 26

Aspitrigla cuculus AspCuc-CB-02 uncut 149, 140, 126, 28, 9, 4 284, 114, 36, 26

Atherina boyeri AthBoy-EM-01 439, 24 149, 146, 126, 28, 9 193, 180, 89

Atherina boyeri AthBoy-EM-02 439, 24 149, 146, 126, 28, 9 193, 180, 89

Atherina presbyter AthPre-MA-01 439, 24 315, 149 284, 120, 58

Atherina presbyter AthPre-MA-02 439, 24 315, 149 284, 120, 58

Auxis rochei AuxRoc-WM-01 234, 229 179, 157, 126 247, 123, 32, 30, 26

Auxis rochei AuxRoc-WM-02 234, 229 179, 157, 126 247, 123, 32, 30, 26

Auxis rochei AuxRoc-CI-01 234, 229 179, 157, 126 247, 123, 32, 30, 26

Auxis rochei AuxRoc-CI-02 234, 229 179, 157, 126 247, 123, 32, 30, 26

Balistes capriscus BalCap-CI-01 uncut 285, 179 284, 180

Balistes capriscus BalCap-CI-02 uncut 285, 179 284, 180

Belone belone BelBel-NS-01 uncut 315, 149 159, 123, 86, 64, 26

Belone belone BelBel-NS-02 uncut 315, 149 159, 123, 86, 64, 26

Belone belone BelBel-EM-01 uncut 315, 149 159, 123, 86, 64, 26

Belone belone BelBel-EM-02 uncut 315, 149 159, 123, 86, 64, 26

Belone belone BelBel-SB-01 uncut 315, 149 159, 123, 86, 64, 26

Belone belone BelBel-SB-02 uncut 315, 149 159, 123, 86, 64, 26

Beryx splendens BerSpl-CS-01 uncut 181, 132, 107, 40 158, 152, 124, 26

Beryx splendens BerSpl-CS-02 uncut 181, 132, 107, 40 158, 152, 124, 26

Boops boops BooBoo-WM-01 uncut 181, 149, 132 243, 193, 26

Boops boops BooBoo-WM-02 uncut 181, 149, 132 243, 193, 26

Boops boops BooBoo-CS-01 uncut 181, 149, 132 243, 193, 26

Boops boops BooBoo-CS-02 uncut 181, 149, 132 243, 193, 26

Boops boops BooBoo-MA-01 uncut 181, 149, 132 438, 26

Boops boops BooBoo-MA-02 uncut 181, 149, 132 438, 26

Boops boops BooBoo-CB-01 uncut 181, 149, 132 243, 193, 26

Boops boops BooBoo-CB-02 uncut 181, 149, 132 243, 193, 26

Boops boops BooBoo-EM-01 uncut 181, 149, 132 243, 193, 26

Page 66 of 153

Last printed 14/08/2013 09:50:00

Brama brama BraBra-CS-01 uncut 220, 126, 110, 4 372, 64, 26

Brama brama BraBra-CS-02 uncut 220, 126, 110, 4 372, 64, 26

Brosme brosme BroBro-SB-01 231, 118, 44, 24, 19, 15 315, 107, 40 uncut

Brosme brosme BroBro-SB-02 231, 118, 44, 24, 19, 15 315, 107, 40 uncut

Brotula barbata BroBar-EE-01 219, 118, 96, 24 296, 69, 55, 40 280, 90, 58, 32

Brotula barbata BroBar-EE-02 219, 118, 96, 24 296, 69, 55, 40 280, 90, 58, 32

Buglossidium luteum BugLut-NS-01 uncut 151, 137, 132, 40 284, 78, 72, 26

Buglossidium luteum BugLut-NS-02 uncut 151, 137, 132, 40 284, 78, 72, 26

Buglossidium luteum BugLut-SB-01 uncut 151, 137, 132, 40 284, 78, 72, 26

Caranx crysos CarCry-CI-01 439, 24 151, 137, 132, 40 180, 159, 123

Caranx crysos CarCry-CI-02 439, 24 151, 137, 132, 40 180, 159, 123

Centrolophus niger CenNig-WM-01 439, 24 181, 149, 126, 4 284, 92, 86

Centrolophus niger CenNig-WM-02 439, 24 181, 149, 126, 4 284, 92, 86

Cephalopholis taeniops CepTae-EE-01 318, 118, 24 332, 132 284, 180

Cephalopholis taeniops CepTae-EE-02 318, 118, 24 332, 132 284, 180

Chelidonichthys gurnardus CheGur-CS-01 uncut 149, 140, 126, 28, 9, 4 284, 152, 26

Chelidonichthys gurnardus CheGur-CS-02 uncut 149, 140, 126, 28, 9, 4 284, 152, 26

Chelidonichthys gurnardus CheGur-NS-01 uncut 149, 140, 126, 28, 9, 4 284, 152, 26

Chelidonichthys gurnardus CheGur-NS-02 uncut 149, 140, 126, 28, 9, 4 284, 152, 26

Chelidonichthys gurnardus CheGur-CB-01 uncut 149, 140, 126, 28, 9, 4 284, 152, 26

Chelidonichthys gurnardus CheGur-CB-02 uncut 149, 140, 126, 28, 9, 4 284, 152, 26

Chelidonichthys gurnardus CheGur-SB-01 uncut 149, 140, 126, 28, 9, 4 284, 152, 26

Chelidonichthys gurnardus CheGur-SB-02 uncut 149, 140, 126, 28, 9, 4 284, 152, 26

Chelidonichthys lastoviza CheLas-WM-01 400, 63 332, 132 438, 26

Chelidonichthys lastoviza CheLas-WM-02 400, 63 332, 132 438, 26

Chelidonichthys lastoviza CheLas-CS-01 400, 63 332, 132 438, 26

Chelidonichthys lastoviza CheLas-CS-02 400, 63 332, 132 438, 26

Chelidonichthys lucernus CheLuc-WM-02 258, 114, 88 149, 140, 126, 28, 9, 4 284, 152, 26

Chelidonichthys lucernus CheLuc-CS-01 258, 114, 88 149, 140, 126, 28, 9, 4 284, 152, 26

Chelidonichthys lucernus CheLuc-CS-02 258, 114, 88 149, 140, 126, 28, 9, 4 284, 152, 26

Chelidonichthys lucernus CheLuc-MA-01 258, 114, 88 149, 140, 126, 28, 9, 4 284, 152, 26

Chelidonichthys lucernus CheLuc-NS-01 258, 114, 88 149, 140, 126, 28, 9, 4 284, 152, 26

Chelidonichthys lucernus CheLuc-NS-02 258, 114, 88 149, 140, 126, 28, 9, 4 284, 152, 26

Chelidonichthys lucernus CheLuc-CB-01 258, 114, 88 149, 140, 126, 28, 9, 4 284, 152, 26

Chelidonichthys lucernus CheLuc-CB-02 258, 114, 88 149, 140, 126, 28, 9, 4 284, 152, 26

Chelidonichthys lucernus CheLuc-CB-03 258, 114, 88 149, 140, 126, 28, 9, 4 284, 152, 26

Chelidonichthys lucernus CheLuc-SB-01 258, 114, 88 149, 140, 126, 28, 9, 4 284, 152, 26

Chelidonichthys obscurus CheObs-WM-01 400, 63 181, 149, 126, 4 284, 114, 36, 26

Chelidonichthys obscurus CheObs-WM-02 400, 63 181, 149, 126, 4 284, 114, 36, 26

Chelidonichthys obscurus CheObs-CS-01 400, 63 181, 149, 126, 4 284, 114, 36, 26

Chelidonichthys obscurus CheObs-CS-02 400, 63 181, 149, 126, 4 284, 114, 36, 26

Chelon labrosus CheLab-CS-01 uncut 179, 157, 126 159, 123, 92, 86

Page 67 of 153

Last printed 14/08/2013 09:50:00

Chlorophthalmus agassizi ChlAga-WM-01 318, 118, 24 293, 126, 43 159, 123, 120, 58

Chlorophthalmus agassizi ChlAga-WM-02 318, 118, 24 293, 126, 43 159, 123, 120, 58

Chromis limbata ChrLim-CI-01 439, 24 285, 137, 40 284, 92, 86

Chromis limbata ChrLim-CI-02 439, 24 285, 137, 40 284, 92, 86

Chromis limbata ChrLim-MA-01 439, 24 285, 137, 40 284, 92, 86

Chromis limbata ChrLim-MA-02 439, 24 285, 137, 40 284, 92, 86

Ciliata septentrionalis CilSep-NS-01 439, 24 187, 126, 107, 40 284, 92, 48, 36

Ciliata septentrionalis CilSep-NS-02 439, 24 187, 126, 107, 40 284, 92, 48, 36

Citharus linguatula CitLin-WM-01 249, 145, 39, 24 285, 179 280, 184

Citharus linguatula CitLin-WM-02 249, 145, 39, 24 285, 179 280, 184

Clupea harengus CluHar-NS-01 uncut uncut 372, 64, 26

Clupea harengus CluHar-NS-02 uncut uncut 372, 64, 26

Clupea harengus CluHar-CB-01 uncut uncut 372, 64, 26

Clupea harengus CluHar-CB-02 uncut uncut 372, 64, 26

Clupea harengus CluHar-SB-01 uncut uncut 372, 64, 26

Clupea harengus CluHar-SB-02 uncut uncut 372, 64, 26

Coryphaena equiselis CorEqu-MA-01 uncut 215, 126, 121 193, 152, 89, 26

Coryphaena equiselis CorEqu-MA-02 uncut 215, 126, 121 193, 152, 89, 26

Coryphaena hippurus CorHip-WM-01 345, 118 338, 126 284, 180

Coryphaena hippurus CorHip-WM-02 345, 118 338, 126 284, 180

Coryphaena hippurus CorHip-MA-01 345, 118 338, 126 284, 180

Cyclopterus lumpus CycLum-NS-02 uncut uncut 341, 123

Cyclopterus lumpus CycLum-NS-03 uncut uncut 341, 123

Cyclopterus lumpus CycLum-SB-01 uncut uncut 341, 123

Cyclopterus lumpus CycLum-SB-02 uncut uncut 341, 123

Dactylopterus volitans DacVol-WM-01 252, 145, 36, 24 179, 157, 126 280, 124, 58

Dactylopterus volitans DacVol-WM-02 252, 145, 36, 24 179, 157, 126 280, 124, 58

Dentex dentex DenDen-WM-01 258, 205 187, 149, 126 284, 86, 64, 26

Dentex dentex DenDen-WM-02 uncut 187, 149, 126 284, 86, 64, 26

Dentex dentex DenDen-CI-01 258, 205 187, 149, 126 284, 86, 64, 26

Dentex dentex DenDen-CI-02 258, 205 187, 149, 126 284, 86, 64, 26

Dentex dentex DenDen-EM-01 uncut 187, 149, 126 284, 86, 64, 26

Dentex dentex DenDen-EM-02 258, 205 187, 149, 126 284, 86, 64, 26

Dentex gibbosus DenGib-MA-01 258, 165, 37 187, 149, 126 284, 86, 64, 26

Dentex gibbosus DenGib-MA-02 258, 165, 37 187, 149, 126 284, 86, 64, 26

Dentex macrophthalmus DenMac-CI-01 uncut 285, 179 193, 177, 64, 26

Dentex macrophthalmus DenMac-EE-01 258, 205 285, 179 193, 177, 64, 26

Dentex macrophthalmus DenMac-EE-02 uncut 285, 179 193, 177, 64, 26

Dicentrarchus labrax DicLab-CS-01 252, 145, 36, 24 181, 126, 61, 44, 40, 4 287, 92, 83

Dicentrarchus labrax DicLab-CS-02 192, 145, 57, 36, 24 181, 126, 61, 44, 40, 4 287, 92, 83

Dicentrarchus labrax DicLab-NS-01 192, 145, 57, 36, 24 181, 126, 61, 44, 40, 4 287, 92, 83

Dicentrarchus labrax DicLab-NS-02 192, 145, 57, 36, 24 181, 126, 61, 44, 40, 4 287, 92, 83

Page 68 of 153

Last printed 14/08/2013 09:50:00

Dicentrarchus labrax DicLab-EM-05 252, 145, 36, 24 181, 126, 61, 44, 40, 4 287, 92, 83

Dicologlossa cuneata DicCun-WM-01 uncut uncut 406, 58

Dicologlossa cuneata DicCun-WM-02 uncut uncut 406, 58

Dicologlossa cuneata DicCun-EE-01 uncut uncut 406, 58

Dicologlossa cuneata DicCun-EE-02 uncut uncut 406, 58

Diplodus annularis DipAnn-WM-01 400, 63 235, 132, 95 372, 64, 26

Diplodus annularis DipAnn-WM-02 400, 63 235, 132, 95 372, 64, 26

Diplodus annularis DipAnn-CI-01 400, 63 235, 132, 95 372, 64, 26

Diplodus annularis DipAnn-CI-02 400, 63 235, 132, 95 372, 64, 26

Diplodus annularis DipAnn-EM-01 400, 63 235, 132, 95 372, 64, 26

Diplodus annularis DipAnn-EM-02 400, 63 235, 132, 95 372, 64, 26

Diplodus cervinus DipCer-CI-01 uncut uncut 284, 86, 64, 26

Diplodus cervinus DipCer-CI-02 uncut uncut 284, 86, 64, 26

Diplodus cervinus DipCer-EE-01 uncut uncut 284, 86, 64, 26

Diplodus cervinus DipCer-EE-02 uncut uncut 284, 86, 64, 26

Diplodus cervinus DipCer-MA-01 uncut uncut 284, 86, 64, 26

Diplodus cervinus DipCer-MA-02 uncut uncut 284, 86, 64, 26

Diplodus puntazzo DipPun-CI-01 uncut uncut 372, 92

Diplodus puntazzo DipPun-CI-02 uncut uncut 372, 92

Diplodus puntazzo DipPun-EE-01 uncut uncut 372, 92

Diplodus puntazzo DipPun-EE-02 uncut uncut 372, 92

Diplodus puntazzo DipPun-EM-01 uncut uncut 372, 64, 26

Diplodus puntazzo DipPun-EM-02 uncut uncut 372, 64, 26

Diplodus sargus DipSar-WM-01 uncut uncut 372, 32, 30, 26

Diplodus sargus DipSar-WM-02 uncut uncut 372, 32, 30, 26

Diplodus sargus DipSar-CS-01 uncut uncut 372, 64, 26

Diplodus sargus DipSar-CS-02 uncut uncut 372, 32, 30, 26

Diplodus sargus DipSar-MA-01 uncut uncut 372, 64, 26

Diplodus sargus DipSar-MA-02 uncut uncut 372, 64, 26

Diplodus sargus DipSar-EM-01 uncut uncut 372, 32, 30, 26

Diplodus sargus DipSar-EM-02 uncut uncut 372, 32, 30, 26

Diplodus vulgaris DipVul-WM-01 uncut 244, 220 372, 64, 26

Diplodus vulgaris DipVul-WM-02 uncut 244, 220 372, 64, 26

Diplodus vulgaris DipVul-CS-01 uncut 244, 220 372, 64, 26

Diplodus vulgaris DipVul-CS-02 uncut 244, 220 372, 64, 26

Diplodus vulgaris DipVul-CI-01 uncut 244, 220 372, 64, 26

Diplodus vulgaris DipVul-MA-01 uncut 244, 220 372, 64, 26

Diplodus vulgaris DipVul-MA-02 uncut 244, 220 372, 64, 26

Diplodus vulgaris DipVul-EM-01 uncut 244, 220 372, 64, 26

Diplodus vulgaris DipVul-EM-02 uncut 244, 220 372, 64, 26

Echiichthys vipera EchVip-NS-01 439, 24 181, 126, 107, 40, 4 341, 123

Echiichthys vipera EchVip-NS-02 439, 24 181, 126, 107, 40, 4 341, 123

Page 69 of 153

Last printed 14/08/2013 09:50:00

Enchelyopus cimbrius EncCim-NS-01 400, 63 315, 107, 40 372, 64, 26

Enchelyopus cimbrius EncCim-NS-02 400, 63 315, 107, 40 372, 64, 26

Enchelyopus cimbrius EncCim-CB-01 400, 63 315, 107, 40 372, 64, 26

Enchelyopus cimbrius EncCim-CB-02 400, 63 315, 107, 40 372, 64, 26

Enchelyopus cimbrius EncCim-SB-01 400, 63 315, 107, 40 372, 64, 26

Enchelyopus cimbrius EncCim-SB-02 400, 63 315, 107, 40 372, 64, 26

Engraulis encrasicolus EngEnc-WM-01 231, 205, 24 229, 160, 73 284, 180

Engraulis encrasicolus EngEnc-WM-02 231, 205, 24 229, 160, 73 284, 180

Engraulis encrasicolus EngEnc-CS-01 231, 205, 24 229, 160, 73 284, 180

Engraulis encrasicolus EngEnc-CS-02 231, 205, 24 229, 160, 73 284, 180

Engraulis encrasicolus EngEnc-NS-01 231, 205, 24 229, 160, 73 284, 180

Engraulis encrasicolus EngEnc-NS-02 231, 205, 24 229, 160, 73 284, 180

Engraulis encrasicolus EngEnc-CB-01 231, 205, 24 229, 160, 73 284, 120, 58

Engraulis encrasicolus EngEnc-CB-02 231, 205, 24 229, 160, 73 284, 180

Engraulis encrasicolus EngEnc-EM-01 231, 205, 24 229, 160, 73 284, 120, 58

Engraulis encrasicolus EngEnc-EM-02 231, 205, 24 229, 160, 73 284, 120, 58

Epinephelus caninus EpiCan-EE-01 439, 24 179, 146, 126, 9 uncut

Epinephelus costae EpiCos-EE-01 439, 24 179, 146, 126, 9 uncut

Epinephelus costae EpiCos-EE-02 439, 24 179, 126, 103, 41, 9 uncut

Epinephelus costae EpiCos-EM-01 439, 24 179, 126, 103, 41, 9 uncut

Epinephelus costae EpiCos-EM-02 439, 24 179, 126, 103, 41, 9 uncut

Epinephelus marginatus EpiMar-WM-01 439, 24 179, 126, 114, 41 uncut

Epinephelus marginatus EpiMar-WM-02 439, 24 179, 126, 114, 41 uncut

Epinephelus marginatus EpiMar-EE-02 439, 24 179, 126, 114, 41 uncut

Epinephelus marginatus EpiMar-MA-01 439, 24 179, 126, 114, 41 uncut

Epinephelus marginatus EpiMar-MA-02 439, 24 179, 169, 114 uncut

Epinephelus marginatus EpiMar-EM-01 439, 24 179, 126, 114, 41 uncut

Epinephelus marginatus EpiMar-EM-02 439, 24 179, 126, 114, 41 uncut

Epinephelus tauvina EpiTau-EE-01 439, 24 179, 169, 114 284, 180

Erythrocles monodi EryMon-EE-01 231, 205, 24 151, 149, 132, 28 372, 92

Euthynnus alletteratus EutAll-WM-01 234, 229 179, 151, 132 247, 123, 92

Euthynnus alletteratus EutAll-WM-02 234, 229 179, 151, 132 247, 123, 92

Gadiculus argenteus GadArg-CB-01 249, 118, 66, 24 285, 149, 28 uncut

Gadiculus argenteus GadArg-CB-02 249, 118, 66, 24 285, 107, 40, 28 uncut

Gadus morhua GadMor-CS-01 231, 118, 84, 24 315, 107, 40 284, 92, 86

Gadus morhua GadMor-CS-02 231, 118, 84, 24 315, 107, 40 284, 92, 86

Gadus morhua GadMor-EE-01 231, 118, 84, 24 315, 107, 40 284, 92, 86

Gadus morhua GadMor-NS-01 231, 118, 84, 24 315, 107, 40 284, 92, 86

Gadus morhua GadMor-NS-02 231, 118, 84, 24 315, 107, 40 284, 92, 86

Gadus morhua GadMor-SB-01 231, 118, 84, 24 315, 107, 40 284, 92, 86

Gadus morhua GadMor-SB-02 231, 118, 84, 24 315, 107, 40 284, 92, 86

Gaidropsarus biscayensis GaiBis-CS-01 345, 118 187, 126, 107, 40 284, 86, 64, 26

Page 70 of 153

Last printed 14/08/2013 09:50:00

Gaidropsarus mediterraneus GaiMed-CS-02 258, 205 285, 107, 40, 28 372, 64, 26

Glyptocephalus cynoglossus GlyCyn-NS-01 298, 157, 5 235, 126, 95, 4 284, 92, 86

Glyptocephalus cynoglossus GlyCyn-NS-02 298, 157, 5 235, 126, 95, 4 284, 92, 86

Glyptocephalus cynoglossus GlyCyn-SB-01 298, 157, 5 235, 126, 95, 4 284, 92, 86

Glyptocephalus cynoglossus GlyCyn-SB-02 298, 157, 5 235, 126, 95, 4 284, 92, 86

Gymnothorax afer GymAfe-EE-01 258, 205 uncut 158, 124, 92, 86

Gymnothorax afer GymAfe-EE-02 258, 205 uncut 158, 124, 92, 86

Helicolenus dactylopterus HelDac-WM-01 249, 187, 24 338, 126 287, 92, 83

Helicolenus dactylopterus HelDac-WM-02 249, 187, 24 338, 126 287, 92, 83

Helicolenus dactylopterus HelDac-CS-01 249, 187, 24 290, 126, 40, 4 287, 92, 83

Helicolenus dactylopterus HelDac-MA-01 249, 187, 24 332, 126, 4 287, 92, 83

Helicolenus dactylopterus HelDac-MA-02 249, 187, 24 332, 126, 4 287, 92, 83

Helicolenus dactylopterus HelDac-CB-01 249, 187, 24 332, 126, 4 287, 92, 83

Helicolenus dactylopterus HelDac-CB-02 249, 187, 24 220, 126, 110, 4 287, 92, 83

Helicolenus dactylopterus HelDac-EM-01 249, 187, 24 332, 126, 4 287, 92, 83

Helicolenus dactylopterus HelDac-EM-02 249, 187, 24 332, 126, 4 287, 92, 83

Helicolenus dactylopterus HelDac-SB-01 249, 187, 24 332, 126, 4 287, 92, 83

Helicolenus dactylopterus HelDac-SB-02 249, 187, 24 332, 126, 4 287, 92, 83 Heteropriacanthus cruentatus HetCru-CI-01 439, 24 179, 157, 126 284, 92, 86 Heteropriacanthus cruentatus HetCru-CI-02 439, 24 179, 157, 126 284, 92, 86 Hippoglossoides platessoides HipPla-NS-01 276, 145, 39 290, 126, 40, 4 284, 92, 86 Hippoglossoides platessoides HipPla-NS-02 276, 145, 39 290, 126, 40, 4 284, 92, 86 Hippoglossoides platessoides HipPla-SB-01 276, 145, 39 290, 126, 40, 4 284, 92, 86 Hippoglossoides platessoides HipPla-SB-02 276, 145, 39 290, 132, 40 284, 92, 86

Hippoglossus hippoglossus HipHip-NS-01 uncut 193, 132, 95, 40 284, 92, 86

Hippoglossus hippoglossus HipHip-NS-02 uncut 193, 132, 95, 40 284, 92, 86

Hippoglossus hippoglossus HipHip-SB-01 uncut 193, 132, 95, 40 284, 92, 86

Hyperoplus lanceolatus HypLan-NS-01 439, 24 181, 149, 132 uncut

Hyperoplus lanceolatus HypLan-NS-02 439, 24 181, 149, 132 uncut

Katsuwonus pelamis KatPel-CS-01 229, 207, 24 332, 132 159, 123, 92, 86

Katsuwonus pelamis KatPel-CS-02 229, 207, 24 332, 132 159, 123, 92, 86

Katsuwonus pelamis KatPel-CI-01 229, 207, 24 332, 132 159, 123, 92, 86

Katsuwonus pelamis KatPel-CI-02 229, 207, 24 332, 132 159, 123, 92, 86

Katsuwonus pelamis KatPel-MA-01 229, 207, 24 332, 132 159, 123, 92, 86

Katsuwonus pelamis KatPel-MA-02 229, 207, 24 332, 132 159, 123, 92, 86

Labrus bergylta LabBer-CS-01 318, 118, 24 315, 149 280, 92, 48, 36, 2

Labrus bergylta LabBer-CS-02 318, 118, 24 315, 149 280, 92, 48, 36, 2

Labrus bergylta LabBer-SB-01 318, 118, 24 315, 149 280, 92, 48, 36, 2

Labrus bergylta LabBer-SB-02 318, 118, 24 315, 149 280, 92, 48, 36, 2

Lepidorhombus boscii LepBos-WM-01 271, 88, 66, 24, 5 181, 149, 132 284, 142, 36

Lepidorhombus boscii LepBos-WM-02 271, 88, 66, 24, 5 181, 149, 132 284, 142, 36

Page 71 of 153

Last printed 14/08/2013 09:50:00

Lepidorhombus boscii LepBos-CB-02 271, 88, 66, 24, 5 181, 149, 132 284, 142, 36

Lepidorhombus boscii LepBos-EM-01 271, 88, 66, 24, 5 181, 149, 132 284, 142, 36

Lepidorhombus boscii LepBos-EM-02 271, 88, 66, 24, 5 181, 149, 132 284, 142, 36

Lepidorhombus whiffiagonis LepWhi-CS-01 306, 157 181, 149, 132 284, 180

Lepidorhombus whiffiagonis LepWhi-CS-02 279, 118, 36, 24 181, 149, 132 284, 180

Lepidorhombus whiffiagonis LepWhi-CB-01 306, 157 181, 149, 132 284, 180

Lepidorhombus whiffiagonis LepWhi-EM-01 306, 157 181, 149, 126, 4 284, 180

Lepidorhombus whiffiagonis LepWhi-EM-02 306, 157 181, 149, 126, 4 284, 180

Lepidotrigla cavillone LepCav-WM-01 400, 36, 24 179, 157, 126 284, 142, 36

Lepidotrigla cavillone LepCav-WM-02 400, 36, 24 179, 157, 126 284, 180

Lichia amia LicAmi-WM-01 uncut 285, 179 280, 86, 64, 26, 2

Lichia amia LicAmi-WM-02 uncut 285, 179 280, 86, 64, 26, 2

Lichia amia LicAmi-CI-01 uncut 285, 179 280, 86, 64, 26, 2

Lichia amia LicAmi-CI-02 uncut 285, 179 280, 86, 64, 26, 2

Limanda limanda LimLim-NS-01 234, 157, 39, 27 290, 132, 40 284, 92, 86

Limanda limanda LimLim-NS-02 234, 157, 39, 27 290, 132, 40 284, 92, 86

Limanda limanda LimLim-CB-01 234, 157, 39, 27 290, 132, 40 284, 92, 86

Limanda limanda LimLim-CB-02 234, 157, 39, 27 290, 132, 40 284, 92, 86

Limanda limanda LimLim-SB-01 234, 157, 39, 27 290, 132, 40 284, 92, 86

Limanda limanda LimLim-SB-03 234, 157, 39, 27 290, 132, 40 284, 92, 86

Liparis liparis LipLip-NS-01 uncut 338, 126 284, 180

Liparis liparis LipLip-NS-02 uncut 338, 126 284, 180

Liparis montagui LipMon-SB-01 439, 24 285, 149, 28 284, 180

Liparis montagui LipMon-SB-02 439, 24 285, 149, 28 284, 180

Lithognathus mormyrus LitMor-WM-01 uncut uncut 372, 64, 26

Lithognathus mormyrus LitMor-WM-02 uncut uncut 372, 64, 26

Lithognathus mormyrus LitMor-EM-01 uncut uncut 372, 64, 26

Lithognathus mormyrus LitMor-EM-02 uncut uncut 372, 64, 26

Liza aurata LizAur-WM-01 uncut 179, 157, 126 159, 123, 92, 86

Liza aurata LizAur-WM-02 uncut 179, 157, 126 159, 123, 92, 86

Liza aurata LizAur-CS-01 uncut 179, 157, 126 159, 123, 92, 86

Liza aurata LizAur-CB-01 uncut 179, 157, 126 159, 123, 92, 86

Liza aurata LizAur-CB-02 uncut 179, 157, 126 159, 123, 92, 86

Liza ramado LizRam-CB-01 uncut 285, 179 155, 123, 92, 86, 2

Liza ramado LizRam-CB-02 uncut 285, 179 155, 123, 92, 86, 2

Lophius budegassa LopBud-WM-01 234, 229 uncut 159, 123, 92, 48, 36

Lophius budegassa LopBud-WM-02 234, 229 uncut 197, 123, 92, 48

Lophius budegassa LopBud-CS-01 234, 229 uncut 159, 123, 92, 48, 36

Lophius budegassa LopBud-CS-02 234, 229 uncut 159, 123, 92, 48, 36

Lophius budegassa LopBud-EE-01 234, 229 uncut 159, 123, 92, 48, 36

Lophius budegassa LopBud-EE-02 234, 229 uncut 159, 123, 92, 48, 36

Lophius budegassa LopBud-CB-01 234, 229 uncut 159, 123, 92, 48, 36

Page 72 of 153

Last printed 14/08/2013 09:50:00

Lophius budegassa LopBud-EM-01 234, 229 uncut 159, 123, 92, 48, 36

Lophius budegassa LopBud-EM-02 234, 229 uncut 159, 123, 92, 48, 36

Lophius piscatorius LopPis-CS-01 234, 229 295, 169 159, 123, 92, 86

Lophius piscatorius LopPis-CS-02 234, 229 295, 169 159, 123, 92, 48, 36

Lophius piscatorius LopPis-NS-01 234, 229 295, 169 159, 123, 92, 86

Lophius piscatorius LopPis-NS-02 234, 229 295, 169 159, 123, 92, 48, 36

Lophius piscatorius LopPis-CB-01 234, 229 295, 169 159, 123, 92, 86

Lophius piscatorius LopPis-EM-01 234, 229 295, 169 159, 123, 92, 86

Lophius piscatorius LopPis-EM-02 234, 229 295, 169 159, 123, 92, 86

Lophius piscatorius LopPis-SB-01 234, 229 295, 169 159, 123, 92, 86

Lophius piscatorius LopPis-SB-02 234, 229 295, 169 159, 123, 92, 86

Makaira nigricans MakNig-CI-01 231, 157, 45, 24 157, 149, 126, 28 284, 86, 58, 32

Makaira nigricans MakNig-CI-02 231, 157, 45, 24 157, 149, 126, 28 284, 86, 58, 32

Melanogrammus aeglefinus MelAeg-CS-01 439, 24 424, 40 193, 180, 89

Melanogrammus aeglefinus MelAeg-EE-01 439, 24 424, 40 193, 180, 89

Melanogrammus aeglefinus MelAeg-EE-02 439, 24 424, 40 193, 180, 89

Melanogrammus aeglefinus MelAeg-NS-01 439, 24 424, 40 193, 180, 89

Melanogrammus aeglefinus MelAeg-NS-02 439, 24 424, 40 193, 180, 89

Melanogrammus aeglefinus MelAeg-CB-01 439, 24 424, 40 193, 180, 89

Melanogrammus aeglefinus MelAeg-CB-02 439, 24 424, 40 193, 180, 89

Melanogrammus aeglefinus MelAeg-SB-01 439, 24 424, 40 193, 180, 89

Melanogrammus aeglefinus MelAeg-SB-02 439, 24 424, 40 193, 180, 89

Merlangius merlangus MeaMea-NS-01 345, 118 315, 107, 40 372, 92

Merlangius merlangus MeaMea-NS-02 345, 118 315, 107, 40 372, 92

Merlangius merlangus MeaMea-CB-01 345, 118 315, 107, 40 193, 177, 92

Merlangius merlangus MeaMea-CB-04 345, 118 315, 107, 40 193, 177, 92

Merlangius merlangus MeaMea-SB-01 345, 118 315, 107, 40 193, 177, 92

Merlangius merlangus MeaMea-SB-02 345, 118 315, 107, 40 193, 177, 92

Merluccius australis MerAus-EE-01 318, 118, 24 187, 126, 107, 40 341, 123

Merluccius australis MerAus-EE-02 318, 118, 24 187, 126, 107, 40 341, 123

Merluccius capensis MerCap-EE-01 306, 157 187, 126, 107, 40 uncut

Merluccius merluccius MerMer-WM-01 306, 157 187, 126, 107, 40 uncut

Merluccius merluccius MerMer-WM-02 306, 157 187, 126, 107, 40 uncut

Merluccius merluccius MerMer-CS-01 306, 157 187, 126, 107, 40 uncut

Merluccius merluccius MerMer-CS-02 306, 157 187, 126, 107, 40 uncut

Merluccius merluccius MerMer-CI-01 306, 157 187, 126, 107, 40 uncut

Merluccius merluccius MerMer-CI-02 306, 157 187, 126, 107, 40 uncut

Merluccius merluccius MerMer-CB-01 306, 157 187, 126, 107, 40 uncut

Merluccius merluccius MerMer-CB-05 306, 157 187, 126, 107, 40 uncut

Merluccius merluccius MerMer-EM-01 306, 157 187, 126, 107, 40 uncut

Merluccius merluccius MerMer-EM-02 306, 157 187, 126, 107, 40 uncut

Merluccius merluccius MerMer-EM-03 306, 157 187, 126, 107, 40 uncut

Page 73 of 153

Last printed 14/08/2013 09:50:00

Merluccius merluccius MerMer-SB-01 306, 157 187, 126, 107, 40 uncut

Merluccius merluccius MerMer-SB-02 306, 157 187, 126, 107, 40 uncut

Merluccius merluccius MerMer-SB-03 306, 157 187, 126, 107, 40 uncut

Merluccius merluccius MerMer-SB-04 306, 157 187, 126, 107, 40 uncut

Merluccius merluccius MerMer-SB-05 306, 157 187, 126, 107, 40 uncut

Merluccius polli MerPol-EE-01 279, 157, 24 187, 126, 107, 40 341, 123

Microchirus azevia MicAze-CI-01 306, 157 163, 126, 125, 40, 4 341, 123

Microchirus azevia MicAze-CI-02 306, 157 290, 126, 40, 4 341, 123

Microchirus variegatus MicVar-WM-01 439, 24 140, 132, 107, 40, 39 163, 123, 106, 68

Microchirus variegatus MicVar-WM-02 439, 24 140, 132, 107, 40, 39 163, 123, 106, 68

Microchirus variegatus MicVar-CS-01 439, 24 140, 132, 107, 40, 39 163, 123, 106, 68

Microchirus variegatus MicVar-CS-02 439, 24 140, 132, 107, 40, 39 163, 123, 106, 68

Microchirus variegatus MicVar-NS-01 439, 24 140, 132, 107, 40, 39 163, 123, 106, 68

Microchirus variegatus MicVar-NS-02 439, 24 140, 132, 107, 40, 39 163, 123, 106, 68

Microchirus variegatus MicVar-CB-01 439, 24 149, 140, 132, 39 163, 123, 106, 68

Microchirus variegatus MicVar-CB-02 439, 24 149, 140, 132, 39 163, 123, 106, 68

Micromesistius poutassou MicPou-WM-01 271, 118, 44, 24 315, 107, 40 372, 92

Micromesistius poutassou MicPou-WM-02 271, 118, 44, 24 315, 107, 40 372, 92

Micromesistius poutassou MicPou-CS-01 271, 118, 44, 24 315, 107, 40 372, 92

Micromesistius poutassou MicPou-CS-02 271, 118, 44, 24 315, 107, 40 372, 92

Micromesistius poutassou MicPou-NS-01 271, 118, 44, 24 315, 107, 40 372, 92

Micromesistius poutassou MicPou-NS-02 271, 118, 44, 24 315, 107, 40 372, 92

Micromesistius poutassou MicPou-CB-01 271, 118, 44, 24 315, 107, 40 372, 92

Micromesistius poutassou MicPou-CB-04 271, 118, 44, 24 315, 107, 40 372, 92

Micromesistius poutassou MicPou-EM-01 271, 118, 44, 24 315, 107, 40 372, 92

Micromesistius poutassou MicPou-EM-02 271, 118, 44, 24 315, 107, 40 372, 92

Micromesistius poutassou MicPou-EM-03 271, 118, 44, 24 315, 107, 40 372, 92

Micromesistius poutassou MicPou-EM-04 271, 118, 44, 24 315, 107, 40 372, 92

Micromesistius poutassou MicPou-EM-05 271, 118, 44, 24 315, 107, 40 372, 92

Micromesistius poutassou MicPou-SB-01 271, 118, 44, 24 315, 107, 40 372, 92

Micromesistius poutassou MicPou-SB-02 271, 118, 44, 24 315, 107, 40 372, 92

Microstomus kitt MicKit-NS-01 uncut 296, 126, 40 193, 92, 89, 86

Microstomus kitt MicKit-NS-02 uncut 296, 126, 40 193, 92, 89, 86

Microstomus kitt MicKit-CB-01 uncut 296, 126, 40 284, 92, 86

Microstomus kitt MicKit-CB-02 uncut 296, 126, 40 193, 92, 89, 86

Microstomus kitt MicKit-SB-01 uncut 296, 126, 40 193, 92, 89, 86

Microstomus kitt MicKit-SB-02 uncut 296, 126, 40 193, 92, 89, 86

Molva molva MolMol-CS-01 231, 205, 24 315, 149 284, 92, 86

Molva molva MolMol-CS-02 231, 205, 24 315, 149 284, 92, 86

Molva molva MolMol-NS-01 439, 24 315, 107, 40 284, 92, 86

Molva molva MolMol-NS-02 439, 24 315, 107, 40 284, 92, 86

Molva molva MolMol-CB-01 231, 205, 24 315, 107, 40 284, 92, 86

Page 74 of 153

Last printed 14/08/2013 09:50:00

Molva molva MolMol-SB-01 231, 205, 24 315, 107, 40 284, 92, 86

Molva molva MolMol-SB-02 231, 205, 24 315, 107, 40 284, 92, 86

Mugil cephalus MugCep-EM-04 439, 24 179, 157, 126 341, 123

Mugil cephalus MugCep-EM-05 439, 24 179, 157, 126 341, 123

Mullus barbatus MulBar-WM-01 345, 118 187, 126, 107, 40 280, 92, 90

Mullus barbatus MulBar-WM-02 345, 118 187, 126, 107, 40 280, 92, 90

Mullus barbatus MulBar-CS-02 279, 157, 24 187, 126, 107, 40 284, 92, 48, 36

Mullus barbatus MulBar-EM-01 345, 118 187, 126, 107, 40 280, 92, 90

Mullus barbatus MulBar-EM-05 345, 118 187, 126, 107, 40 280, 92, 90

Mullus surmuletus MulSur-WM-01 279, 157, 24 187, 126, 107, 40 284, 92, 48, 36

Mullus surmuletus MulSur-WM-02 279, 157, 24 187, 126, 107, 40 284, 92, 48, 36

Mullus surmuletus MulSur-CS-01 279, 157, 24 187, 126, 107, 40 284, 92, 48, 36

Mullus surmuletus MulSur-CS-02 279, 157, 24 187, 126, 107, 40 284, 92, 48, 36

Mullus surmuletus MulSur-MA-01 279, 157, 24 187, 126, 107, 40 284, 92, 48, 36

Mullus surmuletus MulSur-MA-02 279, 157, 24 187, 126, 107, 40 284, 92, 48, 36

Mullus surmuletus MulSur-NS-01 279, 157, 24 187, 126, 107, 40 284, 92, 48, 36

Mullus surmuletus MulSur-NS-02 279, 157, 24 187, 126, 107, 40 284, 92, 48, 36

Mullus surmuletus MulSur-CB-01 279, 157, 24 187, 126, 107, 40 284, 92, 48, 36

Mullus surmuletus MulSur-CB-02 279, 157, 24 187, 126, 107, 40 284, 92, 48, 36

Mullus surmuletus MulSur-EM-01 279, 157, 24 187, 126, 107, 40 284, 92, 48, 36

Mullus surmuletus MulSur-EM-02 279, 157, 24 187, 126, 107, 40 284, 92, 48, 36

Mullus surmuletus MulSur-EM-03 279, 157, 24 187, 126, 107, 40 284, 92, 48, 36

Mullus surmuletus MulSur-EM-04 279, 157, 24 187, 126, 107, 40 284, 92, 48, 36

Mullus surmuletus MulSur-EM-05 279, 157, 24 187, 126, 107, 40 284, 92, 48, 36

Muraena augusti MurAug-MA-01 439, 24 187, 149, 126 196, 124, 58, 48, 32

Muraena robusta MurRob-EE-01 234, 108, 88, 27 244, 220 uncut

Myoxocephalus scorpius MyoSco-NS-01 439, 24 187, 126, 107, 40 uncut

Myoxocephalus scorpius MyoSco-NS-02 439, 24 187, 126, 107, 40 uncut

Myoxocephalus scorpius MyoSco-SB-01 439, 24 187, 126, 107, 40 uncut

Myoxocephalus scorpius MyoSco-SB-02 439, 24 187, 126, 107, 40 uncut

Oblada melanura OblMel-WM-01 uncut 244, 220 372, 64, 26

Oblada melanura OblMel-WM-02 uncut 244, 220 372, 64, 26

Oblada melanura OblMel-EE-01 uncut 244, 220 372, 64, 26

Oblada melanura OblMel-EE-02 uncut 244, 220 372, 64, 26

Oblada melanura OblMel-EM-01 uncut 244, 220 372, 64, 26

Oblada melanura OblMel-EM-02 uncut 244, 220 372, 64, 26

Osmerus eperlanus OsmEpe-SB-01 uncut 290, 132, 40 284, 180

Osmerus eperlanus OsmEpe-SB-02 uncut 290, 132, 40 284, 180

Pagellus acarne PagAca-WM-01 uncut uncut 372, 64, 26

Pagellus acarne PagAca-WM-02 uncut uncut 372, 64, 26

Pagellus acarne PagAca-CS-01 uncut uncut 372, 64, 26

Page 75 of 153

Last printed 14/08/2013 09:50:00

Pagellus acarne PagAca-MA-01 258, 205 187, 149, 126 284, 86, 64, 26

Pagellus acarne PagAca-MA-02 uncut uncut 372, 64, 26

Pagellus bellottii PagBel-CI-01 258, 205 315, 149 287, 83, 64, 26

Pagellus bellottii PagBel-CI-02 258, 205 187, 149, 126 287, 83, 64, 26

Pagellus bellottii PagBel-EE-01 258, 205 187, 149, 126 287, 83, 64, 26

Pagellus bellottii PagBel-EE-02 258, 205 187, 149, 126 287, 83, 64, 26

Pagellus bogaraveo PagBog-WM-01 uncut uncut 372, 64, 26

Pagellus bogaraveo PagBog-WM-02 uncut uncut 372, 64, 26

Pagellus bogaraveo PagBog-CS-01 uncut uncut 372, 64, 26

Pagellus bogaraveo PagBog-MA-01 uncut uncut 372, 64, 26

Pagellus bogaraveo PagBog-MA-02 uncut uncut 372, 64, 26

Pagellus bogaraveo PagBog-CB-01 uncut uncut 372, 64, 26

Pagellus bogaraveo PagBog-CB-02 uncut uncut 372, 64, 26

Pagellus bogaraveo PagBog-EM-01 uncut uncut 372, 64, 26

Pagellus bogaraveo PagBog-EM-02 uncut uncut 372, 64, 26

Pagellus erythrinus PagEry-WM-01 258, 205 187, 149, 75, 49 108, 89, 86, 83, 64, 26

Pagellus erythrinus PagEry-WM-02 258, 205 187, 149, 75, 49 108, 89, 86, 83, 64, 26

Pagellus erythrinus PagEry-MA-01 258, 205 187, 149, 75, 49 108, 89, 86, 83, 64, 26

Pagellus erythrinus PagEry-MA-02 258, 205 187, 149, 126 108, 89, 86, 83, 64, 26

Pagellus erythrinus PagEry-CB-01 258, 205 187, 149, 75, 49 108, 89, 86, 83, 64, 26

Pagellus erythrinus PagEry-CB-02 258, 205 187, 149, 126 108, 89, 86, 83, 64, 26

Pagellus erythrinus PagEry-EM-01 258, 205 187, 149, 126 108, 89, 86, 83, 64, 26

Pagellus erythrinus PagEry-EM-02 258, 205 187, 149, 75, 49 108, 89, 86, 83, 64, 26

Pagellus erythrinus PagEry-EM-03 258, 205 187, 149, 126 108, 89, 86, 83, 64, 26

Pagellus erythrinus PagEry-EM-04 258, 205 187, 149, 75, 49 108, 89, 86, 83, 64, 26

Pagellus erythrinus PagEry-EM-05 258, 205 187, 149, 126 108, 89, 86, 83, 64, 26

Pagrus pagrus PagPag-WM-01 uncut 181, 149, 126, 4 284, 152, 26

Pagrus pagrus PagPag-WM-02 uncut 181, 149, 126, 4 284, 152, 26

Pagrus pagrus PagPag-MA-01 uncut 181, 149, 126, 4 284, 152, 26

Pagrus pagrus PagPag-MA-02 uncut 181, 149, 126, 4 284, 152, 26

Pagrus pagrus PagPag-EM-01 uncut 181, 149, 126, 4 284, 152, 26

Pagrus pagrus PagPag-EM-02 uncut 181, 149, 126, 4 284, 152, 26

Pagrus pagrus PagPag-EM-03 uncut 181, 149, 126, 4 284, 152, 26

Pagrus pagrus PagPag-EM-04 uncut 181, 149, 126, 4 284, 152, 26

Pagrus pagrus PagPag-EM-05 uncut 181, 149, 126, 4 284, 152, 26

Pegusa cadenati PegCad-EE-02 439, 24 285, 179 271, 123, 68

Pegusa lascaris PegLas-WM-01 uncut 179, 157, 69, 55 341, 123

Pegusa lascaris PegLas-WM-02 uncut 179, 157, 69, 55 341, 123

Pegusa lascaris PegLas-CI-01 uncut 179, 157, 69, 55 341, 123

Pegusa lascaris PegLas-CI-02 uncut 179, 157, 69, 55 341, 123

Pegusa lascaris PegLas-CB-01 439, 24 179, 157, 126 341, 123

Pegusa lascaris PegLas-CB-02 439, 24 179, 157, 126 341, 123

Page 76 of 153

Last printed 14/08/2013 09:50:00

Pegusa lascaris PegLas-EM-02 uncut 179, 157, 69, 55 341, 123

Phrynorhombus norvegicus PhrNor-NS-01 439, 24 181, 149, 132 180, 123, 89, 68

Phrynorhombus norvegicus PhrNor-NS-02 439, 24 181, 149, 132 180, 123, 89, 68

Phycis blennoides PhyBle-MA-01 uncut 296, 126, 40 372, 92

Phycis blennoides PhyBle-CB-01 uncut 296, 126, 40 372, 92

Phycis blennoides PhyBle-CB-02 uncut 296, 126, 40 372, 92

Phycis blennoides PhyBle-EM-01 258, 205 296, 126, 40 372, 92

Phycis blennoides PhyBle-EM-02 258, 205 296, 126, 40 372, 92

Phycis phycis PhyPhy-WM-01 uncut uncut uncut

Phycis phycis PhyPhy-WM-02 uncut uncut uncut

Phycis phycis PhyPhy-EM-01 271, 118, 44, 24 181, 126, 107, 40, 4 193, 92, 89, 86

Phycis phycis PhyPhy-EM-02 271, 118, 44, 24 181, 126, 107, 40, 4 193, 92, 89, 86

Platichthys flesus PlaFle-CS-01 318, 145 290, 132, 40 284, 92, 86

Platichthys flesus PlaFle-CS-02 318, 145 290, 132, 40 284, 92, 86

Platichthys flesus PlaFle-NS-01 318, 145 290, 132, 40 284, 92, 86

Platichthys flesus PlaFle-NS-02 318, 145 290, 132, 40 284, 92, 86

Platichthys flesus PlaFle-CB-01 318, 145 290, 132, 40 284, 92, 86

Platichthys flesus PlaFle-CB-02 uncut 332, 126, 4 341, 123

Platichthys flesus PlaFle-SB-01 318, 145 290, 132, 40 284, 92, 86

Platichthys flesus PlaFle-SB-02 318, 145 290, 132, 40 284, 92, 86

Pleuronectes platessa PlePla-NS-01 276, 145, 39 290, 132, 40 193, 92, 89, 86

Pleuronectes platessa PlePla-NS-02 276, 145, 39 290, 132, 40 193, 92, 89, 86

Pleuronectes platessa PlePla-CB-01 276, 145, 39 290, 132, 40 193, 92, 89, 86

Pleuronectes platessa PlePla-CB-02 276, 145, 39 290, 132, 40 193, 92, 89, 86

Pleuronectes platessa PlePla-SB-01 276, 145, 39 290, 132, 40 193, 92, 89, 86

Pleuronectes platessa PlePla-SB-02 276, 145, 39 290, 132, 40 193, 92, 89, 86

Pollachius pollachius PolPol-CS-01 439, 24 315, 107, 40 372, 92

Pollachius pollachius PolPol-NS-01 439, 24 315, 107, 40 372, 92

Pollachius pollachius PolPol-NS-02 439, 24 315, 107, 40 372, 92

Pollachius pollachius PolPol-CB-01 439, 24 315, 107, 40 372, 92

Pollachius pollachius PolPol-CB-02 439, 24 315, 107, 40 372, 92

Pollachius virens PolVir-NS-01 318, 118, 24 315, 107, 40 372, 92

Pollachius virens PolVir-NS-02 318, 118, 24 315, 107, 40 372, 92

Pollachius virens PolVir-SB-01 318, 118, 24 315, 107, 40 372, 92

Pollachius virens PolVir-SB-02 318, 118, 24 315, 107, 40 372, 92

Polyprion americanus PolAme-CI-01 231, 205, 24 181, 149, 132 372, 92

Polyprion americanus PolAme-CI-02 231, 205, 24 181, 149, 132 372, 92

Polyprion americanus PolAme-MA-01 231, 205, 24 181, 149, 132 372, 92

Polyprion americanus PolAme-MA-02 231, 205, 24 181, 149, 132 372, 92

Pomadasys incisus PomInc-MA-01 uncut 157, 149, 126, 28 193, 177, 92

Pomadasys incisus PomInc-MA-02 uncut 157, 149, 126, 28 193, 133, 64, 42, 26

Pomadasys perotaei PomPer-EE-02 231, 205, 24 179, 157, 126 193, 177, 92

Page 77 of 153

Last printed 14/08/2013 09:50:00

Pomatomus saltatrix PomSal-WM-02 uncut 187, 149, 126 284, 92, 86

Pomatomus saltatrix PomSal-EM-01 uncut 187, 149, 126 284, 92, 86

Pomatomus saltatrix PomSal-EM-02 uncut 187, 149, 126 284, 92, 86

Psetta maxima PseMax-CS-01 279, 118, 36, 24 181, 149, 132 uncut

Psetta maxima PseMax-CS-02 279, 118, 36, 24 181, 149, 132 uncut

Psetta maxima PseMax-NS-01 279, 118, 36, 24 181, 149, 132 uncut

Psetta maxima PseMax-NS-02 279, 118, 36, 24 181, 149, 132 uncut

Psetta maxima PseMax-CB-01 279, 118, 36, 24 181, 149, 132 uncut

Psetta maxima PseMax-CB-02 279, 118, 36, 24 181, 149, 132 uncut

Psetta maxima PseMax-SB-01 279, 118, 36, 24 181, 149, 132 uncut

Psetta maxima PseMax-SB-02 279, 118, 36, 24 181, 149, 132 uncut

Pseudocaranx dentex PseDen-CI-02 uncut 179, 151, 126, 4 uncut

Pseudocaranx dentex PseDen-MA-01 uncut 179, 151, 126, 4 uncut

Pseudotolithus elongatus PseElo-EE-02 318, 118, 24 149, 132, 110, 69 217, 153, 92

Ranzania laevis RanLae-CI-01 uncut 295, 132, 35 uncut

Ranzania laevis RanLae-CI-02 uncut 295, 132, 35 uncut

Ruvettus pretiosus RuvPre-CI-01 uncut 338, 126 159, 123, 86, 64, 26

Salmo salar SalSal-SB-01 318, 118, 24 315, 107, 40 438, 26

Salmo salar SalSal-SB-02 318, 118, 24 424, 40 438, 26

Salmo trutta SalTru-NS-01 318, 118, 24 424, 40 438, 26

Salmo trutta SalTru-NS-02 318, 118, 24 424, 40 438, 26

Salmo trutta SalTru-SB-01 318, 118, 24 424, 40 438, 26

Salmo trutta SalTru-SB-02 318, 118, 24 424, 40 438, 26

Sarda sarda SarSar-WM-01 229, 207, 24 187, 149, 126 247, 123, 92

Sarda sarda SarSar-WM-02 229, 207, 24 187, 149, 126 247, 123, 92

Sarda sarda SarSar-CS-01 229, 207, 24 149, 144, 126, 35, 4 247, 123, 92

Sarda sarda SarSar-CS-02 229, 207, 24 149, 144, 126, 35, 4 247, 123, 92

Sarda sarda SarSar-CI-01 229, 207, 24 149, 144, 126, 35, 4 247, 123, 92

Sarda sarda SarSar-CI-02 229, 207, 24 149, 144, 126, 35, 4 247, 123, 92

Sarda sarda SarSar-CB-01 229, 207, 24 187, 149, 126 247, 123, 92

Sarda sarda SarSar-CB-02 229, 207, 24 187, 149, 126 247, 123, 92

Sarda sarda SarSar-EM-01 229, 207, 24 149, 144, 126, 35, 4 247, 123, 92

Sarda sarda SarSar-EM-02 229, 207, 24 187, 149, 126 247, 123, 92

Sardina pilchardus SarPil-WM-01 276, 187 301, 103, 44, 12 193, 177, 32, 30, 26

Sardina pilchardus SarPil-WM-02 276, 187 301, 103, 44, 12 193, 177, 32, 30, 26

Sardina pilchardus SarPil-CS-01 276, 187 301, 103, 44, 12 193, 177, 32, 30, 26

Sardina pilchardus SarPil-CS-02 276, 187 301, 103, 44, 12 193, 177, 32, 30, 26

Sardina pilchardus SarPil-CI-01 276, 187 301, 103, 44, 12 193, 177, 32, 30, 26

Sardina pilchardus SarPil-CI-02 276, 187 301, 103, 44, 12 193, 177, 32, 30, 26

Sardina pilchardus SarPil-MA-01 276, 187 301, 103, 44, 12 193, 177, 32, 30, 26

Sardina pilchardus SarPil-MA-02 276, 187 301, 103, 44, 12 193, 177, 32, 30, 26

Sardina pilchardus SarPil-NS-01 276, 187 301, 103, 44, 12 193, 177, 32, 30, 26

Page 78 of 153

Last printed 14/08/2013 09:50:00

Sardina pilchardus SarPil-CB-01 276, 187 301, 103, 44, 12 193, 177, 32, 30, 26

Sardina pilchardus SarPil-CB-02 276, 187 301, 103, 44, 12 193, 177, 32, 30, 26

Sardina pilchardus SarPil-EM-01 276, 187 301, 103, 44, 12 193, 177, 32, 30, 26

Sardina pilchardus SarPil-EM-02 276, 187 301, 103, 44, 12 193, 177, 32, 30, 26

Sardinella aurita SarAur-WM-01 258, 205 uncut 280, 124, 30, 26

Sardinella aurita SarAur-WM-02 258, 205 uncut 280, 124, 30, 26

Sardinella aurita SarAur-CI-01 258, 205 uncut 280, 124, 30, 26

Sardinella aurita SarAur-CI-02 258, 205 uncut 280, 124, 30, 26

Sardinella aurita SarAur-EM-01 258, 205 uncut 280, 124, 30, 26

Sardinella aurita SarAur-EM-02 258, 205 uncut 280, 124, 30, 26

Sardinella maderensis SarMad-MA-01 231, 205, 24 332, 81, 49 280, 90, 58, 32

Sardinella maderensis SarMad-MA-02 231, 205, 24 332, 81, 49 280, 90, 58, 32

Sarpa salpa SarSal-WM-01 258, 205 uncut 177, 108, 83, 64, 26

Sarpa salpa SarSal-MA-01 258, 205 uncut 177, 108, 83, 64, 26

Sarpa salpa SarSal-MA-02 258, 205 244, 220 177, 108, 83, 64, 26

Sarpa salpa SarSal-EM-01 258, 205 uncut 177, 108, 83, 64, 26

Sarpa salpa SarSal-EM-02 258, 205 uncut 177, 108, 83, 32, 30, 26

Scarus hoefleri ScaHoe-EE-01 uncut 159, 133, 110, 58 371, 93

Schedophilus ovalis SchOva-CI-01 439, 24 181, 149, 126, 4 uncut

Schedophilus ovalis SchOva-CI-02 439, 24 181, 149, 126, 4 uncut

Schedophilus velaini SchVel-EE-01 439, 24 181, 149, 126, 4 284, 92, 86

Schedophilus velaini SchVel-EE-02 439, 24 181, 149, 126, 4 284, 92, 86

Scomber colias ScoCol-WM-01 229, 207, 24 uncut 284, 92, 78, 6

Scomber colias ScoCol-WM-02 229, 207, 24 uncut 284, 92, 78, 6

Scomber colias ScoCol-CS-01 229, 207, 24 uncut 284, 92, 78, 6

Scomber colias ScoCol-CS-02 229, 207, 24 uncut 284, 92, 78, 6

Scomber colias ScoCol-MA-01 229, 207, 24 uncut 284, 92, 78, 6

Scomber colias ScoCol-MA-02 229, 207, 24 uncut 284, 92, 78, 6

Scomber colias ScoCol-CB-01 229, 207, 24 uncut 284, 92, 78, 6

Scomber colias ScoCol-CB-02 229, 207, 24 uncut 284, 92, 78, 6

Scomber colias ScoCol-EM-01 229, 207, 24 uncut 284, 92, 78, 6

Scomber colias ScoCol-EM-02 229, 207, 24 uncut 284, 92, 78, 6

Scomber scombrus ScoSco-WM-01 229, 207, 24 338, 126 280, 92, 90

Scomber scombrus ScoSco-WM-02 229, 207, 24 338, 126 280, 92, 90

Scomber scombrus ScoSco-CS-01 229, 207, 24 338, 126 280, 92, 90

Scomber scombrus ScoSco-CS-02 229, 207, 24 338, 126 280, 92, 90

Scomber scombrus ScoSco-NS-01 229, 207, 24 338, 126 280, 92, 90

Scomber scombrus ScoSco-NS-02 229, 207, 24 338, 126 280, 92, 90

Scomber scombrus ScoSco-CB-01 229, 207, 24 338, 126 280, 92, 90

Scomber scombrus ScoSco-CB-02 229, 207, 24 338, 126 280, 92, 90

Scomber scombrus ScoSco-EM-01 229, 207, 24 338, 126 280, 92, 90

Scomber scombrus ScoSco-EM-02 229, 207, 24 338, 126 280, 92, 90

Page 79 of 153

Last printed 14/08/2013 09:50:00

Scomber scombrus ScoSco-SB-02 229, 207, 24 338, 126 280, 92, 90

Scophthalmus rhombus ScoRho-WM-01 279, 157, 24 181, 149, 132 271, 193

Scophthalmus rhombus ScoRho-WM-02 279, 157, 24 181, 149, 75, 55 211, 193, 58

Scophthalmus rhombus ScoRho-CS-01 279, 157, 24 181, 149, 132 271, 193

Scophthalmus rhombus ScoRho-CS-02 279, 157, 24 181, 149, 75, 55 211, 193, 58

Scophthalmus rhombus ScoRho-NS-01 279, 157, 24 181, 149, 75, 55 211, 193, 58

Scophthalmus rhombus ScoRho-NS-02 279, 157, 24 181, 149, 75, 55 211, 193, 58

Scophthalmus rhombus ScoRho-CB-01 279, 157, 24 181, 149, 75, 55 211, 193, 58

Scophthalmus rhombus ScoRho-CB-02 279, 157, 24 181, 149, 75, 55 211, 193, 58

Scophthalmus rhombus ScoRho-EM-01 279, 157, 24 181, 149, 75, 55 211, 193, 58

Scophthalmus rhombus ScoRho-EM-02 279, 157, 24 181, 149, 75, 55 211, 193, 58

Scophthalmus rhombus ScoRho-SB-02 279, 157, 24 181, 149, 75, 55 211, 193, 58

Scorpaena elongata ScoElo-EE-01 258, 205 179, 157, 126 284, 92, 86

Scorpaena elongata ScoElo-EE-02 258, 205 179, 157, 126 284, 92, 86

Scorpaena porcus ScoPor-WM-01 439, 24 228, 149, 44, 28, 9 284, 92, 86

Scorpaena porcus ScoPor-WM-02 439, 24 228, 149, 44, 28, 9 284, 92, 86

Scorpaena porcus ScoPor-CS-01 439, 24 274, 149, 28, 9 284, 92, 86

Scorpaena porcus ScoPor-CS-02 439, 24 274, 149, 28, 9 284, 92, 86

Scorpaena porcus ScoPor-CI-01 439, 24 228, 149, 44, 28, 9 284, 92, 86

Scorpaena porcus ScoPor-CI-02 439, 24 228, 149, 44, 28, 9 284, 92, 86

Scorpaena porcus ScoPor-EM-01 439, 24 228, 149, 44, 28, 9 284, 92, 86

Scorpaena porcus ScoPor-EM-02 439, 24 274, 149, 28, 9 284, 92, 86

Scorpaena scrofa ScoScr-WM-01 258, 205 285, 179 284, 92, 86

Scorpaena scrofa ScoScr-WM-02 258, 205 285, 179 284, 92, 86

Scorpaena scrofa ScoScr-CI-01 258, 205 285, 179 284, 92, 86

Scorpaena scrofa ScoScr-CI-02 258, 205 285, 179 284, 92, 86

Scorpaena scrofa ScoScr-MA-02 258, 205 285, 179 284, 92, 86

Scorpaena scrofa ScoScr-EM-01 258, 205 285, 179 284, 92, 86

Scorpaena scrofa ScoScr-EM-02 258, 205 285, 179 284, 92, 86

Sebastes mentella SebMen-EE-01 291, 145, 24 332, 132 193, 177, 92

Sebastes mentella SebMen-EE-02 291, 145, 24 332, 132 193, 177, 92

Sebastes viviparus SebViv-SB-01 291, 145, 24 332, 132 193, 177, 92

Sebastes viviparus SebViv-SB-02 291, 145, 24 332, 132 193, 177, 92

Seriola carpenteri SerCar-CI-01 231, 118, 84, 24 170, 132, 118, 40 180, 155, 123, 2

Seriola carpenteri SerCar-CI-02 231, 118, 84, 24 170, 132, 118, 40 180, 155, 123, 2

Seriola dumerili SerDum-WM-01 231, 118, 84, 24 170, 132, 118, 40 180, 155, 123, 2

Seriola dumerili SerDum-WM-02 231, 118, 84, 24 170, 132, 118, 40 180, 155, 123, 2

Seriola dumerili SerDum-CI-01 231, 118, 84, 24 170, 132, 118, 40 180, 155, 123, 2

Seriola dumerili SerDum-CI-02 231, 118, 84, 24 170, 132, 118, 40 180, 155, 123, 2

Seriola dumerili SerDum-MA-01 231, 118, 84, 24 170, 132, 118, 40 180, 155, 123, 2

Seriola dumerili SerDum-MA-02 231, 118, 84, 24 170, 132, 118, 40 180, 155, 123, 2

Seriola dumerili SerDum-EM-01 231, 118, 84, 24 170, 132, 118, 40 180, 155, 123, 2

Page 80 of 153

Last printed 14/08/2013 09:50:00

Seriola fasciata SerFas-MA-01 318, 118, 24 170, 132, 118, 40 184, 155, 123

Seriola fasciata SerFas-MA-02 318, 118, 24 170, 132, 118, 40 184, 155, 123

Seriola rivoliana SerRiv-CI-01 231, 157, 45, 24 290, 132, 40 180, 159, 123

Seriola rivoliana SerRiv-CI-02 231, 157, 45, 24 290, 132, 40 180, 159, 123

Seriola rivoliana SerRiv-MA-01 231, 157, 45, 24 290, 132, 40 180, 159, 123

Seriola rivoliana SerRiv-MA-02 231, 157, 45, 24 290, 132, 40 180, 159, 123

Serranus atricauda SerAtr-MA-01 uncut 179, 151, 132 uncut

Serranus atricauda SerAtr-MA-02 uncut 179, 151, 132 uncut

Serranus cabrilla SerCab-WM-01 uncut 179, 151, 132 284, 180

Serranus cabrilla SerCab-WM-02 uncut 179, 151, 132 284, 180

Serranus cabrilla SerCab-EM-01 uncut 179, 151, 132 284, 180

Serranus cabrilla SerCab-EM-02 uncut 179, 151, 132 284, 180

Serranus hepatus SerHep-WM-01 uncut 332, 132 381, 83

Serranus hepatus SerHep-WM-02 uncut 332, 132 381, 83

Serranus hepatus SerHep-EM-01 uncut 332, 132 381, 83

Serranus hepatus SerHep-EM-02 uncut 332, 132 381, 83

Serranus scriba SerScr-WM-01 uncut 332, 126, 4 271, 193

Serranus scriba SerScr-WM-02 uncut 332, 126, 4 271, 193

Solea senegalensis SolSen-WM-01 318, 145 187, 149, 126 247, 123, 92

Solea senegalensis SolSen-WM-02 318, 145 187, 149, 126 247, 123, 92

Solea senegalensis SolSen-CS-01 318, 145 187, 149, 126 247, 123, 92

Solea senegalensis SolSen-CS-02 318, 145 187, 149, 126 247, 123, 92

Solea solea SolSol-WM-01 439, 24 264, 149, 49 341, 123

Solea solea SolSol-WM-02 439, 24 264, 149, 49 341, 123

Solea solea SolSol-CS-01 439, 24 264, 149, 49 341, 123

Solea solea SolSol-CS-02 439, 24 264, 149, 49 341, 123

Solea solea SolSol-EE-02 439, 24 181, 126, 107, 40, 4 180, 159, 123

Solea solea SolSol-NS-01 439, 24 264, 149, 49 341, 123

Solea solea SolSol-NS-02 439, 24 264, 149, 49 341, 123

Solea solea SolSol-CB-01 439, 24 264, 149, 49 341, 123

Solea solea SolSol-CB-02 439, 24 264, 149, 49 341, 123

Solea solea SolSol-EM-01 439, 24 264, 149, 49 341, 123

Solea solea SolSol-EM-02 439, 24 264, 149, 49 341, 123

Solea solea SolSol-EM-03 439, 24 264, 149, 49 341, 123

Solea solea SolSol-EM-04 439, 24 264, 149, 49 341, 123

Solea solea SolSol-EM-05 439, 24 264, 149, 49 341, 123

Solea solea SolSol-SB-01 439, 24 264, 149, 49 341, 123

Solea solea SolSol-SB-02 439, 24 264, 149, 49 341, 123

Solea solea SolSol-SB-03 439, 24 264, 149, 49 341, 123

Solea solea SolSol-SB-04 439, 24 264, 149, 49 341, 123

Solea solea SolSol-SB-05 439, 24 264, 149, 49 341, 123

Sparisoma rubripinne SpaRub-EE-01 439, 24 179, 157, 126 280, 92, 48, 40

Page 81 of 153

Last printed 14/08/2013 09:50:00

Sparus aurata SpaAur-WM-02 298, 165 uncut 372, 64, 26

Sparus aurata SpaAur-CS-01 298, 165 uncut 372, 64, 26

Sparus aurata SpaAur-CB-01 298, 165 uncut 372, 64, 26

Sparus aurata SpaAur-CB-02 298, 165 uncut 372, 64, 26

Sparus aurata SpaAur-EM-02 298, 165 uncut 372, 64, 26

Sparus aurata SpaAur-EM-05 298, 165 uncut 372, 64, 26

Sphoeroides pachygaster SphPac-CI-01 uncut 338, 126 284, 180

Sphyraena sphyraena SphSph-WM-01 uncut 181, 149, 126, 4 155, 123, 92, 90

Sphyraena sphyraena SphSph-WM-02 uncut 181, 149, 126, 4 155, 123, 92, 90

Spicara flexuosa SpiFle-EM-04 439, 24 uncut 372, 92

Spicara flexuosa SpiFle-EM-05 439, 24 uncut 372, 92

Spicara maena SpiMae-WM-01 439, 24 uncut uncut

Spicara maena SpiMae-EM-01 439, 24 uncut uncut

Spicara maena SpiMae-EM-02 439, 24 uncut uncut

Spicara smaris SpiSma-WM-01 439, 24 244, 220 372, 92

Spicara smaris SpiSma-WM-02 439, 24 244, 220 372, 92

Spicara smaris SpiSma-EM-01 439, 24 244, 220 372, 92

Spicara smaris SpiSma-EM-02 439, 24 244, 220 372, 92

Spondyliosoma cantharus SpoCan-WM-01 439, 24 uncut 372, 92

Spondyliosoma cantharus SpoCan-WM-02 439, 24 uncut 372, 92

Spondyliosoma cantharus SpoCan-CS-01 231, 205, 24 uncut 372, 92

Spondyliosoma cantharus SpoCan-CS-02 231, 205, 24 uncut 372, 92

Spondyliosoma cantharus SpoCan-MA-01 231, 205, 24 uncut 372, 92

Spondyliosoma cantharus SpoCan-CB-01 231, 205, 24 uncut 372, 92

Spondyliosoma cantharus SpoCan-CB-02 231, 205, 24 uncut 372, 92

Spondyliosoma cantharus SpoCan-EM-01 439, 24 uncut 372, 92

Spondyliosoma cantharus SpoCan-EM-02 439, 24 uncut 372, 92

Sprattus sprattus SprSpr-NS-01 279, 157, 24 uncut 280, 90, 58, 32

Sprattus sprattus SprSpr-NS-02 279, 157, 24 uncut 280, 90, 58, 32

Sprattus sprattus SprSpr-CB-01 279, 157, 24 424, 40 280, 90, 58, 32

Sprattus sprattus SprSpr-CB-02 279, 157, 24 uncut 280, 90, 58, 32

Sprattus sprattus SprSpr-SB-01 279, 157, 24 uncut 372, 58, 32

Sprattus sprattus SprSpr-SB-02 279, 157, 24 uncut 280, 90, 58, 32

Synaptura lusitanica SynLus-WM-01 234, 146, 80 332, 132 313, 123, 26

Synapturichthys kleinii SynKle-WM-01 439, 24 uncut 272, 123, 67

Synapturichthys kleinii SynKle-WM-02 439, 24 uncut 272, 123, 67

Synapturichthys kleinii SynKle-CI-01 439, 24 uncut 272, 123, 67

Synapturichthys kleinii SynKle-CI-02 439, 24 uncut 272, 123, 67

Synapturichthys kleinii SynKle-EM-01 439, 24 uncut 272, 123, 67

Synapturichthys kleinii SynKle-EM-02 439, 24 uncut 272, 123, 67

Taractichthys longipinnis TarLon-CI-01 439, 24 181, 149, 126, 4 372, 92

Taractichthys longipinnis TarLon-CI-02 439, 24 181, 149, 126, 4 372, 92

Page 82 of 153

Last printed 14/08/2013 09:50:00

Taurulus bubalis TauBub-SB-02 439, 24 315, 107, 40 uncut

Thunnus alalunga ThuAla-WM-01 229, 207, 24 149, 144, 126, 35, 4 247, 123, 92

Thunnus alalunga ThuAla-WM-02 229, 207, 24 149, 144, 126, 35, 4 247, 123, 92

Thunnus alalunga ThuAla-CS-01 229, 207, 24 149, 144, 126, 35, 4 247, 123, 92

Thunnus alalunga ThuAla-CS-02 229, 207, 24 149, 144, 126, 35, 4 247, 123, 92

Thunnus alalunga ThuAla-CI-01 229, 207, 24 149, 144, 126, 35, 4 247, 123, 92

Thunnus alalunga ThuAla-CI-02 229, 207, 24 149, 144, 126, 35, 4 247, 123, 92

Thunnus alalunga ThuAla-MA-01 229, 207, 24 149, 144, 126, 35, 4 247, 123, 92

Thunnus alalunga ThuAla-MA-02 229, 207, 24 149, 144, 126, 35, 4 247, 123, 92

Thunnus alalunga ThuAla-CB-01 229, 207, 24 149, 144, 126, 35, 4 247, 123, 92

Thunnus alalunga ThuAla-EM-01 229, 207, 24 149, 144, 126, 35, 4 247, 123, 92

Thunnus alalunga ThuAla-EM-02 229, 207, 24 149, 144, 126, 35, 4 247, 123, 92

Thunnus albacares ThuAlb-CI-01 229, 207, 24 149, 144, 132, 35 247, 123, 92

Thunnus albacares ThuAlb-CI-02 229, 207, 24 149, 144, 132, 35 247, 123, 92

Thunnus albacares ThuAlb-EE-01 229, 207, 24 149, 144, 132, 35 247, 123, 92

Thunnus albacares ThuAlb-EE-02 229, 207, 24 149, 144, 132, 35 247, 123, 92

Thunnus obesus ThuObe-CI-02 229, 207, 24 149, 144, 132, 35 247, 123, 92

Thunnus obesus ThuObe-EE-01 229, 207, 24 149, 144, 132, 35 247, 123, 92

Thunnus obesus ThuObe-EE-02 229, 207, 24 149, 144, 132, 35 247, 123, 92

Thunnus obesus ThuObe-MA-01 229, 207, 24 149, 144, 132, 35 247, 123, 92

Thunnus obesus ThuObe-MA-02 229, 207, 24 149, 144, 132, 35 247, 123, 92

Thunnus obesus ThuObe-CB-01 229, 207, 24 149, 144, 132, 35 247, 123, 92

Thunnus thynnus ThuThy-WM-01 207, 165, 61, 24 149, 144, 132, 35 247, 123, 92

Thunnus thynnus ThuThy-WM-02 207, 165, 61, 24 149, 144, 132, 35 247, 123, 92

Thunnus thynnus ThuThy-CS-01 207, 165, 61, 24 149, 144, 132, 35 247, 123, 92

Thunnus thynnus ThuThy-CS-02 207, 165, 61, 24 149, 144, 132, 35 247, 123, 92

Thunnus thynnus ThuThy-MA-01 207, 165, 61, 24 149, 144, 132, 35 247, 123, 92

Thunnus thynnus ThuThy-MA-02 207, 165, 61, 24 149, 144, 132, 35 247, 123, 92

Thunnus thynnus ThuThy-EM-01 207, 165, 61, 24 149, 144, 132, 35 247, 123, 92

Thunnus thynnus ThuThy-EM-02 207, 165, 61, 24 149, 144, 132, 35 247, 123, 92

Trachinus draco TraDra-WM-01 318, 118, 24 181, 132, 107, 40 142, 127, 123, 68

Trachinus draco TraDra-WM-02 318, 118, 24 181, 132, 107, 40 142, 127, 123, 68

Trachinus draco TraDra-EM-01 318, 118, 24 181, 132, 107, 40 142, 127, 123, 68

Trachinus draco TraDra-EM-02 318, 118, 24 181, 132, 107, 40 142, 127, 123, 68

Trachinus draco TraDra-SB-01 318, 118, 24 181, 132, 107, 40 142, 127, 123, 68

Trachinus draco TraDra-SB-02 318, 118, 24 181, 132, 107, 40 142, 127, 123, 68

Trachinus radiatus TraRad-WM-01 318, 118, 24 181, 149, 132 341, 123

Trachinus radiatus TraRad-WM-02 318, 118, 24 181, 149, 132 341, 123

Trachurus mediterraneus TraMed-WM-01 uncut 332, 126, 4 341, 123

Trachurus mediterraneus TraMed-CB-01 uncut 332, 126, 4 341, 123

Trachurus mediterraneus TraMed-CB-02 uncut 332, 126, 4 341, 123

Page 83 of 153

Last printed 14/08/2013 09:50:00

Trachurus mediterraneus TraMed-EM-02 uncut 332, 126, 4 341, 123

Trachurus picturatus TraPic-WM-01 345, 118 338, 126 341, 123

Trachurus picturatus TraPic-WM-02 345, 118 338, 126 341, 123

Trachurus picturatus TraPic-CI-01 345, 118 338, 126 341, 123

Trachurus picturatus TraPic-CI-02 345, 118 338, 126 341, 123

Trachurus picturatus TraPic-MA-01 345, 118 338, 126 341, 123

Trachurus picturatus TraPic-MA-02 345, 118 338, 126 341, 123

Trachurus trachurus TraTra-WM-02 uncut 332, 126, 4 341, 123

Trachurus trachurus TraTra-CS-01 345, 118 338, 126 184, 155, 123

Trachurus trachurus TraTra-CS-02 345, 118 338, 126 184, 155, 123

Trachurus trachurus TraTra-NS-01 345, 118 338, 126 184, 155, 123

Trachurus trachurus TraTra-NS-02 345, 118 338, 126 184, 155, 123

Trachurus trachurus TraTra-CB-01 345, 118 338, 126 184, 155, 123

Trachurus trachurus TraTra-CB-02 345, 118 338, 126 184, 155, 123

Trachurus trachurus TraTra-EM-01 345, 118 338, 126 184, 155, 123

Trachurus trachurus TraTra-EM-02 345, 118 338, 126 184, 155, 123

Trachurus trachurus TraTra-SB-01 345, 118 338, 126 184, 155, 123

Trachurus trachurus TraTra-SB-02 345, 118 338, 126 184, 155, 123

Trigla lyra TriLyr-WM-01 439, 24 149, 140, 126, 28, 9, 4 284, 92, 86

Trigla lyra TriLyr-WM-02 439, 24 151, 149, 126, 28, 4 284, 92, 86

Trigla lyra TriLyr-EM-01 439, 24 151, 149, 126, 28, 4 284, 92, 86

Trigla lyra TriLyr-EM-02 439, 24 151, 149, 126, 28, 4 284, 92, 86

Triglopsis quadricornis TriQua-SB-01 439, 24 315, 107, 40 uncut

Triglopsis quadricornis TriQua-SB-02 439, 24 315, 107, 40 uncut

Trisopterus esmarkii TriEsm-NS-01 258, 118, 84 285, 107, 40, 28 280, 90, 64, 26

Trisopterus esmarkii TriEsm-NS-02 258, 118, 84 285, 107, 40, 28 280, 90, 64, 26

Trisopterus esmarkii TriEsm-SB-01 258, 118, 84 285, 107, 40, 28 280, 90, 64, 26

Trisopterus esmarkii TriEsm-SB-02 258, 118, 84 285, 107, 40, 28 280, 90, 64, 26

Trisopterus esmarkii TriEsm-SB-03 258, 118, 84 285, 107, 40, 28 280, 90, 64, 26

Trisopterus esmarkii TriEsm-SB-04 258, 118, 84 285, 107, 40, 28 280, 90, 64, 26

Trisopterus esmarkii TriEsm-SB-05 258, 118, 84 285, 107, 40, 28 280, 90, 64, 26

Trisopterus luscus TriLus-CS-01 uncut 285, 149, 28 372, 64, 26

Trisopterus luscus TriLus-NS-01 uncut 285, 149, 28 372, 64, 26

Trisopterus luscus TriLus-NS-02 uncut 285, 149, 28 372, 64, 26

Trisopterus luscus TriLus-CB-01 uncut 285, 149, 28 372, 64, 26

Trisopterus luscus TriLus-CB-02 uncut 285, 149, 28 372, 64, 26

Trisopterus minutus TriMin-WM-01 uncut 285, 107, 40, 28 280, 90, 64, 26

Trisopterus minutus TriMin-WM-02 uncut 285, 107, 40, 28 280, 90, 64, 26

Trisopterus minutus TriMin-NS-01 318, 118, 24 285, 107, 40, 28 193, 177, 92

Trisopterus minutus TriMin-NS-02 318, 118, 24 285, 107, 40, 28 193, 177, 92

Trisopterus minutus TriMin-CB-01 318, 118, 24 285, 137, 40 193, 177, 92

Trisopterus minutus TriMin-CB-04 318, 118, 24 285, 107, 40, 28 193, 177, 92

Page 84 of 153

Last printed 14/08/2013 09:50:00

Trisopterus minutus TriMin-EM-02 uncut 285, 107, 40, 28 280, 90, 64, 26

Tylosurus acus TylAcu-WM-01 uncut 285, 149, 28 313, 123, 26

Tylosurus acus TylAcu-CI-01 uncut 285, 149, 28 313, 123, 26

Tylosurus acus TylAcu-CI-02 uncut 285, 149, 28 313, 123, 26

Umbrina canariensis UmbCan-CI-01 439, 24 181, 149, 132 372, 92

Umbrina canariensis UmbCan-CI-02 439, 24 181, 149, 132 372, 92

Uranoscopus scaber UraSca-EM-04 249, 187, 24 338, 126 159, 123, 92, 86

Uranoscopus scaber UraSca-EM-05 249, 187, 24 338, 126 159, 123, 92, 86

Xiphias gladius XipGla-WM-01 439, 24 149, 132, 110, 39, 28 280, 92, 90

Xiphias gladius XipGla-WM-02 439, 24 149, 132, 110, 39, 28 280, 92, 90

Xiphias gladius XipGla-CI-01 439, 24 151, 149, 132, 28 280, 92, 90

Xiphias gladius XipGla-CI-02 439, 24 149, 132, 110, 39, 28 280, 92, 90

Xiphias gladius XipGla-CB-01 439, 24 149, 132, 110, 39, 28 280, 92, 90

Xiphias gladius XipGla-EM-01 439, 24 149, 132, 110, 39, 28 280, 92, 90

Xyrichthys novacula XyrNov-MA-01 375, 88 285, 107, 40, 17, 9 322, 114, 26

Xyrichthys novacula XyrNov-MA-02 375, 88 285, 107, 40, 17, 9 322, 114, 26

Zeus faber ZeuFab-WM-01 234, 118, 108 424, 40 284, 152, 26

Zeus faber ZeuFab-WM-02 234, 118, 108 424, 40 284, 152, 26

Zeus faber ZeuFab-CS-01 234, 118, 108 424, 40 284, 152, 26

Zeus faber ZeuFab-CS-02 234, 118, 108 424, 40 284, 152, 26

Zeus faber ZeuFab-CI-01 234, 118, 108 424, 40 284, 152, 26

Zeus faber ZeuFab-CB-01 234, 118, 108 424, 40 284, 152, 26

Zeus faber ZeuFab-CB-02 234, 118, 108 424, 40 284, 152, 26

Zeus faber ZeuFab-EM-01 234, 118, 108 424, 40 284, 152, 26

Zeus faber ZeuFab-EM-02 234, 118, 108 424, 40 284, 152, 26

Zoarces viviparus ZoaViv-NS-01 uncut 181, 149, 132 322, 142

Zoarces viviparus ZoaViv-NS-02 uncut 181, 149, 132 322, 142

Zoarces viviparus ZoaViv-SB-01 uncut 181, 149, 132 322, 142

Zoarces viviparus ZoaViv-SB-02 uncut 181, 149, 132 322, 142

Page 85 of 153

Last printed 14/08/2013 09:50:00

L:\Food Authenticity\Archive\AUTHENTICITY\Research Projects\Final reports\Reports\Q01099 Fish _CCFRA\FINAL VERSIONS AUGUST 2010\Q01099 Final Report August 2010.doc

Appendix C: Comparison of experimental PCR-RFLP profiles to theoretical profiles produced from FishTrace and Campden BRI sequence data.

FISHTRACE dB FISH SPECIES DdeI profile (bp) HaeIII profile (bp) NlaIII profile (bp) ID CODE Anarhichas lupus Catfish AnaLup-EE-01 318, 118, 24 149, 132, 94, 85 284, 92, 48, 36 DNA 500 PCR-RFLP 329, 120 146, 137, 96, 86 278, 104, 50, 40 Clupea harengus Herring CluHar-NS-01 uncut uncut 372, 64, 26 CCFRA theoretical 466 466 371, 66, 29 DNA 500 PCR-RFLP 491 493 382, 76 Series II PCR-RFLP 516 520 394, 84 Dicentrarchus labrax 181, 126, 61, 44, 40, Sea bass DicLab-CS-01 252, 145, 36, 24 4 287, 92, 83 181, 126, 61, 44, 40, Dicentrarchus labrax DicLab-CS-02 192, 145, 57, 36, 24 4 287, 92, 83 183, 126, 63, 46, 40, CCFRA theoretical 195, 121, 60, 39, 26, 23 4 289, 91, 84 Series II PCR-RFLP 200, 123, 64, 42, 21 187, 137, 62, 42 289,109 90 Engraulis encrasicolus Anchovy EngEnc-CB-01 231, 205, 24 229, 160, 73 284, 120, 58 Engraulis encrasicolus EngEnc-CB-02 231, 205, 24 229, 160, 73 284, 180 DNA 500 PCR-RFLP 237, 200 229, 156, 71 275, 181 Gadus morhua Atlantic cod GadMor-CS-01 231, 118, 84, 24 315, 107, 40 284, 92, 86 CCFRA theoretical 234, 118, 87, 25 314, 109, 41 287, 89, 88 Series DNA 500 PCR- RFLP 234, 115, 84 321, 102, 37 280, 100, 89 Series II PCR-RFLP 248, 123, 95 332, 111, 47 290,107, 98 Glyptocephalus cynoglossus Witch GlyCyn-NS-01 298, 157, 5 235, 126, 95, 4 284, 92, 86 CCFRA theoretical 300, 156, 8 235, 126, 97, 6 286, 90, 88 Series II PCR-RFLP 308, 301, 154 236, 132, 99 288, 107, 96 Hippoglossus HipHip -NS-01 uncut 193, 132, 95, 40 284, 92, 86 Page 86 of 153

Last printed 14/08/2013 09:50:00

L:\Food Authenticity\Archive\AUTHENTICITY\Research Projects\Final reports\Reports\Q01099 Fish _CCFRA\FINAL VERSIONS AUGUST 2010\Q01099 Final Report August 2010.doc hippoglossus Halibut Series II PCR-RFLP 489 196, 137, 100 288, 106, 94 Katsuwonus pelamis Skipjack tuna KatPel-CS-01 229, 207, 24 332, 132 159, 123, 92, 86 CCFRA theoretical 228, 210, 18, 8 332, 132 161, 125, 90, 88 Series II PCR-RFLP 232, 215 330, 137 166, 123, 106, 91 Limanda limanda Dab LimLim-NS-01 234, 157, 39, 27 290, 132, 40 284, 92, 86 DNA 500 PCR-RFLP 233, 153, 43, 25 288, 134, 38 283, 100, 86

FISHTRACE dB FISH SPECIES DdeI profile (bp) HaeIII profile (bp) NlaIII profile (bp) ID CODE Lophius piscatorius Monkfish LopPis-CS-01 234, 229 295, 169 159, 123, 92, 86 CCFRA theoretical 232, 229 293, 168 161, 119, 93, 88 DNA 500 PCR-RFLP 240, 234, 226 292, 172 169, 126, 101, 93 Series II PCR-RFLP 234 303, 179 Melanogrammus aeglefinus Haddock MelAeg-SB-02 439, 24 424, 40 193, 180, 89 CCFRA theoretical 439, 25 423, 41 196, 177, 91 DNA500 PCR-RFLP 433 37, 429 94, 183 Series II PCR-RFLP 434 47, 400 100, 191 Merlangius merlangus Whiting MeaMea-NS-01 345, 118 315, 107, 40 372, 92 Merlangius merlangus MeaMea-SB-02 345, 118 315, 107, 40 193, 177, 92 CCFRA theoretical 346, 118 314, 109, 41 196, 179, 89 DNA500 PCR-RFLP 355, 344, 115 326, 101, 37 186, 100 Series II PCR-RFLP 368, 123 336, 110, 47 195, 107 Merluccius merluccius MerMer -WM- E.Hake 01 306, 157 187, 126, 107, 40 uncut CCFRA theoretical 306, 158 189, 124, 109, 42 464 uncut DNA 500 PCR-RFLP 314, 307, 155 185, 127, 101, 28 477 uncut Series II PCR-RFLP 327, 321, 160 198, 134, 110, 44 505 Microstomus kitt Lemon sole MicKit-NS-01 uncut 296, 126, 40 193, 92, 89, 86 Microstomus kitt MicKit-CB-01 uncut 296, 126, 40 284, 92, 86 CCFRA theoretical Series II PCR-RFLP 458 297, 131, 48 192, 103, 97 Molva molva Ling MolMol-CS-01 231, 205, 24 315, 149 284, 92, 86 Molva molva MolMol-NS-02 439, 24 315, 107, 40 284, 92, 86 Molva molva MolMol-CB-01 231, 205, 24 315, 107, 40 284, 92, 86 DNA 500 PCR-RFLP 242, 195 325, 99, 35 280, 102, 94

Page 87 of 153

Last printed 14/08/2013 09:50:00

Mullus surmuletus Red Mullet MulSur-WM-01 279, 157, 24 187, 126, 107, 40 284, 92, 48, 36 CCFRA theoretical 282, 160, 19 189, 122, 109, 41 247, 90, 50, 38, 36 Series II PCR-RFLP 301, 162 198, 133, 111 Platichthys flesus Flounder PlaFle-CS-01 318, 145 290, 132, 40 284, 92, 86 CCFRA Theoretical 319, 148 292, 129, 41, 5 283, 96, 88 Series II PCR-RFLP 336, 329, 145 298, 138, 48 291, 107, 94 Pleuronectes platessa E. Plaice PlePla-NS-01 276, 145, 39 290, 132, 40 193, 92, 89, 86 Pleuronectes platessa PlePla-NS-02 276, 145, 39 290, 132, 40 193, 92, 89, 86 CCFRA theoretical 277, 145, 42 292, 131, 41 196, 91, 89, 88 DNA500 PCR-RFLP 273, 266, 138, 32 286, 129, 37 187, 100, 88 Series II PCR-RFLP 280, 273, 144, 41 298, 136, 46 193, 103, 90 Pollachius pollachius Pollock PolPol-CS-01 439, 24 315, 107, 40 372, 92 CCFRA theoretical 442, 24 316, 109, 41 371, 95 DNA 500 PCR-RFLP 451 324, 101, 35 373, 101 Series II PCR-RFLP 333, 109, 44 381, 106 Pollachius virens Coley PolVir-NS-01 318, 118, 24 315, 107, 40 372, 92 CCFRA theoretical 321, 118, 25 312, 109, 41 375, 89 Series I PCR-RFLP 328, 117 323, 103, 37 372, 101 Series II PCR-RFLP 339, 122 335, 111. 48 382, 108 Psetta maxima Turbot PseMax-CS-01 279, 118, 36, 24 181, 149, 132 uncut CCFRA theoretical 282, 118, 39, 28 183, 150, 134 467 Series II PCR-RFLP 296, 124, 38 190, 149, 135 487 Salmo salar Atlantic salmon SalSal-SB-01 318, 118, 24 315, 107, 40 438, 26 Salmo salar SalSal-SB-02 318, 118, 24 424, 40 438, 26 DNA500 PCR-RFLP 326, 318, 113 319, 100, 37 441 Series II PCR-RFLP 332, 117 330, 105, 40 458

Sarda sarda Bonito SarSar-WM-01 229, 207, 24 187, 149, 126 247, 123, 92 Sarda sarda SarSar-CS-01 229, 207, 24 149, 144, 126, 35, 4 247, 123, 92 CCFRA Theoretical 229, 210, 27 189, 150, 127, 249, 126, 91 Series II PCR-RFLP 233, 214 189, 149, 131 253, 128, 108 Sardina pilchardus Sardine SarPil-WM-01 276, 187 301, 103, 44, 12 193, 177, 32, 30, 26 CCFRA Theoretical 276, 190 302, 104, 46, 14 192, 179, 34, 32, 29 Page 88 of 153

Last printed 14/08/2013 09:50:00

L:\Food Authenticity\Archive\AUTHENTICITY\Research Projects\Final reports\Reports\Q01099 Fish _CCFRA\FINAL VERSIONS AUGUST 2010\Q01099 Final Report August 2010.doc Series II PCR-RFLP 291, 285, 187 315, 109, 41 195, 189, 61, 51 Scomber scombrus Mackerel ScoSco-WM-01 229, 207, 24 338, 126 280, 92, 90 DNA 500 PCR-RFLP 219, 209 328, 128 Scophthalmus rhombus Brill ScoRho-WM-01 279, 157, 24 181, 149, 132 271, 193 Scophthalmus rhombus ScoRho-WM-02 279, 157, 24 181, 149, 75, 55 211, 193, 58 DNA 500 PCR-RFLP 285, 155 182, 145, 73, 52 219, 186, 62 Solea solea Dover sole SolSol-WM-01 439, 24 264, 149, 49 341, 123 CCFRA theoretical 437, 26 266, 148, 49 339, 124 Series II PCR-RFLP 451 271, 148, 58 359, 124 Sparus aurata Gilthead bream SpaAur-WM-01 298, 165 uncut 372, 64, 26 Series II PCR-RFLP 305, 298, 167 467 374, 89 Spondyliosoma cantharus Black Sea Bream SpoCan-WM-01 439, 24 uncut 372, 92 Spondyliosoma cantharus SpoCan-CB-02 231, 205, 24 uncut 372, 92 CCFRA theoretical 234, 205, 23 uncut 368, 94 Series II PCR-RFLP 238, 208 468 372, 107 Thunnus alalunga Albacore tuna ThuAla-WM-01 229, 207, 24 149, 144, 126, 35, 4 247, 123, 92 CCFRA theoretical 228, 210, 18, 8 149, 146, 126, 37, 6 249, 125, 90 Series II PCR-RFLP 232, 213 146, 132, 33 250, 127, 107 Thunnus albacares Yellowfin tuna ThuAlb-CI-01 229, 207, 24 149, 144, 132, 35 247, 123, 92 CCFRA theoretical 228, 210, 18, 8 149, 146, 132, 37 249, 125, 90 Series II PCR-RFLP 230, 213 150, 146, 137, 34 250, 127, 107 Thunnus obesus Bigeye tuna ThuObe-CI-02 229, 207, 24 149, 144, 132, 35 247, 123, 92 CCFRA theoretical 229, 210, 18, 8 149, 146, 132, 37 250, 125, 90 Series II PCR-RFLP 231, 215 150, 145, 137, 35 250, 127, 107 Thunnus thynnus Bluefin tuna ThuThy-WM-01 207, 165, 61, 24 149, 144, 132, 35 247, 123, 92 CCFRA theoretical 210, 164, 18, 8 149, 146, 132, 37 249, 125, 90 Xiphias gladius Sword fish XipGla-WM-01 439, 24 149, 132, 110, 39, 28 280, 92, 90 Xiphias gladius XipGla-CI-01 439, 24 151, 149, 132, 28 280, 92, 90 Series II PCR-RFLP 459 197, 138, 100, 45 280, 106, 97 Zeus faber John Dory ZeuFab-WM-01 234, 118, 108 424, 40 284, 152, 26

Page 89 of 153

Last printed 14/08/2013 09:50:00

Some species exhibit more than one FishTrace PCR-RFLP profile.

Dde I fragments in bold are experimentally derived double fragments that sometimes occur. They are produced from a primer which contains a Dde I cutting site, consequently one DNA fragment is shorter than the other by a few bp.

Not all small PCR-RFLP fragments (<30bp) are detected by the Bioanalyzer on its default setting.

DNA 500 PCR-RFLP: experimental data produced using the old Agilent DNA 500 labchip kit. Series II PCR-RFLP: experimental data produced using the new Agilent DNA 1000 labchip kit. CCFRA theoretical: a theoretical profile produced from CCFRA sequence data.

Appendix C

Version 1.0, October 2007

STANDARD OPERATING PROCEDURE FOR THE DISCRIMINATION OF SALMON

Page 90 of 153

Last printed 14/08/2013 09:50:00

Prepared by

Campden BRI

Page 91 of 153

Last printed 14/08/2013 09:50:00

L:\Food Authenticity\Archive\AUTHENTICITY\Research Projects\Final reports\Reports\Q01099 Fish _CCFRA\FINAL VERSIONS AUGUST 2010\Q01099 Final Report August 2010.doc CONTENTS 1. HISTORY / BACKGROUND ...... 94 2. PURPOSE ...... 94 3. SCOPE ...... 94 4. DEFINITIONS AND ABBREVIATIONS ...... 95 5. PRINCIPLE OF THE METHOD ...... 95 6. MATERIALS AND EQUIPMENT ...... 96

6.1 WATER ...... 96

6.2 SOLUTIONS, STANDARDS AND REFERENCE MATERIALS ...... 96

6.2.1 4MM DNTP MIXTURE ...... 96

6.2.2 5µM PRIMER SOLUTIONS (CYT B5-F AND CYT B5-R) ...... 96

6.2.3 AMPLITAQ GOLD® POLYMERASE ...... 97

6.2.4 PCR MASTERMIX ...... 97

6.2.5 EDTA SOLUTION ...... 98

0.5M Stock Solution ...... 98

60mM Working Solution ...... 99

6.2.6 RESTRICTION ENZYMES ...... 99

6.2.7 POSITIVE AND NEGATIVE DNA CONTROLS ...... 99

6.2.8 TEMPLATE DNA SOLUTIONS OF SAMPLES ...... 99

6.2.9 ETHANOL 80% (V/V) ...... 100

6.2.10 HAZ TAB ...... 100

6.3 EQUIPMENT ...... 101

6.3.1 THERMOCYCLER...... 101

6.3.2 LAMINAR FLOW HOOD (PCR HOOD)...... 101

6.3.3 SETS OF GILSON PRECISION PIPETTES (INCLUDING, P10, P20, P100, P200, P1000)...... 101

6.3.4 BENCHTOP WHIRLIMIXER...... 101

6.3.5 BENCHTOP CENTRIFUGE FOR MICROTUBES...... 101 Page 92 of 153

Last printed 14/08/2013 09:50:00

6.3.7 AGILENT 2100 BIOANALYZER...... 101

6.3.8 VORTEX MIXER – IKA MODEL MS2-S8/S9...... 101

6.3.9 1.5 ML EPPENDORF TUBES ...... 101

6.3.10 2.0 ML EPPENDORF TUBES...... 101

6.3.11 PCR TUBE STRIPS WITH ATTACHED CAPS (EIGHT REACTIONS EACH)...... 101

6.3.12 PCR TUBE STORAGE BLOCK FOR PREPARATION OF PCRS...... 101

6.3.13 96 WELL PCR PLATES AND LIDS OR SEALS...... 101

7. PROCEDURES ...... 101

7.1 SAMPLE PREPARATION ...... 101

7.2 AMPLIFICATION OF CYT B SEQUENCES ...... 102

7.3 CONFIRMATION OF CYT B GENE AMPLIFICATION ...... 104

7.4 RESTRICTION DIGESTION OF PCR PRODUCTS ...... 104

7.5 FINGERPRINTING SAMPLES ON THE AGILENT 2100 BIOANALYZER ...... 106

7.6 QUALITY ASSURANCE ...... 107

7.6.1 NEGATIVE CONTROLS ...... 107

7.6.2 POSITIVE PCR CONTROLS...... 107

7.6.3 PCR AMPLIFICATION ...... 108

7.6.4 RESTRICTION DIGEST QUALITY CONTROL ...... 108

7.6.5 2100 BIOANALYZER QUALITY CONTROL ...... 108

7.6.6 PRESENCE OF SPECIES ...... 108

8. EXPRESSION OF RESULTS ...... 108 9. PRECISION AND ACCURACY ...... 109 10. APPENDICES ...... 110

10.1 APPENDIX ONE ...... 110

Page 93 of 153

Last printed 14/08/2013 09:50:00

L:\Food Authenticity\Archive\AUTHENTICITY\Research Projects\Final reports\Reports\Q01099 Fish _CCFRA\FINAL VERSIONS AUGUST 2010\Q01099 Final Report August 2010.doc

Page 94 of 153

Last printed 14/08/2013 09:50:00

L:\Food Authenticity\Archive\AUTHENTICITY\Research Projects\Final reports\Reports\Q01099 Fish _CCFRA\FINAL VERSIONS AUGUST 2010\Q01099 Final Report August 2010.doc HISTORY / BACKGROUND

Differences in DNA sequences allow species to be discriminated. The mitochondrial cytochrome b (cyt b) gene, which contains regions of sequence variation, has proved a popular choice for taxonomists. It is not highly conserved and has a rapid mutation rate and is useful in the study of evolutionary relationships between species. There are also 1000s of copies of the mitochondrial genome in each cell making it an ideal target for DNA amplification in samples where DNA degradation has occurred.

The polymerase chain reaction (PCR) can be used to amplify DNA sequences. By combining PCR with restriction fragment length polymorphisms (RFLP) analysis it is possible to produce DNA fragment profiles that discriminate a large number of fish species.

Large cyt b DNA targets such as the 464bp target used in other PCR-RFLP methods cannot be amplified from heavily processed canned fish products. Therefore smaller targets must be used.

Detection of the small DNA fragments generated by PCR-RFLP is performed on a lab-on-a-chip capillary electrophoresis system, the Agilent 2100 Bioanalyzer.

This method was developed by Campden BRI for Food Standards Agency in project Q01099: “Extending the Lab-on-a-Chip Capillary Electrophoresis PCR-RFLP Database for a wider range of commercial fish species”.

PURPOSE

The purpose of this SOP is to enable discrimination of five salmon species found in commercial canned products.

SCOPE

The method describes amplification of a 168bp cyt b amplicon and RFLP profiling to discriminate five Pacific salmon species found in commercial canned products. These species include; red salmon (Oncorhynchus nerka), chum salmon (Oncorhynchus keta), pink salmon (Oncorhynchus gorbuscha), coho salmon (Oncorhynchus kisutch) and chinook salmon (Oncorhynchus tschawytscha). Other fish species not subject to this study could, in theory, generate the same DNA profile as the salmon species present in the sample as they may share the same genetic profile. However, the method can successfully be used to establish consistency between the sample under investigation and the known reference salmon species.

Page 95 of 153

Last printed 14/08/2013 09:50:00

L:\Food Authenticity\Archive\AUTHENTICITY\Research Projects\Final reports\Reports\Q01099 Fish _CCFRA\FINAL VERSIONS AUGUST 2010\Q01099 Final Report August 2010.doc DEFINITIONS AND ABBREVIATIONS

DNA : Deoxy-ribonucleic acid. This molecule comprises strings of the four bases (Guanine, Adenosine, Thymine, Cytosine) forming genes. dNTP : deoxy-nucleotide-triphosphates. An abbreviation for any of the four bases forming DNA. NTC : No template control. PCR : Polymerase chain reaction – a method of amplifying a single DNA fragment to produce millions of copies, which can be detected. Primer : A short oligonucleotide designed to anneal to specific regions of DNA in order to facilitate the PCR. Primers are designed to complement regions of DNA bounding the gene of interest. RFLP : Restriction fragment length polymorphism. Different sizes of DNA fragment produced by cutting DNA with restriction enzymes. SDW : Sterile distilled water of molecular biology grade. Taq polymerase : A specific, heat-stable DNA polymerase used to replicate DNA targets during PCR

PRINCIPLE OF THE METHOD

This method describes the production of PCR-RFLP fingerprints for the discrimination of canned salmon. Species-specific profiles are produced using DNA extracted from fish samples. The method used for DNA extraction is not part of this method; however, DNA should be extracted using a method suited for use with canned food samples. One suitable method is the CTAB method, details of which can be found in the final report for FSA project Q01084 "Final optimisation and evaluation of DNA based methods for the authentication and quantification of meat species" The polymerase chain reaction (PCR) is used to detect DNA sequences in living organisms and in materials derived from living organisms. It relies on the binding of single-stranded DNA fragments (primers) to a specific DNA target sequence and the copying of this target in the presence of excess amounts of DNA subunits (nucleotides) and a DNA polymerase (Taq). Multiple cycles at specific temperatures result in the million-fold copying of the target sequence.

Restriction enzymes are naturally produced by bacterial strains to degrade DNA at sequence specific sites, e.g. EcoR1 only cuts the six base- pair pattern GAATTC between the G and first A as shown. By selecting the correct enzymes it is possible to digest DNA from different species to produce species-specific DNA fragments. These fragments can be separated by electrophoretic methods to produce species- specific patterns know as restriction fragment length polymorphism (RFLP) fingerprints.

PCR-RFLP techniques combine DNA amplification and RFLPs to produce limited fragment fingerprints which are easier to interpret. They also have the advantage that only small amounts of DNA are required as the PCR step increases the amount of template DNA for restriction digests. PCR primers are used to amplify mitochondrial cyt b gene sequences from all fish species.

Page 96 of 153

Last printed 14/08/2013 09:50:00

L:\Food Authenticity\Archive\AUTHENTICITY\Research Projects\Final reports\Reports\Q01099 Fish _CCFRA\FINAL VERSIONS AUGUST 2010\Q01099 Final Report August 2010.doc Restriction enzymes are used to digest amplified DNA to produce species-specific PCR-RFLP fingerprints. Species discrimination is achieved by separating DNA fragments by capillary electrophoresis using the Agilent 2100 Bioanalyzer and a DNA1000 LabChip. Individual species are identified by their unique fingerprint patterns.

MATERIALS AND EQUIPMENT

All reagents should be of a suitable purity defined for molecular biology analysis (e.g. Sigma molecular biology products). Reagents for PCR are stored in a dedicated PCR reagent freezer at -15oC to -22oC for up to six months, unless otherwise stated.

Note: Solutions 6.2.1 – 6.2.6 should be prepared in a laminar flow cabinet. The cabinet should be decontaminated using UV irradiation. Latex gloves should be worn throughout the procedure.

Water

The water used should be ultra-pure water, molecular grade or equivalent purity.

Solutions, standards and reference materials

1. 4mM dNTP mixture dCTP, dGTP, dATP, dTTP, bought as individual 100mM solutions. Using a P100 Gilson pipette, add 38µl of each 100mM stock dNTP to a sterile labelled 1.5ml Eppendorf. Use a P1000 Gilson pipette to add 800µl of ultrapure water and aspirate gently to mix. Use a P200 Gilson pipette to aliquot into labelled portions of 200µl in sterile 1.5ml Eppendorf tubes.

Store at -15C to -22C for up to six months.

2. 5µM primer solutions (Cyt B5-F and Cyt B5-R)

Table 1: Primer Specifications

Target Sequence Mitochondrial cyt b gene from fish species

PCR product size ~168bp

Page 97 of 153

Last printed 14/08/2013 09:50:00

Cyt B5-R primer sequence 5' GCA GAC AGA GGA AAA AGC TGT TGA-3'

Use a P1000 Gilson pipette to add sufficient ultrapure water to dissolve the primers specified in Table 1 to produce a primer concentration of 100µM (100pmol per µl). Vortex thoroughly and leave overnight at 4C until dissolved.

Note: If primers are required urgently, dissolve at 60C for 1 hour.

Vortex primer solution to thoroughly mix. Centrifuge at 16,000g for 30 seconds to recover solution. Using a P1000 pipette remove about half the solution and place into a sterile, labelled 1.5ml Eppendorf tube. The solution may be stored at this point at -15C to -22C for up to two years. Using a P1000 Gilson pipette, add 950µl of ultrapure water to a labelled sterile 1.5ml Eppendorf tube. Using a P100 Gilson add 50µl of the primer solution (100µM) to the water to give a primer solution of 5µM. Vortex this solution to ensure it is thoroughly mixed and recover by centrifuging at 16,000g for 30 seconds. Using a P1000 pipette divide the solution between two sterile, labelled 1.5ml Eppendorf tubes. The solution may be stored at this point at -15C to -22C for up to two years. 3. AmpliTaq Gold® Polymerase

Enzyme kit from Applied Biosystems containing; 10 x PCR Buffer 25mM Magnesium Chloride AmpliTaq Gold Polymerase

Store in a dedicated PCR freezer at -15C to -22C for up to six months. 4. PCR Mastermix

A PCR mastermix is prepared for the analysis of a batch of several samples Remove aliquots of each reagent from the freezer and allow to thaw in the laminar flow cabinet.

Prepare the mastermix using the reagents and volumes detailed in the Table 2. Add the reagents to a sterile 2ml Eppendorf tube and mix thoroughly by gentle pipette aspiration prior to use. Page 98 of 153

Last printed 14/08/2013 09:50:00

Final Equivalent Concentration in Initial in a Single Reagents PCR Reaction Concentration Reaction (20µl reaction (µl) vol.)

PCR buffer 10x 1x 2

MgCl2 25mM 5mM 4

dNTPs 4mM 200µM 1.2

CtyB5-F primer 5µM 0.3µM 1.2

CtyB5-R primer 5µM 0.3µM 1.2

Water - - 5.15

Volume 14.8 TaqGold 5U/µl 0.05U/µl 0.2 (before addition of DNA Volume 15 extract) 5µl Template DNA Final Volume 20

EDTA Solution

0.5M Stock Solution

This is a standard lab stock solution of EDTA.

Weigh out 18.61g ± 0.01g EDTA (Ethylenediaminetetraacetic acid, Disodium Salt Dihydrate) into a 200ml beaker.

Add approximately 80ml ultrapure to dissolve. Adjust pH to 8.0 with NaOH. Note: EDTA will not dissolve until pH is adjusted. Once dissolved, make up to 100ml in a volumetric flask. Transfer to a labelled Schott bottle and autoclave. Solution can be stored for one year.

Page 99 of 153

Last printed 14/08/2013 09:50:00

L:\Food Authenticity\Archive\AUTHENTICITY\Research Projects\Final reports\Reports\Q01099 Fish _CCFRA\FINAL VERSIONS AUGUST 2010\Q01099 Final Report August 2010.doc 60mM Working Solution

Dilute 0.5M stock solution with ultrapure water 3 in 25 to produce a 60mM working solution. To prepare 10ml of 60mM EDTA solution, add 1.2ml 0.5M EDTA to 8.8ml ultrapure water. Mix well before use. Solution can be stored for up to one month at ambient (room) temperature. 5. Restriction Enzymes

Restriction enzymes, as shown in Table 3, are obtained from New England Biolabs unless otherwise stated. All enzymes come with optimal buffers as shown.

Enzymes should be stored at -15˚C to -22˚C until the expiry date for each particular enzyme batch is reached.

Table 3: Details of Restriction Enzymes Used During this Method

Incubation Enzyme Catalogue No. Optimal Buffer Temperature (C) Dde I R0175L NEBuffer 3 37 Bfa I R0568S NEBuffer 4 37

6. Positive and Negative DNA Controls

DNA extracts from single species fish are used as positive controls. After DNA extraction prepare DNA solutions at 10ng/µl using the formula in 6.2.8. This is a 10ng/µl working solution. Use a P200 Gilson pipette to aliquot 50µl volumes of the DNA working solution into sterile, labelled 1.5ml Eppendorf tubes. Store aliquots at –15ºC to –22ºC for up to two years. A negative extraction control should be prepared with every batch of DNA extracts. This control is prepared using water and can be used for PCR amplification in an undiluted form.

7. Template DNA Solutions of Samples

The concentration of DNA within unknown sample extracts is determined using spectrophotometry Dilute extracts of sample DNA to 10ng/µl, for PCR amplification, using the formula below:

Page 100 of 153

Last printed 14/08/2013 09:50:00

L:\Food Authenticity\Archive\AUTHENTICITY\Research Projects\Final reports\Reports\Q01099 Fish _CCFRA\FINAL VERSIONS AUGUST 2010\Q01099 Final Report August 2010.doc Volume of water to be added  Concentration (ng / l) *     1 x 5  to 5μl sample extract for a  Nominal concentration (10ng / l)   final concentration of 10ng/μl (to the nearest 5μl)  Value obtained from spectrophotometer

Use a P200 Gilson pipette to add Milli-Q water to a 1.5ml Eppendorf tube. Use a P10 Gilson pipette to add 5µl of sample DNA extract to the water. Vortex for 20 seconds to mix and centrifuge 30 seconds at 16,000g to recover solution. This is a 10ng/µl DNA working solution of the test sample for analysis.

DNA samples can be stored at 4ºC to 8ºC for up to 1 week or at –15ºC to –22ºC for longer periods up to 2 years.

8. Ethanol 80% (v/v)

Use a measuring cylinder to add 80ml Ethanol to 20ml ultra-pure water in a clean labelled Schott bottle. Store at ambient temperature for up to 3 months 9. Haz Tab

Chlorine disinfection tablets made with NaDCC (Sodium Dichloroisocyanurate). (Guest Medical, Edenbridge, Kent, UK). Follow manufacturer's instuctions to make up to appropriate concentration.

Page 101 of 153

Last printed 14/08/2013 09:50:00

L:\Food Authenticity\Archive\AUTHENTICITY\Research Projects\Final reports\Reports\Q01099 Fish _CCFRA\FINAL VERSIONS AUGUST 2010\Q01099 Final Report August 2010.doc Equipment

10. Thermocycler.

11. Laminar flow hood (PCR hood).

12. Sets of Gilson precision pipettes (including, P10, P20, P100, P200, P1000).

13. Benchtop whirlimixer.

14. Benchtop centrifuge for microtubes.

15. Sterile filter pipette tips.

16. Agilent 2100 Bioanalyzer.

17. Vortex mixer – IKA model MS2-S8/S9.

The following items are sterilised by autoclaving (see note): 1.5 ml Eppendorf tubes

2.0 ml Eppendorf tubes.

Note: All equipment and reagents required to be autoclaved are sterilised using the following conditions: 121C2.5C for 15 min2min at 1.0 Bar. The following items are UV sterilised for 5 minutes using the UV light source in a laminar flow cabinet: PCR tube strips with attached caps (eight reactions each).

PCR tube storage block for preparation of PCRs.

96 well PCR plates and lids or seals.

PROCEDURES

Sample preparation

Note: DNA should be extracted using either a CTAB extraction or other suitable commercial kit method (Tepnel, Promega, R-Biopharm, Qiagen etc.) Perform replica DNA extractions on at least two individual salmon flakes or pieces from different regions within the can. Do not homogenise the fish material from the whole can. Page 102 of 153

Last printed 14/08/2013 09:50:00

L:\Food Authenticity\Archive\AUTHENTICITY\Research Projects\Final reports\Reports\Q01099 Fish _CCFRA\FINAL VERSIONS AUGUST 2010\Q01099 Final Report August 2010.doc

Perform DNA extraction from samples following the CTAB method or other appropriate method. Record method use in laboratory note book. Perform DNA extraction in duplicate for the first sample and for every 10 samples thereafter. Include a suitable DNA extraction positive control and a DNA extraction negative control with every batch of samples. Record the positive control sample code in your laboratory notebook. Note: The positive control should be chosen to match one of the species being tested for. If no species are declared for analysis, a sample of known species should be used.

For the negative control, use water in place of the sample.

Quantify the DNA extractions using a spectrophotometer. Dilute sample DNA to 10ng/μl using the formula shown in 6.2.8. Diluted DNA is now known as template DNA.

Amplification of cyt b Sequences

In the laminar flow hood Note: Use sterile filter tip pipette tips and wear disposable gloves during the procedure. Wipe laminar flow hood with tissue dampened with sterilising solution (Haz tab). Dry flow hood with tissue then wipe hood with tissue dampened with 80% ethanol. Remove the reagents and primer working stocks from the freezer and allow to completely thaw to room temperature in the laminar flow cabinet. Once thawed vortex for 20 seconds and recover solutions by centrifuging at 16,000g for 20 seconds. Label enough PCR tubes for reactions allowing two tubes per unknown sample and three additional tubes for the positive, negative and no template control (NTC) (water blank) controls. Label a 1.5ml Eppendorf tube for mastermix preparation. Place all tubes in suitable rack and place into PCR hood. UV sterilise tubes for 5 minutes.

Page 103 of 153

Last printed 14/08/2013 09:50:00

L:\Food Authenticity\Archive\AUTHENTICITY\Research Projects\Final reports\Reports\Q01099 Fish _CCFRA\FINAL VERSIONS AUGUST 2010\Q01099 Final Report August 2010.doc Safety Note: Ensure cabinet is closed before switching on UV lights. Do not tamper with safety micro switches on cabinet door. Using a P1000 or P200 Gilson pipette, as appropriate, prepare mastermixes using the reagents and volumes detailed in Table 2 in 2ml Eppendorf tubes. Using an appropriate (P10 or P20) Gilson pipette, add Amplitaq Gold to the mastermix and mix thoroughly by vortexing for 20 seconds. Centrifuge tubes at 16,000g for 30 seconds to recover solution. Using a P20 Gilson pipette, aliquot 15µl of mastermix into two replicate Eppendorf tubes for each sample to be tested. A PCR negative control (NTC), a positive control and an extraction negative control should also be prepared by aliquoting 15µl of mastermix into an Eppendorf tube for each control. Use a P10 Gilson to pipette 5µl of diluted template DNA solution into the two replicate wells for each sample. Use a fresh tip for each replicate. Cap each tube after adding the DNA solution. Repeat for each unknown sample. Use a P10 Gilson to pipette 5µl of positive control DNA (from DNA extraction positive) solution and negative control DNA (from DNA extraction negative) solution into their respective reaction wells. Use a fresh tip for each control. Cap each tube after adding the DNA solution. Use a P10 Gilson pipette to add 5µl of ultrapure water to the NTC wells. Cap the tubes after adding the water. Remove all used tips and tubes, replace tube holders and wipe the laminar flow hood with sterilising solution. Transfer Eppendorf tubes prepared for PCR to the thermocycler laboratory.

In post-PCR laboratory

Place PCR tubes into a thermocycler and use the programme found in Table 4.

Safety Note: Avoid touching heating block and heated lid, as they achieve temperatures of over 95°C.

After the PCR programme is complete, remove the tube strips from thermocycler and store samples at 1ºC to 6ºC for up to 2 days. Alternatively, PCR products can be stored for up to three months at between -15ºC and -22ºC. Note: Do not remove PCR products from the thermocycler laboratory.

Page 104 of 153

Last printed 14/08/2013 09:50:00

95ºC/5 min 95ºC/40 sec PCR program 50ºC/80 sec 45 cycles 72ºC/80 sec 72ºC/5 min 4C/hold

Confirmation of cyt b Gene Amplification

Run the purified DNA on an Agilent DNA1000 LabChip to confirm fragment has been amplified, and to determine the concentration of DNA, before proceeding with a restriction enzyme digest. Print out results of chip analysis. The purpose of this is to confirm PCR amplification occurred in all samples. Fix this securely into laboratory notebook.

Restriction Digestion of PCR Products

Parts of the following stage are performed in the PCR set-up laboratory and parts in the post-PCR laboratory. Note: Take care not to move samples from the post-PCR lab to the PCR set-up lab. The preparation of restriction digest reactions should be performed on ice. Restriction enzymes should only be taken from the freezer (-20C) for as short a time as possible and handled as little as possible. In the PCR set-up, label 0.2ml PCR tubes with sample name and restriction enzyme and arrange in a suitable rack. Include tubes for restriction digest positive controls for each enzyme. Place all tubes on ice. For each enzyme reaction prepare a mastermix as shown in Table 5 in a 0.5ml Eppendorf tube. To prepare enough reaction mastermix count the number of samples to test. Add 1 for the PCR positive control, which has now become the restriction digest positive control, and multiply the total number of reactions by the values in column 3 of Table 5 (‘Volume for 1 Digest’). Finally add an extra 10% for pipetting errors.

Page 105 of 153

Last printed 14/08/2013 09:50:00

Component Final Volume for 1 Volume for Concentration Digest 10 Digests1 (μl) (μl)

10x Buffer2 1x 0.5 5.5

Enzyme 0.5 5.5

SDW ~ 1.5 16.5

Volume ~ 2.5 27.5

1. An extra 10% has been added to values shown to allow for pipetting errors. 2. See Table 3 for correct buffer to use with each enzyme.

Vortex the enzyme mastermix thoroughly to mix. Centrifuge at 16,000g for 15 seconds to recover the solution. Leave enzyme mastermixes on ice and transfer to the Post-PCR laboratories for the next step Use a P10 Gilson pipette to add 2.5µl of the mastermix to the respective labelled PCR tubes. Leave the tubes on ice and take them to the Post-PCR laboratory for the next steps. Use a P10 Gilson pipette to add 2.5µl of PCR product (from 7.3) to the respective labelled PCR tubes. Use a P10 Gilson pipette to add 2.5μl of PCR positive control DNA to the restriction digest positive control tube.

Place the tubes in the thermocycler and incubate samples for at least 4 hours (or overnight) at 37C ± 1.0C. Terminate reactions by heating samples to 65C ± 1C for 10-15 minutes.

Digests can be stored at +3C to +6C for up to 2 days. For longer times store samples at -15C to -25C.

Page 106 of 153

Last printed 14/08/2013 09:50:00

The Agilent 2100 Bioanalyser is a capillary electrophoretic system which is used to separate, size and quantify DNA products according to size. Different sized DNA products require different chip assays according to expected size range. For the analysis of fish PCR-RFLP products the DNA1000 LabChip should be used. Note: Before loading samples on the 2100 Bioanalyzer, use a P10 Gilson pipette to add 1μl of 60mM EDTA to each 5μl digest and mix to achieve a final concentration of 10mM EDTA. Remove tubes containing prepared matrix, DNA size ladder (yellow cap) and upper and lower size markers (green cap) from fridge (+1C to +6C) and leave to warm to room temperature for 1 hour. Prime DNA1000 LabChip according to the manufacturer’s instructions using prepared gel matrix.

Safety Note: Gel matrix contains a DNA binding dye. Avoid contact with skin. Wear gloves and goggles when handling. Use a P10 Gilson to load 5µl of size markers into all sample wells and ladder well, ensuring marker settles onto bottom of well and does not remain on sides. Using P10 Gilson pipette to load 1µl of ladder into the well labelled with a ladder symbol, ensuring ladder settles onto bottom of well and does not remain on sides. Using P10 Gilson pipette to load 1µl of digested DNA sample into one of the 12 sample wells, 1 – 12. Ensure samples have settled onto bottom of well and have not remained on sides of well. Fill any spare wells with 1µl of size marker. Use the IKA vortex to vortex the chip for 1 minute at 2,400 rpm, then load into slot in 2100 Bioanalyser.

Safety Note: The 2100 Bioanalyzer contains a laser. Do not interfere with the normal operation of this instrument. Select chip assay type as DNA1000 assay. Press start when chip is ready and wait for 1-2 minutes to ensure analyser starts and there are no problems with chip. If chip error is reported

 Stop run and remove chip.

 Check chip wells to ensure samples are in bottom of wells and are not adhering to sides. If sample is on sides use a pipette to move it into base of well. Reload chip into analyser and restart run.

 If all samples are in bottom of wells invert chip and examine chip wells for bubbles. If chip contains bubbles discard chip and reload samples into fresh chip.

Page 107 of 153

Last printed 14/08/2013 09:50:00

After run is complete save file into appropriate folder. Remove DNA chip from analyser and clean analyser pins with cleaning chip containing approximately 350µl SDW.

Quality Assurance

18. Negative Controls

The purpose of the negative controls are to identify if contamination has occurred during the extraction or PCR procedures. An extraction negative control must be prepared with every batch of DNA extracts. The extraction negative is usually manipulated last at each stage of the process, to pick up any possible source of contamination. A PCR negative control must be used as a method control with every set of samples amplified at the same time. For a PCR negative, 5µl ultrapure water replaces the sample DNA extract, when setting up the PCR. The PCR negative is usually manipulated last at each stage of the process, to pick up any possible source of contamination.

The PCR negative control should show no PCR product present. Presence of the PCR product indicates contamination has occurred and the PCR batch is invalid and all samples must be re- amplified. If this occurs, consult your line manager. A DNA extraction negative control showing a strong visible band of equivalent size to the positive PCR control means the extraction batch is invalid and all DNA from samples must be re-extracted.

19. Positive PCR Controls

A positive PCR control, relating to the sample type*, is amplified with every batch of samples. The positive must be treated as an unknown sample during the DNA extraction and amplification stages.

* Where a particular sample type is expected (from information supplied by the client) use this species as the positive PCR control where possible.

Page 108 of 153

Last printed 14/08/2013 09:50:00

L:\Food Authenticity\Archive\AUTHENTICITY\Research Projects\Final reports\Reports\Q01099 Fish _CCFRA\FINAL VERSIONS AUGUST 2010\Q01099 Final Report August 2010.doc 20. PCR Amplification

PCR products resulting from the amplification of DNA extracted from samples and controls are separated according to size using a DNA1000 LabChip. The presence of a PCR product is indicated by a DNA fragment of 168bp ± 5%.

21. Restriction Digest Quality Control

Restriction digestion positive controls should produce bands of sizes shown in Appendix 1 ± 5% for fragments >100bp or ± 15% for fragments <100bp. If digestion is incomplete, i.e. some undigested DNA remains, digestion assays with that enzyme should be repeated. Complete digestion of PCR products from samples is assumed based on comparisons to digestion of positive controls. Positive controls are completely digested with a specific enzyme if only the DNA fragments of sizes shown in Appendix 1 are detected by the 2100 Bioanalyzer. If the expected fragments are not observed, or additional larger fragments are also observed, consult your line manager. It is likely that complete digestion has not occurred and samples may require re- analysis.

22. 2100 Bioanalyzer Quality Control

A ladder with eleven DNA fragments ranging in size from 15bp to 1500bp should be fully resolved and detected by the bioanalyzer using default settings. The internal size markers (15bp and 1500bp) should be clear of other DNA fragments. Check that the bioanalyzer has identified the markers correctly. Consult your line manager if other fragments appear to be co-migrating near the markers.

23. Presence of Species

If the restriction digest positive control DNA shows complete digestion with a specific enzyme, it is assumed that enzymatic digestion of sample DNA has also proceeded to completion with that enzyme

EXPRESSION OF RESULTS

Compare the sample profiles to those profiles of the salmon species found in Appendix 1. Results are expressed in the report as the following:

Page 109 of 153

Last printed 14/08/2013 09:50:00

The method cannot identify the species present in a sample as other related salmon species may have the same PCR-RFLP profile.

PRECISION AND ACCURACY

All DNA extracts are analysed in duplicate. The results are valid if the DNA fragments obtained in each duplicate are the same, i.e. identical fingerprint patterns ± 5%. If duplicates do not give the same result, consult your line manager and repeat if appropriate.

Page 110 of 153

Last printed 14/08/2013 09:50:00

L:\Food Authenticity\Archive\AUTHENTICITY\Research Projects\Final reports\Reports\Q01099 Fish _CCFRA\FINAL VERSIONS AUGUST 2010\Q01099 Final Report August 2010.doc APPENDICES

APPENDIX ONE

168bp CYT B PCR-RFLP PROFILES FOR PACIFIC SALMON SPECIES

DNA Fragments (bp) produced using a DNA1000 Labchip following Species Digestion with the Enzyme Bfa I Dde I

Expected Observed Expected Observed

Chinook salmon 19, 57, 92 (21), 61, 83, 99 51, 117 (21), 60, 123

Coho salmon 19, 57, 92 (22), 61, 84, 99 48, 51, 69 (21), 60, 74

Red salmon 19, 42, 50, 57 (21), 44, 60, 85, 99 48, 120 (21), 59, 124

Chum salmon 19, 30, 50, 69 (21), 23, 59, 74, 95 48, 120 (22), 58, 122

Pink salmon 12, 19, 30, 50, 57 (21), 24, 62, 84 48, 120 (21), 58, 124

Red fragments= Possible artefact due to incomplete digestion of PCR product

() possible primer dimer formed during PCR

19bp BfaI fragments co-migrate with the primer dimer.

The theoretical 50 & 57 bp fragments produced with Bfa I in pink and red salmon often run as a double headed band at approximately 60bp

Page 111 of 153

Last printed 14/08/2013 09:50:00

Food and Safety with 1 2 3 4 5 6 the7 2100 bioanalyzer8 9

Partial digests 92

57 57 57 50 50 50

30 30 PCR artefact band LSCA / Bioanalyzer Fish ID Russell McInnes, 11-Sep-05 Page 13

Red number are the theoretical DNA fragment sizes in bp

Green spots indicate individual DNA fragments that are unique to the species

Lanes Salmon species

1&2 chum

3&4 red

5&6 pink

7&8 chinook

9 coho

Page 112 of 153

Appendix E

Version 1.0, January 2008

STANDARD OPERATING PROCEDURE FOR THE DISCRIMINATION OF TUNA SPECIES IN CANNED PRODUCTS BY PCR- RFLP ANALYSIS ON THE AGILENT 2100 BIOANALYZER

Prepared by

Campden BRI

Page 113 of 153

CONTENTS

1. HISTORY / BACKGROUND ...... 115 2. PURPOSE ...... 115 3. SCOPE ...... 115 4. DEFINITIONS AND ABBREVIATIONS ...... 115 5. PRINCIPLE OF THE METHOD ...... 116 6. MATERIALS AND EQUIPMENT ...... 117

6.1 WATER ...... 117

6.2 SOLUTIONS, STANDARDS AND REFERENCE MATERIALS ...... 117

6.2.1 4MM DNTP MIXTURE ...... 117

6.2.2 5µM PRIMER SOLUTIONS (L15424 AND H15573) ...... 117

6.2.3 AMPLITAQ GOLD® POLYMERASE ...... 118

6.2.4 PCR MASTERMIX ...... 118

6.2.5 EDTA SOLUTION ...... 119

0.5M Stock Solution ...... 119

60mM Working Solution ...... 120

6.2.6 RESTRICTION ENZYMES ...... 120

6.2.7 POSITIVE AND NEGATIVE DNA CONTROLS...... 120

6.2.8 TEMPLATE DNA SOLUTIONS OF SAMPLES ...... 120

6.2.9 ETHANOL 80% (V/V) ...... 121

6.2.10 HAZ TAB ...... 121

6.3 EQUIPMENT ...... 122

6.3.1 THERMOCYCLER...... 122

6.3.2 LAMINAR FLOW HOOD (PCR HOOD)...... 122

6.3.3 SETS OF GILSON PRECISION PIPETTES (INCLUDING, P10, P20, P100, P200, P1000)...... 122

6.3.4 BENCHTOP WHIRLIMIXER...... 122

6.3.5 BENCHTOP CENTRIFUGE FOR MICROTUBES...... 122

Page 114 of 153

6.3.6 STERILE FILTER PIPETTE TIPS...... 122

6.3.7 AGILENT 2100 BIOANALYSER...... 122

6.3.8 VORTEX MIXER – IKA MODEL MS2-S8/S9...... 122

6.3.9 1.5 ML EPPENDORF TUBES ...... 122

6.3.10 2.0 ML EPPENDORF TUBES...... 122

6.3.11 PCR TUBE STRIPS WITH ATTACHED CAPS (EIGHT REACTIONS EACH)...... 122

6.3.12 PCR TUBE STORAGE BLOCK FOR PREPARATION OF PCRS...... 122

7. PROCEDURES ...... 122

7.1 SAMPLE PREPARATION ...... 122

7.2 AMPLIFICATION OF CYT B SEQUENCES ...... 123

7.3 CONFIRMATION OF CYT B GENE AMPLIFICATION ...... 125

7.4 RESTRICTION DIGESTION OF PCR PRODUCTS ...... 125

7.5 FINGERPRINTING SAMPLES ON AGILENT 2100 BIOANALYZER ...... 126

7.6 QUALITY ASSURANCE ...... 127

7.6.1 NEGATIVE CONTROLS ...... 127

7.6.3 PCR AMPLIFICATION ...... 128

7.6.4 RESTRICTION DIGEST QUALITY CONTROL ...... 128

7.6.5 2100 BIOANALYZER QUALITY CONTROL ...... 129

7.6.6 PRESENCE OF SPECIES ...... 129

8. EXPRESSION OF RESULTS ...... 129 9. PRECISION AND ACCURACY ...... 129 10. APPENDIX ...... 130

Page 115 of 153

HISTORY / BACKGROUND

The polymerase chain reaction (PCR) can be used to amplify DNA sequences. By combining PCR with restriction fragment length polymorphisms (RFLP) analysis it is possible to generate DNA fragment profiles that discriminate a large number of fish species.

Large cyt b DNA targets such as the 464bp target used in other PCR-RFLP methods cannot be amplified from heavily processed canned fish products. Therefore small targets must be used. Quinteiro et al (1998)* published a PCR-RFLP assay for six canned tuna species based on a 176bp cyt b target.

Detection of the small DNA fragments generated by PCR-RFLP is easily performed on a lab-on-a-chip capillary electrophoresis system, the Agilent 2100 Bioanalyzer.

* Quinteiro, J., Sotelo, C. G., Rehbein, H., Pryde, S. E., Medina, I., Perez-Martin, R. I.,Rey-Mendez, M., & Mackie, I. M. (1998) Use of mtDNA Direct Polymerase Chain Reaction (PCR) Sequencing and PCR-Restriction Fragment Length Polymorphism Methodologies in Species Identification of Canned Tuna. Journal of Agricultural Food Chemistry, 46(4) 1662-1669

PURPOSE

The purposed of this SOP is to enable discrimination of tuna species in commercial canned products.

SCOPE

The method describes the use of PCR-RFLP profiling using a small 176 bp cyt b amplicon to discriminate species in commercial canned products. These species include; skipjack (Katsuwonus pelamis), albacore (Thunnus alalunga), bluefin (Thunnus thynnus), yellowfin (Thunnus albacares), bigeye (Thunnus obese) and bonito (Sarda sarda).

DEFINITIONS AND ABBREVIATIONS

Page 116 of 153

Primer : A short oligonucleotide designed to anneal to specific regions of DNA in order to facilitate the PCR. Primers are designed to complement regions of DNA bounding the gene of interest. RFLP : Restriction Fragment Length Polymorphism- DNA fragments produced by DNA digesting enzymes (restriction enzymes). SDW : Sterile distilled water of molecular biology grade. Taq polymerase : A specific, heat-stable DNA polymerase used to replicate DNA targets during PCR

PRINCIPLE OF THE METHOD

This method describes the production of PCR-RFLP profiles for the discrimination of species canned tuna. Species-specific profiles are produced using DNA extracted from fish samples. The method used for DNA extraction is not part of this method; however, DNA should be extracted using a method suited for use with canned food samples. One suitable method is the CTAB method, details of which can be found in the final report for FSA project Q01084 "Final optimisation and evaluation of DNA based methods for the authentication and quantification of meat species"

The polymerase chain reaction (PCR) is used to detect DNA sequences in living organisms and in materials derived from living organisms. It relies on the binding of single-stranded DNA fragments (primers) to a specific DNA target sequence and the copying of this target in the presence of excess amounts of DNA subunits (nucleotides) and a DNA polymerase (Taq). Multiple cycles at specific temperatures result in the million-fold copying of the target sequence.

Restriction enzymes are naturally produced by bacterial strains to degrade DNA at sequence specific sites, e.g. EcoR1 only cuts the six base-pair pattern GAATTC between the G and first A as shown. By selecting the correct enzymes it is possible to digest DNA from different species to produce species-specific DNA fragments. These fragments can be separated by electrophoretic methods to produce species-specific patterns know as restriction fragment length polymorphism (RFLP) fingerprints.

Restriction enzymes are used to digest amplified DNA to produce species-specific PCR-RFLP fingerprints. Species identification is achieved by separating DNA fragments by capillary electrophoresis using the Agilent 2100 Bioanalyzer and a DNA1000 LabChip. Individual species are identified by their unique profile patterns.

The method is based on the method by Quinteiro et al.(1998)

Page 117 of 153

MATERIALS AND EQUIPMENT

Note: Solutions 6.2.1 – 6.2.6 should be prepared in the laminar flow cabinet. The cabinet should be decontaminated using UV irradiation. Latex gloves should be worn throughout the procedure.

Water

The water used should be ultra-pure water, molecular grade or equivalent purity. Solutions, standards and reference materials

24. 4mM dNTP mixture

dCTP, dGTP, dATP, dTTP, bought as individual 100mM solutions. Using a P100 Gilson pipette, add 38µl of each 100mM stock dNTP to a sterile labelled 1.5ml Eppendorf. Use a P1000 Gilson pipette to add 800µl of ultrapure water and aspirate gently to mix. Use a P200 Gilson pipette to aliquot into labelled portions of 200µl in sterile 1.5ml Eppendorf tubes.

Store at -15C to -22C for up to six months.

25. 5µM primer solutions (L15424 and H15573)

Table 1: Primer Specifications

Target Sequence Mitochondrial cyt b gene from fish species

PCR product size ~176bp

Page 118 of 153

L15424 primer sequence 5'- ATC CCA TTC CAC CCA TAC TAC TC -3'

H15573 primer sequence 5'- AAT AGG AAG TAT CAT TCG GGT TTG ATG -3'

Use a P1000 to add sufficient ultrapure water to dissolve the primers specified in Table 1 to produce a primer concentration of 100µM (100pmol per µl). Vortex thoroughly and leave overnight at 4C until dissolved.

Note: If primers are required urgently, dissolve at 60C for 1 hour.

Vortex primer solution to thoroughly mix. Centrifuge at 16,000g for 30secs to recover solution. Using a P1000 pipette remove about half the solution and place into a sterile, labelled 1.5ml Eppendorf. The solution may be stored at this point at -15C to -22C for up to two years. Using a P1000 Gilson pipette add 950µl of ultrapure water to a labelled sterile 1.5ml Eppendorf tube. Using a P100 Gilson add 50µl of the primer solution (100µM) to the water to give a primer solution of 5µM. Vortex this solution to ensure it is thoroughly mixed and recover by centrifuging at 16,000g for 30secs. Using a P1000 pipette divide the solution between two sterile, labelled 1.5ml Eppendorf tubes. The solution may be stored at this point at -15C to -22C for up to two years. 26. AmpliTaq Gold® Polymerase

Enyzyme kit from Applied Biosystems containing; 10 x PCR Buffer 25mM Magnesium Chloride AmpliTaq Gold Polymerase (5 units/µl) Store at -15C to -22C for up to six months.

27. PCR Mastermix

A PCR mastermix is prepared for the analysis of a batch of several samples. Remove aliquots of each reagent from the freezer and allow to thaw in the laminar flow cabinet.

Page 119 of 153

Final Equivalent Concentration in Initial in a Single Reagents PCR Reaction Concentration Reaction (20µl reaction (µl) vol.)

PCR buffer 10x 1x 2.5

MgCl2 25mM 5mM 2.5

dNTPs 4mM 200µM 1.25

L14735 primer 5µM 0.3µM 1.25

H15149 primer 5µM 0.3µM 1.25

Water - - 11

Volume 14.8 TaqGold 5U/µl 0.05U/µl 0.25 (before addition of DNA Volume 20 extract) 5µl Template DNA Final Volume 25

28. EDTA Solution

0.5M Stock Solution

This is a standard lab stock solution of EDTA.

Weigh out 18.61g ± 0.01g EDTA (Ethylenediaminetetraacetic acid, Disodium Salt Dihydrate) into a 200ml beaker.

Add approximately 80ml ultrapure water to dissolve. Adjust pH to 8.0 with NaOH. Note: EDTA will not dissolve until pH is adjusted. Once dissolved, make up to 100ml in a volumetric flask. Transfer to a labelled Schott bottle and autoclave. Solution can be stored for one year.

Page 120 of 153

60mM Working Solution

Dilute 0.5M stock solution 3 in 25 to produce a 60mM working solution. To prepare 10ml of 60mM EDTA solution, add 1.2ml 0.5M EDTA to 8.8ml ultrapure water. Mix well before use. Solution can be stored for up to one month at ambient (room) temperature. 29. Restriction Enzymes

Restriction enzymes, shown in Table 3, are obtained from New England Biolabs unless otherwise stated. All enzymes come with optimal buffers as shown.

Enzymes should be stored at -15˚C to -22˚C until the expiry date for each particular enzyme batch is reached. Note: Bsi YI is purchased from Roche Diagnostics GmbH Table 3: Details of Restriction Enzymes Used During this Method

Incubation Enzyme Catalogue No. Optimal Buffer Temperature (C) MboI R0148S NEBuffer 2 37 Mnl I R0163S NEBuffer2 37 Bsi Y I 11 388 916 001 Roche Buffer M 37

30. Positive and Negative DNA Controls.

DNA extracts from single species fish are used as positive controls. After DNA extraction prepare DNA solutions at 10ng/µl using the formula in 6.2.8. This is a 10ng/µl working solution. Use a P200 Gilson to aliquot 50µl volumes of the DNA working solution into sterile, labelled 1.5ml Eppendorf tubes. Store aliquots at –15ºC to –22ºC for up to two years. A negative extraction control should be prepared with every batch of DNA extracts. This control is prepared using water and can be used for PCR amplification in an undiluted form.

31. Template DNA Solutions of Samples

Page 121 of 153

The concentration of DNA within unknown sample extracts is determined using spectrophotometry. Dilute extracts of sample DNA to 10ng/µl, for PCR amplification, using the formula below: Volume of water to be added  Concentration (ng / l) *     1 x 5  to 5μl sample extract for a  Nominal concentration (10ng / l)   final concentration of 10ng/μl (to the nearest 5μl) *Value obtained from spectrophotometer Use a P200 Gilson pipette to add ultrapure water to a 1.5ml Eppendorf tube. Use a P10 Gilson pipette to add 5µl of sample DNA extract to the water. Vortex for 20 seconds to mix and centrifuge 30 seconds at 16,000g to recover solution. This is a 10ng/µl DNA working solution of the test sample for analysis.

DNA samples can be stored at 4ºC to 8ºC for up to 1 week or at –15ºC to –22ºC for longer periods up to 2 years. 32. Ethanol 80% (v/v)

Use a measuring cylinder to add 80ml Ethanol to 20ml ultra-pure water in a clean labelled Schott bottle. Store at ambient temperature for up to 3 months 33. Haz Tab

Chlorine disinfection tablets made with NaDCC (Sodium Dichloroisocyanurate). (Guest Medical, Edenbridge, Kent, UK). Follow manufacturer's instuctions to make up to appropriate concentration.

Page 122 of 153

Equipment

34. Thermocycler.

35. Laminar flow hood (PCR hood).

36. Sets of Gilson precision pipettes (including, P10, P20, P100, P200, P1000).

37. Benchtop whirlimixer.

38. Benchtop centrifuge for microtubes.

39. Sterile filter pipette tips.

40. Agilent 2100 Bioanalyser.

41. Vortex mixer – IKA model MS2-S8/S9.

The following items are sterilised by autoclaving (see note): 42. 1.5 ml Eppendorf tubes

43. 2.0 ml Eppendorf tubes.

Note: All equipment and reagents required to be autoclaved are sterilised using the following conditions: 121C2.5C for 15 min2min at 1.0 Bar. The following items are UV sterilised for 5 minutes using the UV light source in a laminar flow cabinet: 44. PCR tube strips with attached caps (eight reactions each).

45. PCR tube storage block for preparation of PCRs.

PROCEDURES

Sample preparation

Note: DNA should be extracted using either a CTAB DNA extraction or other suitable commercial kit method (Tepnel, Promega, Genescan, R-Biopharm, Qiagen etc.). Perform replicate DNA extractions on at least two individual tuna flakes or pieces from different regions within the can. Do not homogenise the fish material from the whole can. Include a suitable DNA extraction positive control and a DNA extraction negative control with every batch of samples. Note: The positive control should be chosen to match one of the species being tested for. If no species are declared for analysis, a sample of known species should be used.

Page 123 of 153

For the negative control, use water in place of the sample.

Quantify the DNA extractions using a GeneQuant Pro DNA calculator or alternative spectrophotometer instrument. Dilute sample DNA to 10ng/μl using the formula shown in 6.2.8. Diluted DNA is now known as template DNA. Amplification of cyt b sequences

This method is suitable for the analysis of extracts of fish products with template DNA of between 50ng and 100ng for each reaction. For example, 5µl of an extract with a DNA concentration of 10ng/µl gives 50ng of DNA for the amplification reaction. If the concentration of extracted DNA is below 10ng/μl, the method must be performed on undiluted extract. In a laminar flow hood Note: Use sterile filter tip pipette tips and wear disposable gloves during the procedure. Wipe laminar flow hood with tissue dampened with sterilising solution (haz tab). Dry flow hood with tissue then wipe hood with tissue dampened with 80% ethanol.

Remove the reagents and primer working stocks from the freezer and allow to completely thaw to room temperature in the laminar flow cabinet. Once thawed vortex for 20 seconds and recover solutions by centrifuging at 16,000g for 20 seconds.

Label enough PCR tubes for reactions allowing two tubes per unknown sample and three additional tubes for the positive, negative and no template control (NTC) (water blank) controls. Label a 1.5ml Eppendorf tube for mastermix preparation. Place all tubes in suitable rack and place into PCR hood. UV sterilise tubes for 5 minutes.

Safety Note: Ensure cabinet is closed before switching on UV lights. Do not tamper with safety micro switches on cabinet door. Using a P1000 or P200 Gilson pipette, as appropriate, prepare mastermixes using the reagents and volumes detailed in Table 2 in 2ml Eppendorf tubes. Using an appropriate (P10 or P20) Gilson pipette, add Amplitaq Gold to mastermix and mix thoroughly by vortexing for 20 seconds. Centrifuge tubes at 16,000g for 30 seconds to recover solution. Using a P20 Gilson pipette, aliquot 20µl of mastermix into two replicate tubes for each sample to be tested. A PCR negative control (NTC), a positive control and an extraction

Page 124 of 153

negative control should also be prepared by aliquoting 20µl of mastermix into a tube for each control.

Use a P10 Gilson to pipette 5µl of diluted template DNA solution into the two replicate wells for each sample. Use a fresh tip for each replicate. Cap each tube after adding DNA solution. Repeat for each unknown sample.

Use a P10 Gilson to pipette 5µl of positive control DNA (from DNA extraction positive) solution and negative control DNA (from DNA extraction negative) solution into their respective reaction wells. Use a fresh tip for each control. Cap each tube after adding DNA solution.

Use a P10 Gilson to add 5µl of ultrapure water to the NTC wells. Cap the tubes after adding water.

Remove all used tips and tubes, replace tube holders and wipe laminar flow hood with sterilising solution. Transfer PCR tubes to the thermocycler laboratory. In post-PCR laboratory

Place PCR tubes into a thermocycler.

Safety Note: Avoid touching heating block and heated lid as they achieve temperatures of over 95°C.

Set the PCR programme (Table 4) and leave until the program has finished (approximately 3 hours or overnight). After the PCR programme is complete, remove tube strips from thermocycler and store samples at 1ºC to 6ºC for up to 2 days. Alternatively, PCR products can be stored for up to three months at between -15ºC and -22ºC. Note: Do not remove PCR products from the thermocycler laboratory.

Page 125 of 153

Table 4: PCR Amplification Conditions

95ºC/7 min 95ºC/20 sec PCR program 52ºC/20 sec 45 cycles 72ºC/20 sec 72ºC/5 min 4C/hold

Confirmation of cyt b Gene Amplification

Run the purified DNA on an Agilent DNA1000 LabChip to confirm fragment has been amplified, and to determine the concentration of DNA, before proceeding with a Restriction enzyme digest.

Restriction Digestion of PCR Products

Parts of the following stage are performed in the PCR set-up laboratory and parts in the post-PCR laboratory. Note: Take care not to move samples from the post-PCR lab to the PCR set-up lab. The preparation of restriction digest reactions should be performed on ice. Restriction enzymes should only be taken from the freezer (-20) for as short a time as possible and handled as little as possible. In the PCR set-up, label 0.2ml PCR tubes with sample name and restriction enzyme and arrange in suitable rack. Include tubes for restriction digest positive controls for each enzyme. Place all tubes on ice. For each enzyme reaction prepare a mastermix as shown in Table 5 in a 0.5ml Eppendorf tube. To prepare enough reaction mastermix count the number of samples to test. Add 1 for the PCR positive control, which has now become the restriction digest positive control, and multiply the total number of reactions by the values in columns 3 or 5 (depending on whether BSA should be used). Finally add an extra 10% for pipetting errors. Note: BSA is required by some enzymes. Stock (100x) BSA provided with the enzyme should be diluted 1 in 30 in SDW prior to adding volumes shown in table. Table 5: Preparation Volumes for Restriction Digests Mastermix

Component Final Bsi YI Mbo I and Mnl I

Page 126 of 153

Concentration Volume for 1 Volume for Volume for Volume for Digest 10 Digests1 1 Digest 10 Digests1 (μl) (μl) (μl) (μl) 10x Buffer2 1x 0.5 5.5 0.5 5.5 Enzyme 0.5 5.5 0.5 5.5 BSA 1x ~ ~ 1.5 16.5 SDW ~ 1.5 16.5 ~ ~

Volume ~ 2.5 27.5 2.5 27.5

3. An extra 10% has been added to values shown to allow for pipetting errors. 4. See Table 3 for correct buffer to use with each enzyme.

Vortex the enzyme mastermix thoroughly to mix. Centrifuge at 16,000g for 15 secs to recover the solution. Leave enzyme mastermixes on ice and transfer to Post-PCR for next step Use a P10 Gilson to add 2.5µl of the mastermix to the respective labelled PCR tubes. Leave the tubes on ice and take them to the Post-PCR laboratory for the next steps. Use a P10 Gilson to add 2.5µl of PCR product (from 8.3) to the respective labelled PCR tubes. Use a P10 Gilson pipette to add 2.5μl of PCR positive control DNA to the restriction digest positive control tube.

Place the tubes in the thermocycler and incubate samples for at least 4 hours (or overnight) at 37C ± 0.5C. Terminate reactions by heating samples to 65C ± 1C for 10-15 minutes.

Digests can be stored at +3C to +6C for up to 2 days. For longer times store samples at - 15C to -25C. Fingerprinting samples on Agilent 2100 Bioanalyzer

The Agilent 2100 Bioanalyzer is a capillary electrophoretic system which is used to separate, size and quantify DNA products according to size. Different sized DNA products require different chip assays according to expected size range. For the analysis of fish PCR-RFLP products the DNA1000 LabChip should be used. Note: Before loading samples on the 2100 Bioanalyzer, use a P10 Gilson pipette to add 1μl of 60mM EDTA to each 5μl digest and mix to achieve a final concentration of 10mM EDTA. Remove tubes containing prepared matrix, DNA size ladder (yellow cap) and upper and lower size markers (green cap) from fridge (+1C to +6C) and leave to warm to room temperature for 1 hour.

Page 127 of 153

Prime DNA1000 LabChip using a prepared gel matrix (See Agilent Bioanlayzer instruction booklet).

Safety Note: The 2100 Bioanalyser contains a laser. Do not interfere with the normal operation of this instrument. Select chip assay type as DNA1000 assay. Press start when chip is ready and wait for 1-2 minutes to ensure analyser starts and there are no problems with chip. If chip error is reported

 stop run and remove chip.

 check chip wells to ensure samples are in bottom of wells and are not adhering to sides. If sample is on sides use a pipette to move it into base of well. Reload chip into analyser and restart run.  If all samples are in bottom of wells invert chip and examine chip wells for bubbles. If chip contains bubbles discard chip and reload samples into fresh chip.  If problems persist and there are no obvious problems consult your line manager. You may need to run a full instrument diagnostics test.

After run is complete save file into appropriate folder. Remove DNA chip from analyser and clean analyser pins with cleaning chip containing approximately 350µl SDW.

Quality Assurance

46. Negative Controls

The purpose of the negative controls are to identify if contamination has occurred during the extraction or PCR procedures.

Page 128 of 153

An extraction negative control must be prepared with every batch of DNA extracts. The extraction negative is usually manipulated last at each stage of the process, to pick up any possible source of contamination. A PCR negative control must be used as a method control with every set of samples amplified at the same time. For a PCR negative, 5µl sterile ultrapure water replaces the sample DNA extract, when setting up the PCR. The PCR negative is usually manipulated last at each stage of the process, to pick up any possible source of contamination.

The PCR negative control should show no PCR product present. Presence of the PCR product indicates contamination has occurred and the PCR batch is invalid and all samples must be re-amplified. If this occurs, consult your line manager. A DNA extraction negative control showing a strong visible band of equivalent size to the positive PCR control means the extraction batch is invalid and all samples must be re- extracted. Positive PCR Controls

A positive PCR control, relating to the sample type*, is amplified with every batch of samples. The positive must be treated as an unknown sample during the DNA extraction and amplification stages.

* Where a particular sample type is expected (from information supplied by the client) use this species as the positive PCR control where possible.

47. PCR Amplification

PCR products resulting from the amplification of DNA extracted from samples and controls are separated according to size using a DNA1000 LabChip.

The presence of a PCR product is indicated by a DNA fragment of 176bp ± 5%.

48. Restriction Digest Quality Control

Restriction digestion positive controls should produce bands of sizes shown in the Appendix 2± 5% for fragments >100bp or ± 15% for fragments <100bp. If digestion is incomplete, i.e. some undigested DNA remains, digestion assays with that enzyme should be repeated.

Restriction digest products should be in the range 15bp to 200bp (largest amplicon size). If products are outside this range, consult your line manager.

Page 129 of 153

Complete digestion of PCR products from samples is assumed based on comparisons to digestion of positive controls. Positive controls are completely digested with a specific enzyme if only the DNA fragments of sizes shown in the Appendix are detected by the 2100 Bioanalyser. If expected fragments are not observed, or additional larger fragments are also observed, consult your line manager. It is likely that complete digestion has not occurred and samples may require re-analysis. 49. 2100 Bioanalyzer Quality Control

A ladder with eleven DNA fragments ranging in size from 15bp to 1500bp should be fully resolved and detected by the analyser using default settings. The internal size markers (15bp and 1500bp) should be clear of other DNA fragments. Check that the bioanalyzer has identified the markers correctly. Consult your line manager if other fragments appear to be co-migrating near the markers.

50. Presence of Species

If the restriction digest positive control DNA shows complete digestion with a specific enzyme, it is assumed that enzymatic digestion of sample DNA has also proceeded to completion with that enzyme.

EXPRESSION OF RESULTS

Compare the sample profiles to those profiles of the tuna species found in the Appendix.

Results are expressed in the report as the following: For sample X, the PCR-RFLP profiles are consistent with the presence of <....> species.

The method cannot identify the species present in a sample as other related tuna species may have the same PCR-RFLP profile.

PRECISION AND ACCURACY

Page 130 of 153

APPENDIX

AUTHENTIC AGILENT 2100 BIOANALYSER CYTB PCR-RFLP PROFILES FOR SPECIES IN CANNED TUNA

DNA Fragments (bp) produced using a DNA1000 Labchip following Species Digestion with the Enzyme Bsi YI Mbo I Mnl I

Theoretical Observed Theoretical Observed Theoretical Observed1

Tunnus alalunga 21, 25, 35, 57, 119 66, 127 47, 129 59, 132 Profile A Albacore 43, 52

Tunnus alabacares 21, 25, 35, 176 183 47, 129 59, 134 Profile A Yellowfin 43, 52

Thunnus thynnus 21, 25, 35, 176 182 47, 55, 74 59, 63, 83 Profile A Bluefin 43, 52

2 Thunnus obesus 58, 132 21, 25, 35, 176 184 176 Profile A Bigeye 182 43, 52

Katsumonus 24, 43, 49, pelamis 176 184 176 182 Profile B 60 Skipjack

Sarda. Sarda 176 NT 176 NT 20, 77, 79 Profile C Bonito

NT = Not tested

1 these small Mnl 1 fragments are not always automatically detected by the Bioanalyzer and the 52 and 43 bp fragments can co- migrate. So it is easier to distinguish the different profiles by analyzing the electropherograms.

2 This is an alternative profile obtained with some Thunnus obesus fish

Page 131 of 153

Observed Mnl1 profiles viewed as Bioanalyzer electropherogram images.

Profile A

Sometimes the 2 largest fragments run together so only one peak is observed

Profile B

Profile C Image not available

Page 132 of 153

Appendix F

Version 1.0, October 2007

STANDARD OPERATING PROCEDURE FOR DISCRIMINATION OF KING & QUEEN SCALLOP SPECIES BY PCR-RFLP ANALYSIS USING THE AGILENT 2100 BIOANALYZER

Page 133 of 153

Prepared by

Campden BRI

Page 134 of 153

CONTENTS

1. HISTORY / BACKGROUND ...... 136 2. PURPOSE ...... 136 3. SCOPE ...... 136 4. DEFINITIONS AND ABBREVIATIONS ...... 136 5. PRINCIPLE OF THE METHOD ...... 137 6. MATERIALS AND EQUIPMENT ...... 137

6.1 WATER ...... 138

6.2 SOLUTIONS, STANDARDS AND REFERENCE MATERIALS ...... 138

6.2.1 4MM DNTP MIXTURE ...... 138

6.2.2 5µM PRIMER SOLUTIONS ...... 138

6.2.3 AMPLITAQ GOLD® POLYMERASE ...... 139

6.2.4 PCR MASTERMIX ...... 139

6.2.5.1 0.5M STOCK SOLUTION ...... 140

6.2.6 RESTRICTION ENZYMES ...... 141

6.2.7 POSITIVE AND NEGATIVE DNA CONTROLS ...... 141

6.2.8 TEMPLATE DNA SOLUTIONS OF SAMPLES ...... 141

6.2.9 ETHANOL 80% (V/V) ...... 142

6.2.10 HAZ TAB ...... 142

6.3 EQUIPMENT ...... 142

6.3.1 THERMOCYCLER...... 142

6.3.2 LAMINAR FLOW HOOD (PCR HOOD)...... 142

6.3.3 SETS OF GILSON PRECISION PIPETTES (INCLUDING, P10, P20, P100, P200, P1000)...... 142

6.3.4 BENCHTOP WHIRLIMIXER...... 142

6.3.5 BENCHTOP CENTRIFUGE FOR MICROTUBES...... 142

6.3.6 STERILE FILTER PIPETTE TIPS...... 142

6.3.7 AGILENT 2100 BIOANALYZER...... 142

6.3.8 VORTEX MIXER – IKA MODEL MS2-S8/S9...... 142

Page 135 of 153

6.3.9 1.5 ML EPPENDORF TUBES ...... 143

6.3.10 2.0 ML EPPENDORF TUBES...... 143

6.3.11 PCR TUBE STRIPS WITH ATTACHED CAPS (EIGHT REACTIONS EACH)...... 143

6.3.12 PCR TUBE STORAGE BLOCK FOR PREPARATION OF PCRS...... 143

6.3.13 96 WELL PCR PLATES AND LIDS OR SEALS...... 143

7. PROCEDURES ...... 143

7.1 SAMPLE PREPARATION ...... 143

7.2 AMPLIFICATION THE TARGET SEQUENCE ...... 143

7.3 CONFIRMATION OF PCR AMPLIFICATION ...... 145

7.4 RESTRICTION DIGESTION OF PCR PRODUCTS ...... 146

7.5 FINGERPRINTING SAMPLES ON AGILENT 2100 BIOANALYZER ...... 147

7.6 QUALITY ASSURANCE ...... 148

7.6.1 NEGATIVE CONTROLS ...... 148

7.6.3 PCR AMPLIFICATION ...... 149

7.6.4 RESTRICTION DIGEST QUALITY CONTROL ...... 149

7.6.5 2100 BIOANALYZER QUALITY CONTROL ...... 150

7.6.6 PRESENCE OF SPECIES ...... 150

8. EXPRESSION OF RESULTS ...... 150 9. PRECISION AND ACCURACY ...... 150 10. APPENDICES ...... 151

10.1 APPENDIX ONE ...... 151

Page 136 of 153

HISTORY / BACKGROUND

Differences in DNA sequences allow a species to be discriminated. The polymerase chain reaction (PCR) can be used to amplify DNA sequences. By combining PCR with restriction fragment length polymorphisms (RFLP) analysis it is possible to generate DNA fragment profiles which discriminate species.

The 464bp cyt b target used for vertebrate fish species PCR-RFLP is not suitable for molluscs and crustacea so other approaches must be adopted. One common approach has been to target a nuclear ribosomal DNA region spanning the 5.8S ribosomal RNA gene and the two internal transcribed spacers, ITS-1 and ITS-2. This region has been specifically targeted for bivalve molluscs such as scallops by Lopez-Pinon et al, 2002.* * Lopez-Pinon, M. J., Insua, A., & Mendez, J. (2002) Identification of Four Scallop Species Using PCR and Restriction Analysis of the Ribosomal DNA Internal Transcribed Spacer Region. Marine Biotechnology, 4(5) 495-502.

PURPOSE

The rationale for having the SOP is to enable discrimination of King scallop from Queen scallop in commercial products

SCOPE

The method describes the use of PCR-RFLP profiling for discrimination of King scallop (Pecten maximus ) and Queen scallop (Aequipecten opercularis) in fresh and frozen food products.

DEFINITIONS AND ABBREVIATIONS

DNA : Deoxy-ribonucleic acid. This molecule comprises strings of the four bases (Guanine, Adenosine, Thymine, Cytosine) forming genes. dNTP : deoxy-nucleotide-triphosphates. An abbreviation for any of the four bases (see specific bases) forming DNA. PCR : Polymerase Chain Reaction – a method of amplifying a single DNA fragment to produce millions of copies, which can be detected. Primer : A short oligonucleotide designed to anneal to specific regions of DNA in order to facilitate the PCR. Primers are designed to complement regions of DNA bounding the gene of interest. RNA : Ribonucleic acid. This molecule comprises a single stranded string of the four bases, (Adenine, Uracil, Thymine, Guanine), used in the transcription (formation) of genes. RFLP : Restriction fragment length polymorphism. Different sizes of DNA fragment produced by cutting DNA with restriction enzymes. SDW : Sterile distilled water of molecular biology grade. Taq polymerase : A specific, heat-stable DNA polymerase used to replicate DNA targets during PCR

Page 138 of 153

PRINCIPLE OF THE METHOD

This method describes the production of PCR-RFLP fingerprints for the identification of King and Queen scallops. Species-specific profiles are produced using DNA extracted from scallops samples. The method used for DNA extraction is not part of this method; however, DNA should be extracted using a method suited for use with food samples. One suitable method is the CTAB method, details of which can be found in the final report for FSA project Q01084 "Final optimisation and evaluation of DNA based methods for the authentication and quantification of meat species" The polymerase chain reaction (PCR) is used to detect DNA sequences in living organisms and in materials derived from living organisms. It relies on the binding of single-stranded DNA fragments (primers) to a specific DNA target sequence and the copying of this target in the presence of excess amounts of DNA subunits (nucleotides) and a DNA polymerase (Taq). Multiple cycles at specific temperatures result in the million-fold copying of the target sequence.

Restriction enzymes are naturally produced by bacterial strains to degrade DNA at sequence specific sites, e.g. EcoR1 only cuts the six base-pair pattern GAATTC between the G and first A as shown. By selecting the correct enzymes it is possible to digest DNA from different species to produce species-specific DNA fragments. These fragments can be separated by electrophoretic methods to produce species-specific patterns know as restriction fragment length polymorphism (RFLP) fingerprints.

MATERIALS AND EQUIPMENT

Note: Solutions 6.2.1 – 6.2.6 should be prepared in a laminar flow cabinet. The cabinet should be decontaminated using UV irradiation. Latex gloves should be worn throughout the procedure.

Page 139 of 153

Water

The water used should be ultra-pure water, molecular grade or equivalent purity.

Solutions, standards and reference materials

4mM dNTP mixture dCTP, dGTP, dATP, dTTP, bought as individual 100mM solutions. Using a P100 Gilson pipette, add 38µl of each 100mM stock dNTP to a sterile labelled 1.5ml Eppendorf. Use a P1000 to add 800µl of ultrapure water and aspirate gently to mix. Use a P200 Gilson pipette to aliquot into labelled portions of 200µl in sterile 1.5ml Eppendorf tubes.

Store at -15C to -22C for up to six months.

5µM primer solutions

Table 1: Primer Specifications

5.8S ribosomal RNA gene and the 2 flanking internal Target Sequence transcribed spacers ITS –2

PCR product size ~383bp

ITS-R primer sequence 5'-CTC GTC TGA TCT GAG GTC G-3'

ITS-2 primer sequence 5'- CAT CGA TAT CTT GAA CGC-3'

Note: If primers are required urgently, dissolve at 60C for 1 hour.

Vortex primer solution to thoroughly mix. Centrifuge at 16,000g for 30secs to recover solution. Using a P1000 pipette remove about half the solution and place into a sterile,

Page 140 of 153

labelled 1.5ml Eppendorf. The solution may be stored at this point at -15C to -22C for up to two years. Using a P1000 Gilson pipette add 950µl of ultrapure water to a labelled sterile 1.5ml Eppendorf. Using a P100 Gilson add 50µl of the primer solution (100µM) to the water to give a primer solution of 5µM. Vortex this solution to ensure it is thoroughly mixed and recover by centrifuging at 16,000g for 30secs. Using a P1000 pipette divide the solution between two sterile, labelled 1.5ml Eppendorf tubes. The solution may be stored at this point at -15C to -22C for up to two years. AmpliTaq Gold® Polymerase

Enyzyme kit from Applied Biosystems containing; 10 x PCR Buffer 25mM Magnesium Chloride AmpliTaq Gold Polymerase (5 units/µl)

Store in a dedicated PCR freezer at -15C to -22C for up to six months. PCR Mastermix

A PCR mastermix is prepared for the analysis of a batch of several samples. Details of the reagents used are to be recorded in the analysts laboratory notebook Remove aliquots of each reagent from the freezer and allow to thaw in the laminar flow cabinet.

Prepare the mastermix using the reagents and volumes detailed in the Table 2. Add the reagents to a sterile 2ml Eppendorf tube and mix thoroughly by gentle pipette aspiration prior to use.

Page 141 of 153

Table 2: Preparation of PCR Mastermix

Final Equivalent Concentration in Initial in a Single Reagents PCR Reaction Concentration Reaction (20µl reaction (µl) vol.)

PCR buffer 10x 1x 2.5

MgCl2 25mM 5mM 2

dNTPs 4mM 200µM 1.25

Forward primer 5µM 0.3µM 1.25

Reverse primer 5µM 0.3µM 1.25

Water - - 11.5

Volume 19.75 TaqGold 5U/µl 0.05U/µl 0.25 (before addition of DNA Volume 20 extract) 5µl Template DNA Final Volume 25

EDTA Solution

0.5M Stock Solution

This is a standard lab stock solution of EDTA.

Weigh out 18.61g ± 0.01g EDTA (Ethylenediaminetetraacetic acid, Disodium Salt Dihydrate) into a 200ml beaker.

Page 142 of 153

Restriction enzymes, as shown in Table 3, are obtained from New England Biolabs unless otherwise stated. All enzymes come with optimal buffers as shown.

Enzymes should be stored at -15˚C to -22˚C until the expiry date for each particular enzyme batch is reached.

Table 3: Details of Restriction Enzymes Used During this Method

Incubation Enzyme Catalogue No. Optimal Buffer Temperature (C) Nla III R0125S NEBuffer 4 37

Positive and Negative DNA Controls

DNA extracts from single known species are used as positive controls. After DNA extraction prepare DNA solutions at 10ng/µl using the formula in 6.8.2. This is a 10ng/µl working solution. Use a P200 Gilson to aliquot 50µl volumes of the DNA working solution into sterile, labelled 1.5ml Eppendorf tubes. Store aliquots at –15ºC to –22ºC for up to two years. A negative extraction control should be prepared with every batch of DNA extracts. This control is prepared using water and can be used for PCR amplification in an undiluted form.

Template DNA Solutions of Samples

The concentration of DNA within unknown sample extracts is determined using spectrophotometry

Page 143 of 153

Dilute extracts of sample DNA to 10ng/µl, for PCR amplification, using the formula below: Volume of water to be added  Concentration (ng / l) *     1 x 5  to 5μl sample extract for a  Nominal concentration (10ng / l)   final concentration of 10ng/μl (to the nearest 5μl)  Value obtained from spectrophotometer

Use a P200 Gilson pipette to add ultrapure water to a 1.5ml Eppendorf tube. Use a P10 Gilson pipette to add 5µl of sample DNA extract to the water. Vortex for 20 seconds to mix and centrifuge 30 seconds at 16,000g to recover solution. This is a 10ng/µl DNA working solution of the test sample for analysis.

DNA samples can be stored at 4ºC to 8ºC for up to 1 week or at –15ºC to –22ºC for longer periods up to 2 years. Ethanol 80% (v/v)

Use a measuring cylinder to add 80ml Ethanol to 20ml ultra-pure water in a clean labelled Schott bottle. Store at ambient temperature for up to 3 months Haz Tab

Chlorine disinfection tablets made with NaDCC (Sodium Dichloroisocyanurate). (Guest Medical, Edenbridge, Kent, UK). Follow manufacturer's instuctions to make up to appropriate concentration.

Equipment

Thermocycler.

Laminar flow hood (PCR hood).

Sets of Gilson precision pipettes (including, P10, P20, P100, P200, P1000).

Benchtop whirlimixer.

Benchtop centrifuge for microtubes.

Sterile filter pipette tips.

Agilent 2100 Bioanalyzer.

Vortex mixer – IKA model MS2-S8/S9.

The following items are sterilised by autoclaving (see note):

Page 144 of 153

. 1.5 ml Eppendorf tubes

. 2.0 ml Eppendorf tubes.

Note: All equipment and reagents required to be autoclaved are sterilised using the following conditions: 121C2.5C for 15 min2min at 1.0 Bar. The following items are UV sterilised for 5 minutes using the UV light source in a laminar flow cabinet: . PCR tube strips with attached caps (eight reactions each).

. PCR tube storage block for preparation of PCRs.

. 96 well PCR plates and lids or seals.

PROCEDURES

Sample preparation

Note: DNA should be extracted using either a CTAB DNA extraction or other suitable commercial kit method (Tepnel, Promega, R-Biopharm, Qiagen etc.). Records method use in laboratory note book. Perform DNA extraction from individual scallops in duplicate for the first sample and for every 10 samples thereafter. Include a suitable DNA extraction positive control and a DNA extraction negative control with every batch of samples. Record the positive control sample code in your laboratory notebook. Note: The positive control should be chosen to match one of the species being tested for. If no species are declared for analysis. A sample of known species should be used.

For the negative control, use water in place of the sample.

Quantify the DNA extractions using the GeneQuant Pro calculator or alternative spectrophotometer instrument. Dilute sample DNA to 10ng/μl using the formula shown in 6.2.8. Diluted DNA is now known as template DNA. Amplification the target sequence

Page 145 of 153

This method is suitable for the analysis of extracts of scallops with template DNA of between 50ng and 100ng for each reaction. For example, 5µl of an extract with a DNA concentration of 10ng/µl gives 50ng of DNA for the amplification reaction. If the concentration of extracted DNA is below 10ng/μl, the method must be performed on undiluted extract.

Page 146 of 153

Use a P10 Gilson to add 5µl of ultrapure water to the NTC wells. Cap the tubes after adding water.

Remove all used tips and tubes, replace tube holders and wipe laminar flow hood with sterilising solution. Transfer PCR tubes to the thermocycler laboratory. In post-PCR laboratory

Place PCR tubes into a thermocycler and use the programme found in Table 4.

Safety Note: Avoid touching heating block and heated lid as they achieve temperatures of over 95°C.

After the PCR programme is complete, remove tube strips from thermocycler and store samples at 1ºC to 6ºC for up to 2 days. Alternatively, PCR products can be stored for up to three months at between -15ºC and -22ºC. Note: Do not remove PCR products from the thermocycler laboratory.

Table 4: PCR Amplification Conditions

95ºC/5 min 95ºC/20 sec PCR program 55ºC/20 sec 40 cycles 72ºC/45 sec 72ºC/5 min 4C/hold

Confirmation of PCR Amplification

Run the purified DNA on an Agilent DNA1000 LabChip to confirm fragment has been amplified, and to determine the concentration of DNA, before proceeding with a Restriction enzyme digest.

Page 147 of 153

Restriction Digestion of PCR Products

Parts of the following stage are performed in the PCR set-up laboratory and parts in the post-PCR laboratory. Note: Take care not to move samples from the post-PCR lab to the PCR set-up lab. The preparation of restriction digest reactions should be performed on ice. Restriction enzymes should only be taken from the freezer (-20) for as short a time as possible and handled as little as possible. In the PCR set-up, label 0.2ml PCR tubes with sample name and restriction enzyme and arrange in suitable rack. Include tubes for restriction digest positive controls for each enzyme. Place all tubes on ice. For each enzyme reaction prepare a mastermix as shown in Table 5 in a 0.5ml Eppendorf tube. To prepare enough reaction mastermix count the number of samples to test. Add 1 for the PCR positive control, which has now become the restriction digest positive control, and multiply the total number of reactions by the values in column 3 of Table 5 (volume for 1 Digest). Finally add an extra 10% for pipetting errors.

Table 5: Preparation Volumes for Restriction Digests Mastermix

Reactions without BSA Reactions with BSA1 Final Component Volume for 1 Volume for Volume for Volume for Concentration Digest 10 Digests2 1 Digest 10 Digests2 (μl) (μl) (μl) (μl) 10x Buffer3 1x 0.5 5.5 0.5 5.5 Enzyme 0.5 5.5 0.5 5.5 BSA 1x ~ ~ 1.5 16.5 SDW ~ 1.5 16.5 ~ ~ Volume ~ 2.5 27.5 2.5 27.5

1. Enzyme Nla III requires BSA. 5. An extra 10% has been added to values shown to allow for pipetting errors. 6. See Table 3 for correct buffer to use with each enzyme.

Page 148 of 153

Leave the tubes on ice and take them to the Post-PCR laboratory for the next steps. Use a P10 Gilson to add 2.5µl of PCR product (from 8.3) to the respective labelled PCR tubes. Use a P10 Gilson pipette to add 2.5μl of PCR positive control DNA to the restriction digest positive control tube.

Place the tubes in the thermocycler and incubate samples for at least 4 hours (or overnight) at 37C ± 1.0C. Terminate reactions by heating samples to 65C ± 1C for 10-20 minutes.

Digests can be stored at +3C to +6C for up to 2 days. For longer times store samples at - 15C to -25C. Fingerprinting samples on Agilent 2100 Bioanalyzer

The Agilent 2100 Bioanalyzer is a capillary electrophoretic system which is used to separate, size and quantify DNA products according to size. Different sized DNA products require different chip assays according to expected size range. For the analysis of fish PCR-RFLP products the DNA1000 LabChip should be used. Note: Before loading samples on the 2100 Bioanalyser, use a P10 Gilson pipette to add 1μl of 60mM EDTA to each 5μl digest and mix to achieve a final concentration of 10mM EDTA. Remove tubes containing prepared matrix, DNA size ladder (yellow cap) and upper and lower size markers (green cap) from fridge (+1C to +6C) and leave to warm to room temperature for 1 hour. Prime the DNA1000 LabChip according to the manufacturer’s instructions using prepared gel matrix.

Page 149 of 153

After run is complete save file into appropriate folder. Remove DNA chip from analyser and clean analyser pins with cleaning chip containing approximately 350µl SDW.

Print results of analysis, including gel image and report of fragment sizes. Fix in lab notebook.

Quality Assurance

Negative Controls

Page 150 of 153

A DNA extraction negative control showing a strong visible band of equivalent size to the positive PCR control means the extraction batch is invalid and all samples must be re- extracted.

Positive PCR Controls

A positive PCR control, relating to the sample type*, is amplified with every batch of samples. The positive must be treated as an unknown sample during the DNA extraction and amplification stages.

* Where a particular sample type is expected (from information supplied by the client) use this species as the positive PCR control where possible.

PCR Amplification

PCR products resulting from the amplification of DNA extracted from samples and controls are separated according to size using a DNA1000 LabChip.

The presence of a PCR product is indicated by a DNA fragment 390 ± 5% for ITS-R/ ITS-2.

Restriction Digest Quality Control

Restriction digestion positive controls should produce bands of sizes shown in the Appendix ± 5%. If digestion is incomplete, i.e. some undigested DNA remains, digestion assays with that enzyme should be repeated.

Restriction digest products should be in the range 87-390bp (for ITS-R/ ITS-2). If products are outside this range, consult your line manager.

Complete digestion of PCR products from samples is assumed based on comparisons to digestion of positive controls. Positive controls are completely digested with a specific enzyme if only the DNA fragments of sizes shown in Appendix 1 are detected by the 2100 Bioanalyzer. If expected fragments are not observed, or additional larger fragments are also observed, consult your line manager. It is likely that complete digestion has not occurred and samples may require re-analysis.

Page 151 of 153

2100 Bioanalyzer Quality Control

A ladder with eleven DNA fragments ranging in size from 15bp to 1500bp should be fully resolved and detected by the analyser using default settings. The internal size markers (15bp and 1500bp) should be clear of other DNA fragments. Check that the bioanalyser has identified the markers correctly. Consult your line manager if other fragments appear to be co-migrating near the markers.

Presence of Species

If the restriction digest positive control DNA shows complete digestion with a specific enzyme, it is assumed that enzymatic digestion of sample DNA has also proceeded to completion with that enzyme

EXPRESSION OF RESULTS

Compare the NlaIII profiles from the samples to the profiles for King and Queen scallop profiles found in the Appendix. Please note that Queen scallops sometimes produces a larger fragment at 283bp in addition to the fragment at 273bp.

The results are expressed in the following way:

For sample X, the PCR-RFLP profiles are consistent with the presence of <....> species.

The method cannot identify the species present in a sample as other scallop species may share the same profile.

PRECISION AND ACCURACY

Page 152 of 153

APPENDICES

APPENDIX ONE

NlaIII PCR-RFLP profiles for scallops (ITS-R/ITS-2 amplicon)

DNA Fragments (bp) produced using a DNA1000 Labchip following Species Digestion with the Enzyme PCR Product Nla III

Expected Observed Expected Observed 283*, 272, Queen Scallop 96 (Aequipecten 366 390 87, 279 or operularis) 273, 97

King Scallop 369 390 142, 227 (Pecten Maximus) 226, 158

* an additional fragment appears in some samples.

Page 153 of 153