viruses

Article The Operophtera brumata Nucleopolyhedrovirus (OpbuNPV) Represents an Early, Divergent Lineage within Genus Alphabaculovirus

Robert L. Harrison 1,*, Daniel L. Rowley 1, Joseph D. Mowery 2 ID , Gary R. Bauchan 2 and John P. Burand 3 1 Invasive Insect Biocontrol and Behavior Laboratory, Beltsville Agricultural Research Center, USDA Agricultural Research Service, Beltsville, MD 20705, USA; [email protected] 2 Electron and Confocal Microscopy Unit, Beltsville Agricultural Research Center, USDA Agricultural Research Service, Beltsville, MD 20705, USA; [email protected] (J.D.M.); [email protected] (G.R.B.) 3 Department of Microbiology, University of Massachusetts-Amherst, Amherst, MA 01003, USA; [email protected] * Correspondence: [email protected]; Tel.: +1-301-504-5249

Received: 18 September 2017; Accepted: 17 October 2017; Published: 21 October 2017 Abstract: Operophtera brumata nucleopolyhedrovirus (OpbuNPV) infects the larvae of the winter moth, Operophtera brumata. As part of an effort to explore the pesticidal potential of OpbuNPV, an isolate of this virus from Massachusetts (USA)—OpbuNPV-MA—was characterized by electron microscopy of OpbuNPV occlusion bodies (OBs) and by sequencing of the viral genome. The OBs of OpbuNPV-MA consisted of irregular polyhedra and contained virions consisting of a single rod-shaped nucleocapsid within each envelope. Presumptive cypovirus OBs were also detected in sections of the OB preparation. The OpbuNPV-MA genome assembly yielded a circular contig of 119,054 bp and was found to contain little genetic variation, with most polymorphisms occurring at a frequency of < 6%. A total of 130 open reading frames (ORFs) were annotated, including the 38 core genes of Baculoviridae, along with five homologous repeat (hr) regions. The results of BLASTp and phylogenetic analysis with selected ORFs indicated that OpbuNPV-MA is not closely related to other alphabaculoviruses. Phylogenies based on concatenated core gene amino acid sequence alignments placed OpbuNPV-MA on a basal branch lying outside other alphabaculovirus clades. These results indicate that OpbuNPV-MA represents a divergent baculovirus lineage that appeared early during the diversification of genus Alphabaculovirus.

Keywords: baculovirus; Alphabaculovirus; genome; winter moth; Operophtera brumata; cypovirus

1. Introduction Baculoviruses are rod-shaped, insect-specific viruses of family Baculoviridae that possess large (≥80 kbp) double-stranded circular DNA genomes [1]. There are four genera in this family, with genus Alphabaculovirus containing the largest number of species. Alphabaculoviruses—also known as nucleopolyhedroviruses (NPVs)—infect larvae of order Lepidoptera (moths and butterflies) and produce visually distinctive polyhedra (or occlusion bodies, OBs) in host cells during replication [2,3]. The OBs are large enough to be visualized by light microscopy, and contain a type of virion referred to as the occlusion-derived virus (ODV). The ODV initiate primary infection of the host larval midgut epithelium after being liberated from the OBs, which are solubilized in the alkaline lumen of the host midgut. A second type of virion—the budded virus (BV)—is initially assembled and secreted from infected cells to spread infection to other tissues in the host. Progeny ODVs are later assembled and occluded into OBs, which are subsequently released after the death of the infected insect.

Viruses 2017, 9, 307; doi:10.3390/v9100307 www.mdpi.com/journal/viruses Viruses 2017, 9, 307 2 of 20

In this study, we present an analysis of the occlusion bodies and genome sequence of an alphabaculovirus from the winter moth, Operophtera brumata (L.) (Lepidoptera: Geometridae). A native of Europe, this moth species has established invasive populations in North America multiple times during the last 60 years [4,5]. The most recent invasion started in Massachusetts, and has spread to the coastal regions of New England in the USA and the Maritime Provinces in Canada. Outbreaks of winter moth larvae in these areas cause mass defoliation of trees. The larvae also attack the fruiting buds of apple trees and blueberry bushes in local orchards. Alphabaculovirus isolates have been isolated from populations of winter moth [6,7], including winter moth larvae in Massachusetts [8]. As a pathogen of the winter moth, the idea of formulating Operophtera brumata nucleopolyhedrovirus (OpbuNPV) isolates as biopesticides to use against outbreaks of winter moth larvae is appealing. Another alphabaculovirus—Lymantria dispar multiple nucleopolyhedrovirus (LdMNPV)—has been applied successfully to control outbreaks of the gypsy moth, another defoliating lepidopteran pest found in the northeastern USA. However, while LdMNPV can cause naturally occurring epizootics in outbreaking populations of Lymantria dispar, OpbuNPV appears to exist primarily in a covert state in Massachusetts winter moth populations, with little mortality reported in field-caught, laboratory-raised larvae, and no viral epizootics reported in Massachusetts populations [5,8,9]. An early attempt to control an outbreak of winter moth larvae in British Columbia with an application of OpbuNPV caused only a transient 46% reduction in larval population density with the highest dose [10]. In this study, we examined the occlusion bodies and the genome sequence of a Massachusetts isolate of OpbuNPV (OpbuNPV-MA) as part of an attempt to understand why this virus is not more of a mortality factor in North American populations of the winter moth and to identify genotypes that may be more virulent against winter moth larvae.

2. Materials and Methods

2.1. Virus Production and Isolation A sample of the isolate OpbuNPV-MA collected in eastern Massachusetts was used to infect 3rd instar O. brumata larvae that had been hatched and reared in captivity as described in [9]. Larvae that were starved overnight were allowed to feed on a cube of diet surface-contaminated with 8 × 105 OpbuNPV-MA OBs. Cadavers dying from infection were harvested and homogenized in 20 mL 0.5% SDS for 30 s with an Ultra-Turrax T-25 fitted with an IKA S25N-18G dispersing tool and set at 3000 rpm. The homogenate was filtered through three layers of cheesecloth, and OBs were recovered by low-speed centrifugation (1436 g for 10 min). After decanting the supernatant, the OB pellet was resuspended in 25 mL 0.1% SDS. OBs were pelleted again as above, resuspended in 25 mL 0.5 M NaCl, then pelleted a third time. The final OB pellet was resuspended in 0.02% sodium azide prepared in deionized distilled H2O at a final concentration of 8.7 × 109 OBs/mL.

2.2. Electron Microscopy For scanning electron microscopy (SEM), OpbuNPV-MA OBs were pipetted onto filter paper and secured to copper plates using ultra-smooth round carbon adhesive tabs (Electron Microscopy Sciences, Inc., Hatfield, PA, USA). The OBs were frozen by placing the plates on the surface of a pre-cooled (−196 ◦C) brass bar whose lower half was submerged in liquid nitrogen. After 20–30 s, the holders containing the frozen samples were transferred to a Quorum PP2000 cryo-prep chamber (Quorum Technologies, East Sussex, UK) attached to an S-4700 field emission scanning electron microscope (Hitachi High Technologies America, Inc., Dallas, TX, USA). The OBs were etched to remove condensed water vapor by raising the temperature of the stage to −90 ◦C for 10–15 min. Following etching, the temperature of the stage inside the cryo-transfer system was lowered to −130 ◦C, and the OBs were coated with a 10-nm layer of platinum using a magnetron sputter head equipped with a platinum Viruses 2017, 9, 307 3 of 20 target. The specimens were transferred to a pre-cooled (−130 ◦C) cryostage in the low-temperature SEM (LT-SEM) for observation. An accelerating voltage of 5 kV was used to view the specimens. Images were captured using a 4pi Analysis System (Durham, NC, USA). For transmission electron microscopy (TEM), OBs were pelleted by centrifugation at 2300× g for 3 min. The pellet was fixed for 2 h at room temperature in 2.5% glutaraldehyde-0.05 M sodium ◦ cacodylate-0.005 M CaCl2 (pH 7.0), then refrigerated at 4 C overnight. After six rinses with 0.05 M sodium cacodylate-0.005 M CaCl2 buffer, the OBs were post-fixed in 1% buffered osmium tetroxide for 2 h at room temperature. Post-fixed OBs were then rinsed six times in the same buffer, dehydrated in a graded series of ethanol followed by three exchanges of propylene oxide, infiltrated in a graded series of LX-112 resin/propylene oxide, and polymerized in LX-112 resin at 65 ◦C for 24 h. Then, 60- to 90-nm silver-gold ultrathin sections were cut on a Reichert/AO Ultracut ultramicrotome with a Diatome diamond knife and mounted onto 200 mesh carbon/formvar-coated copper grids. Grids were stained with 4% uranyl acetate and 3% lead citrate and imaged at 80 kV with a Hitachi HT-7700 transmission electron microscope (Hitachi High Technologies America, Inc., USA).

2.3. Viral DNA Isolation and Sequencing

9 An aliquot of OpbuNPV-MA containing 6.5 × 10 OBs was diluted to 28 mL in 0.1 M Na2CO3. Diluted OBs were solubilized by incubation for 30 min at the benchtop, followed by 15 min at 37 ◦C, and insoluble material was removed by centrifugation (10 min at 1436 g). After neutralization with 1 M Tris-HCl pH 7.5, ODVs were pelleted by centrifugation (75 min at 103,586 g) through a 3 mL pad of 25% w/w sucrose in phosphate-buffered saline using a Beckman SW-28 rotor. DNA was extracted from the ODV pellet by resuspension in Disruption Buffer (10 mM Tris-HCL pH 8.0–10 mM EDTA pH 8.0–0.25% SDS) containing 500 µg/mL proteinase K, followed by incubation for 1 h at 55 ◦C, extraction with 1:1 phenol:chloroform, and ethanol precipitation. A total of 0.5 µg DNA was recovered as assessed with the Quant-iT PicoGreen dsDNA Kit (Invitrogen, Waltham, MA, USA). For sequencing of the viral DNA, a paired-end library was prepared by tagmentation of 100 ng of the DNA sample with the QIAseq FX DNA Library Kit (Qiagen catalog #180473) followed by size selection with the GeneRead Size Selection Kit (Qiagen catalog #180514) following the manufacturer’s instructions. The library prep quality was evaluated with the Agilent TapeStation. Six picomoles of the library were sequenced on a MiSeq System (Illumina) using the MiSeq® Reagent Kit v2 micro 300 cycles kit (MS-103-1002) following the manufacturer’s instructions. The sequencing data were initially assembled de novo with SeqMan NGen (DNASTAR) using 200,000 reads. The resulting contigs were joined into a single contig, with the initial nucleotide corresponding to the initial adenine of the polyhedrin start codon. This contig was then used as a template for a second round of assembly using 746,754 sequence reads with an average length of 151 nt. Single-nucleotide polymorphisms (SNPs) and insertions/deletions (indels) were identified and enumerated with the SNP Report function of SeqMan Pro (DNASTAR). The sequence of the final contig, with an average coverage of 941X, was deposited in GenBank with the accession number MF614691.

2.4. Genome Sequence Analysis and Feature Annotation Lasergene GeneQuest (DNAStar, v. 14) was used to identify potentially protein-encoding open reading frames (ORFs) of ≥50 codons in size (excluding the stop codon) in the OpbuNPV-MA genome sequence. These ORFs were selected for annotation if they possessed significant amino acid sequence similarity with ORFs from other baculoviruses or sequences from other sources, as assessed by BLASTp. ORFs with no significant matches to other sequences also were selected for annotation if (a) they did not overlap a larger ORF by ≥75 bp, and (b) they were predicted to be protein-encoding by both the fgenesV (http://linux1.softberry.com/berry.phtml) and ZCURVE_V [11] algorithms. Sequence similarity for these ORFs was also sought for using HHpred [12]. Viruses 2017, 9, 307 4 of 20

Regions of repeated sequences corresponding to likely homologous repeat (hr) regions were also sought out and identified using Lasergene GeneQuest. Unit repeats were aligned with CLUSTAL W[13]) on Lasergene MegAlign (v. 14) and conserved positions were visualized with BoxShade 3.2 (http://www.ch.embnet.org/software/BOX_form.html).

2.5. Sequence Comparison and Phylogeny Amino acid sequences were aligned using MAFFT [14] on MegAlign Pro (v. 14) with default parameters. Core gene amino acid sequence alignments were concatenated using BioEdit 7.1.3.0. Minimum evolution (ME) phylograms were inferred using MEGA 7 [15] using the Jones–Taylor– Thorton (JTT) substitution matrix with rates varying among sites and a gamma parameter value estimated from the alignments. For the ME phylogram of the concatenated core gene alignments, the DNA polymerase alignment was used to estimate the gamma parameter. The pairwise-deletion option was used for handling gaps and missing data, and tree reliability was evaluated by bootstrap with 500 replicates. Maximum likelihood (ML) phylograms were inferred with either MEGA 7 from single-sequence alignments or RAxML [16] from the concatenated core gene alignments. For MEGA 7, the best-fitting substitution matrix—as determined by the Model Selection function of MEGA 7—was used for phylogenetic inference with variable rates among sites, the pairwise-deletion option for handling gaps and missing data, and 500 bootstrap replicates. For RAxML, the Le and Gascuel (LG) substitution matrix was used with variable rates among sites and 100 bootstrap replicates.

3. Results

3.1. Ultrastructure of OBs from Winter Moth Larvae Scanning electron micrographs revealed that the OBs isolated from winter moth larval cadavers were composed of irregular polyhedra with an appearance typical for alphabaculovirus OBs (Figure1A,B). OBs measured up to 1.8 µm in diameter. Transmission electron micrographs of sections through the OBs revealed that they contained numerous enveloped rod-shaped virions consisting of a single nucleocapsid per virion (Figure1C,D). Closer examination of the OB cross-sections revealed the presence of OBs that did not contain the rod-shaped virions typically observed in baculovirus OBs (Figure2A). Instead, these OBs contained virus-like particles that were round or icosahedral in cross-section and measured up to 58 nm in diameter (Figure2B). The OBs themselves were often hexagonal in cross-section and were usually smaller relative to the alphabaculovirus OBs in the sectioned material. In appearance, the OBs together with their embedded virions closely resembled OBs described for cypoviruses, which are viruses of the insect-specific genus Cypovirus of the segmented dsRNA virus family Reoviridae [17]. At least two distinct cypoviruses have previously been described from Scottish populations of O. brumata [18,19]. Viruses 2017, 9, 307 5 of 20 Viruses 2017, 9, 307 5 of 20

Figure 1.1. OcclusionOcclusion bodies bodies (OBs) of alphabaculovirusalphabaculovirus OpbuNPV-MA (Massachusetts isolate of OpbuNPV). (A,,B) Scanning electron micrographs of OpbuNPV-MA OBs. ( C,D) Transmission Transmission electron micrographs of of OpbuNPV-MA OpbuNPV-MA OBs. OBs. The The red red arrow arrow in ( inD) ( Ddenotes) denotes the theenvelope envelope surrounding surrounding the rod- the rod-shapedshaped nucleocapsid nucleocapsid of a ofvirion. a virion. Scale Scale bars: bars: (A) 2 (A μ)m; 2 µ(Bm;,C ()B 1, Cμ)m; 1 µ(Dm;) 500 (D) nm. 500 nm.

Viruses 2017, 9, 307 6 of 20 Viruses 2017, 9, 307 6 of 20

Figure 2. OBsOBs of ofpresumptive presumptive cypoviruses cypoviruses found found in the in theOpbuNPV-MA OpbuNPV-MA OB preparation. OB preparation. (A) (OpbuNPV-MAA) OpbuNPV-MA and andcypovirus cypovirus OBs. OBs. Black Black arrows arrows denote denote two two cypovirus cypovirus OBs OBs adjacent adjacent to to an OpbuNPV-MA OB, and red arrows point to examples of the virus-like particles in the presumptive cypovirus OBs.OBs. ( B(B) Higher) Higher magnification magnification image image of a presumptiveof a presumptive cypovirus cypovirus OB, with OB, an insetwith showing an inset a showinghigh magnification a high magnification image of one image of the of occluded one of virus-likethe occluded particles. virus-like Scale particles. bars: (A) 500Scale nm; bars: (B) ( 200A) nm;500 (nm;inset (B)) 40 200 nm. nm; (inset) 40 nm.

3.2. Properties of the Opbu OpbuNPV-MANPV-MA Genome Sequence Reads from sequencing of OpbuNPV-MA DNA were assembled into a circular genome contig of 119,054 bp (Figure3 3).). TheThe sizesize ofof thethe genomegenome andand thethe G+C G+C nucleotidenucleotide distributiondistribution (39.83%)(39.83%) werewere within the range of genome sizes and nucleotide distributions that have been reported for other alphabaculoviruses [[20].20]. A total of 130 ORFs were were annotated (Table S2). In addition, five five homologous repeat regions (hrs) [[20]20] were identifiedidentified thatthat containedcontained one-to-four copies of a 48-bp imperfect inverted repeat sequence with the consensus consensus sequence sequence 5 5′0-aACGAtCcgtcgcAgcAATTtaaaattaAATTtg-aACGAtCcgtcgcAgcAATTtaaaattaAATTtg TgCGatagatcGTt-30′ (Figure4 4).). In the the assembly, assembly, 878 878 putative putative SNPs SNPs and and small small indels indels were were identified. identified. These These polymorphisms polymorphisms were werepresent present at low at frequencies low frequencies within within the assembly, the assembly, with withonly onlyten occurring ten occurring at a atfrequency a frequency of ≥8%, of ≥ and8%, mostand most occurring occurring at frequencies at frequencies ≤6%≤ 6%(Figure (Figure S1). S1). In Incontrast, contrast, a sequence a sequence of of an an Autographa Autographa californica californica multiple nucleopolyhedrovirus isolateisolate generatedgenerated with with an an Illumina Illumina HiSeq HiSeq 2000 2000 instrument instrument identified identified a afrequency frequency cluster cluster of of 118 118 SNPs SNPs with with average average frequencies frequencies of of 33–36% 33–36% [21 [21].]. The The highest-frequency highest-frequency SNPs SNPs in inthe the OpbuNPV-MA OpbuNPV-MA assembly assembly occurred occurred at at nucleotide nucleotide positions positions 1,320 1,320 (17.44%), (17.44%), 7,4687,468 (14.63%),(14.63%), 66,442 (11.08%), 66,45366,453 (10.10%),(10.10%), and and 114,338 114,338 (12.5%). (12.5%). All All five five SNPs SNPs occur occur in in ORFs, ORFs, and and the the last last four four listed listed are arenonsynonymous nonsynonymous substitutions substitutions in ORF6 in ORF6 (exon0 (exon0), ORF80), ORF80 (helicase (helicase), and), ORF129 and ORF129 (vef ). In(vef addition,). In addition, reads readscorresponding corresponding to larger to larger (>3 bp) (>3 indels bp) indels were presentwere present in ORFs in ORFs 55 (baculovirus 55 (baculovirus repeated repeated ORF-a ORF-a, or bro-a, or) bro-aand 117) and (bro-b 117 )(bro-b at frequencies) at frequencies of approximately of approximately 6%, and 6%, in and other in locationsother locations at lower at lower frequencies. frequencies.

Viruses 2017, 9, 307 7 of 20 Viruses 2017, 9, 307 7 of 20

ORF1629

127 p49 pif-2 vef rr1 pk-1 4 124 5 hr5 ep23 efp ie-1 arif-1 odv-e27 fgf pep rr2 polh 14 exon0 odv-e56 odv-e18 dbp pif-1 chtB ac34 ac26 19 odv-e66 hr1 lef-6 118 bro-b me53 ac29 116 lef-1 p10 p74 hr4 38.7k iap-3 25 p24 112 iap-3 ubi pep ac18 lef-2 lef-11 p47 dut 109 OpbuNPV-MA adprase 32 alk-exo 33 106 119,054 bp ctl hr2 lef-12 36 105 ac43 hrf-1 Baculoviridae core genes lef-8 104 Alphabaculovirus conserved genes egt ac53 ac52 Homologues in other baculoviruses 43 102 pif-3 lef-10 42 sod No baculovirus homologs vp1054 98 48 ac55 99 dna 97 nrk-1 Homologous region (hr) chtB ligase 94 53 chaB1 ac106/107 chaB2 p13 ac57 fp25k phr ac110 nrk-1 bro-a ac108 60 odv-ec43 pif-6 lef-5 lef-9 56 vp80 p12 tlp-20 iap-3 p40 pif-4 lef-3 59 p48 desmop p18 p6.9 helicase 76 vp39 ac81 ac76 38k odv-e25 ac78 lef-4 vp91 dnapol ac75 p33 hr3 gp41 vlf-1

FigureFigure 3. 3.Map Map of of the the open open reading readingframes frames (ORFs)(ORFs) an andd other features features of of the the OpbuNPV-MA OpbuNPV-MA genome. genome. ORFsORFs are are represented represented by by arrows, arrows, with with the the positionposition and direction of of the the arrow arrow indicating indicating ORF ORF position position andand orientation. orientation. Each ORF ORF is is color-coded color-coded to toindica indicatete whether whether it corresponds it corresponds to a baculovirus to a baculovirus core coregene, gene, an ORF an ORF conserved conserved among among all alphabaculoviruses all alphabaculoviruses,, an ORF anwith ORF homologs with homologs in a subset in of a other subset ofbaculoviruses, other baculoviruses, or an ORF or anwith ORF no withbaculovi no baculovirusrus homologs. homologs. Homologous Homologous repeat regions repeat (hrs) regions are (hrrepresenteds) are represented by black by rectangles. black rectangles. ORFs are ORFs design areated designated by names by if names they are if they conserved are conserved or well- or well-characterizedcharacterized baculovirus baculovirus homologs, homologs, or a ornumber a number corresponding corresponding to itsto annotation its annotation in the in genome. the genome.

Viruses 2017, 9, 307 8 of 20 Viruses 2017, 9, 307 8 of 20

hr1_repeat_1 14393 AACGAACCATCGCACCAATTTAAAATTAAATTGCTACG----CCGGTT 14436 hr1_repeat_2 14485 AACGATCCGTCGTACAAATTTAAAATTAAATTTGTGCGATAGATCGTT 14532 hr1_repeat_3 14549 GACGATCCGTCGCAGCAATTTAAAATTAAATTTGTACGACGGATCGTT 14596 hr1_repeat_4 14624 AACGATCCGTCGCAGCAATTTAAAATTAAATTTGTGCGATAGATCGTT 14671 hr2_repeat_1 27980 AACGATCCGTCGCAGCAATTTAAAATTAAATTTGTGCGATAGATCGTT 28027 hr2_repeat_2 28037 AACGATCCGTCGCAGCAATTTAAAATTAAATTTGTACGATAGATCGTT 28084 hr2_repeat_3 28102 AACGATCCGTCGCAGCAATT------AATTTGTACGATAGATCGTT 28141 hr3_repeat_1 60091 AACGATCCAATCTAGCAATTTAAAATTAAATTGCTGCGATAGTTCGTT 60138 hr3_repeat_2 60175 AACGATCTATCGCAGCAATTTAAAATTAAATTGCTGCGATAGATCGTT 60222 hr4_repeat_1 96404 AACGATCCGTCGTACAAATTTAAATTTAAATTGCTGCGATAGATCGTT 96451 hr4_repeat_2 96486 AACGATCTATCGTACAAATTTAAAATTAAATTGGTGCGACAGATCGTT 96533 hr4_repeat_3 96539 GACGATCCAATCTAGCAATTTAAAATTAAATTTGTACGATAGATCGTT 96586 hr5_repeat_1 111089 AACGATCCGTCGTACAAATTTAAATTTAAATTGCTGCGATAGATCGTG 111136 consensus aACGAtCcgtcgcAgcAATTtaaaattaAATTtgTgCGatagatcGTt

FigureFigure 4. 4. OpbuNPV-MAOpbuNPV-MA homologoushomologous region ( hr) unit repeats. repeats. Nucleotide Nucleotide positions positions of of the the repeats repeats in inthe the genome genome sequence sequence are are indicated. indicated. Identical Identical nu nucleotidescleotides occupying occupying >50% >50% of ofaligned aligned positions positions are areshaded shaded in inblack, black, and and nucleotides nucleotides of of the the same same cl classass as conserved nucleotidesnucleotides (containing(containing eithereither aa purinepurine or or pyrimidine pyrimidine base) base) are are shaded shaded in in gray. gray. Uppercase Uppercase letters letters in in the the consensus consensus sequence sequence denote denote nucleotidesnucleotides in in the the alignment alignment with with completely completely identical identical residues, residues, and lowercase and lowercase letters denote letters positions denote inpositions the alignment in the withalignment a majority with ofa majority identical of residues. identical residues.

3.3.3.3. OpbuNPV-MAOpbuNPV-MA ORF ORF Content Content

3.3.1.3.1.1. CoreCore Genes, Genes,bro broGenes, Genes, and and Unique Unique ORFs ORFs TheThe OpbuNPV-MA OpbuNPV-MA genome genome contains contains all 38 all of the38 coreof the genes core identified genes to-dateidentified in everyto-date baculovirus in every genome,baculovirus including genome,ac110 including(pif-8) (Figure ac1103 (,pif-8 Table) (Figure S2) [ 22 ,3,23 Table]. It also S2) contains [22,23]. 25It also of the contains 26 ORFs 25 identified of the 26 byORFs Garavaglia identified et al.by [Garavaglia22] as present et al. in [22] genomes as present of alpha- in genomes and betabaculoviruses, of alpha- and betabaculoviruses, and is missing ac64 and (gp37is missing). There ac64 are (gp37 two). copies There of are the twobaculovirus copies of repeatedthe baculovirus ORF (bro repeated) multigene ORF ( familybro) multigene [24] present family in the[24] genomepresent sequence.in the genome sequence. Twenty-twoTwenty-two ORFs ORFs were were determined determined not not to to possess possess homologs homologs in in any any other other baculovirus baculovirus genome genome (Figure(Figure3 ,3, Table Table S2). S2). Among Among these these ORFs, ORFs, ORF4 ORF4 exhibited exhibited 56% 56% sequence sequence identity identity with with part part of of a a hypotheticalhypothetical protein protein from fromXenoplus Xenoplus laevis. laevis.ORF33 ORF33 encoded encoded a sequence a sequence exhibiting exhibiting 53.8% 53.8% identity identity with with an uncharacterizedan uncharacterized ORF identifiedORF identified in the winterin the mothwinter genome moth (accessiongenome (accession No. KOB64482) No. KOB64482) [25], suggesting [25], ansuggesting exchange an of exchange genetic materialof genetic between material virus between and virus host and during hosttheir during co-evolution. their co-evolution. Queries Queries with HHpredwith HHpred using using the encoded the encoded amino amino acid sequencesacid sequences indicated indicated the presencethe presence of zinc of zinc finger finger domains domains in ORF59in ORF59 and and ORF60. ORF60. The The remaining remaining nineteen nineteen unique unique ORFs ORFs did did not not exhibit exhibit sequence sequence similarity similarity with with otherother sequences sequences in in queries queries with with BLASTp BLASTp and and HHpred. HHpred.

3.3.2.3.1.2. Inhibitor-Of-ApoptosisInhibitor-Of-Apoptosis Protein Protein ( iap(iap)) Genes Genes ThreeThree ORFs—ORF24, ORFs—ORF24, ORF26, ORF26, and and ORF61—were ORF61—were found found to to encode encode inhibitor-of-apoptosis inhibitor-of-apoptosis protein protein (IAP)(IAP) homologs homologs [ 26[26].]. BLASTp BLASTp results results suggested suggested that that all all three three of of these these ORFs ORFs encode encode homologs homologs of of the the iap-3iap-3lineage. lineage. ThisThis featurefeature isis unusual, unusual, as as alphabaculoviruses alphabaculoviruses generallygenerally containcontain onlyonly oneoneiap iapgene gene ofof anyany given given lineage, lineage, and and often often possess possess homologs homologs of ofiap-1 iap-1and andiap-2 iap-2[ 26[26].]. While While all all three three IAP IAP homologs homologs containcontain two two copies copies of of the theBaculovirus Baculovirus Inhibitor Inhibitor of apoptosisof apoptosis protein protein Repeat Repeat(BIR) (BIR) domain, domain, only only ORFs ORFs 24 and 24 61and contain 61 contain the C-terminal the C-terminal RING RING finger finger domain domain common common to IAPs. to ORF26IAPs. ORF26 encodes encodes a relatively a relatively short IAPshort sequence IAP sequence (159 amino (159 acids),amino andacids), it appears and it appears that a sequence that a sequence at the C-terminus at the C-terminus that would that encode would a RINGencode finger a RING is missing. finger is missing. PhylogeneticPhylogenetic inference inference with with selected selected baculovirus baculovirus IAP-1, IAP-1, baculovirus baculovirus IAP-3, IAP-3, betabaculovirus betabaculovirus IAP-5, entomopoxvirusIAP-5, entomopoxvirus IAP, and IAP, insect and IAP insect sequences IAP sequ didences not did place not anyplace of any the of three the three OpbuNPV-MA OpbuNPV-MA IAP sequencesIAP sequences with anywith of any the of IAP-1, the IAP-1, IAP-5, IAP-5, group group II alphabaculovirus II alphabaculovirus IAP-3, entomopoxvirus,IAP-3, entomopoxvirus, or insect or IAPinsect clades IAP in clades the ML in phylogramthe ML phylogram (Figure5). ORF24(Figure was5). groupedORF24 was with grouped the IAP-3 with of Dendrolimusthe IAP-3 of kikuchiiDendrolimus nucleopolyhedrovirus kikuchii nucleopolyhedrovirus (DekiNPV-YN; GenBank(DekiNPV-YN; accession GenBank No. JX193905) accession in bothNo. MEJX193905) and ML in both ME and ML phylograms, although bootstrap support >50% for this placement only occurred in

Viruses 2017, 9, 307 9 of 20 Viruses 2017, 9, 307 9 of 20 phylograms,the ML phylogram. although ORFs bootstrap 26 and support 61 occurred >50% in for different this placement parts of only the occurredME and ML in the phylograms ML phylogram. with ORFsbootstrap 26 and support 61 occurred <50%. in different parts of the ME and ML phylograms with bootstrap support <50%.

60/57 Lepidoptera (11) CpGV-M1 IAP-3 EpapGV-Oliveros.Santa Fe IAP-3 57/ 65 BusuNPV-Hubei IAP-3 Alphabaculovirus group I IAP-3 (11) -/52 ChocGV IAP-3 DisaGV-Parana-2009 IAP-3 UrprNPV-Southern Brazil IAP-3 OpbuNPV-MA ORF26 CBEV IAP3 99/100 CREV IAP-3 CrleGV-CV3 IAP-3 LafiNPV-GR15 IAP-3 AdorGV-England IAP-3 LeseNPV-AH1 IAP AdorNPV-England IAP-3 AgseGV-DA IAP-1 AMEV IAP -/58 MSEV-Tucson IAP-3 Alphabaculovirus 99/100 ChchNPV IAP-3 Betabaculovirus TnSNPV-Canada IAP Entomopoxvirinae 98/100 ClasGV-B IAP-3 Insecta ErelGV-S68 IAP-3 98/100 SeMNPV-US IAP-3 SpltNPV-II IAP-3 71/87 SfMNPV-3AP2 IAP-3 -/76 AgseNPV-A IAP-3 98/99 AgipMNPV-Illinois IAP-3 100/100 AgseNPV-B IAP-3 -/80 DekiNPV-YN IAP-3 OpbuNPV-MA ORF24 MacoNPV-A 90/2 IAP-3 100/100 -/56 MacoNPV-B IAP-3 88/100 Diptera (3)

-/85 Isoptera, Hymenoptera, Hemiptera, Coleoptera (7) PiGV-Cambridge ORF81 -/92 HearNPV-G4 IAP-3 69/84 Betabaculovirus IAP-1 (4) 68/ 68 99/100 Alphabaculovirus IAP-1 (9) OpbuNPV-MA ORF61

99/100 Betabaculovirus IAP-5 (14) PiGV-Cambridge IAP-5

0.5

FigureFigure 5. 5.Phylogenetic Phylogenetic inferenceinference fromfrom alignedaligned viral and insect inhibitor-of-apoptosis protein protein (IAP) (IAP) homologs.homologs. MaximumMaximum likelihoodlikelihood (ML) phylogram in inferredferred from from the the alignmen alignmentt of of IAP IAP amino amino acid acid sequencessequences is is shown shownwith with bootstrapbootstrap valuesvalues (>50%)(>50%) at interior branches for for minimum minimum evolution evolution (ME) (ME) andand ML ML analysis analysis (ME/ML) (ME/ML) wherewhere they occur. The sequence for Arabadopsis thaliana thaliana IAP-likeIAP-like protein protein (GenBank(GenBank accession accession no.no. NP_173164)NP_173164) waswas usedused as anan outgroup.outgroup. The The classificati classificationon of of each each taxon taxon is is indicatedindicated with with a a color-coded color-coded texttext background.background. BranchesBranches for IAPs from various various insect insect orders orders and and for for alphabaculovirusalphabaculovirus IAP-1, IAP-1, betabaculovirus betabaculovirus IAP-1,IAP-1, betabaculovirusbetabaculovirus IAP-5,IAP-5, and group group I I alphabaculovirus alphabaculovirus IAP-3IAP-3 sequencessequences areare collapsed,collapsed, andand thethe numbersnumbers of taxa in each of these nodes nodes are are indicated indicated in in parentheses.parentheses. OpbuNPV OpbuNPV sequencessequences areare indicatedindicated with red arrows. The virus and and insect insect taxa taxa and and their their accessionaccession numbers numbers are are as as listed listed inin TableTable S1. S1.

Viruses 2017, 9, 307 10 of 20

Viruses 2017, 9, 307 10 of 20 hrf-1 3.3.3.3.1.3. DNA DNA Ligase Ligase III III and and Host Host Range Range Factor-1Factor-1 ((hrf-1) OpbuNPV-MAOpbuNPV-MA ORF37 ORF37 and and ORF47 ORF47 were were found found to encode to encode host rangehost range factor-1 factor-1 (hrf-1 )( andhrf-1 a) homologand a of DNAhomolog ligase of DNA III, respectively. ligase III, respectively. Both of these Both genes of thes weree genes originally were originally identified id inentified the genome in the genome sequence ofsequence LdMNPV of isolate LdMNPV 5/6 [27 ].isolate The LdMNPV5/6 [27]. hrf-1Thegene LdMNPV allows heterologoushrf-1 gene allows alphabaculoviruses heterologous to replicatealphabaculoviruses in the L. dispar to replicateLd652Y in cell the lineL. dispar [28,29 Ld652Y]. The cell LdMNPV line [28,29]. DNA The ligase LdMNPV III gene DNA product ligase III has beengene shown product to ligatehas been nicks shown in a to double-stranded ligate nicks in a do DNAuble-stranded substrate, DNA suggesting substrat thate, suggesting it may play that a roleit inmay viral play DNA a role replication in viral DNA or repair replication [30]. Homologsor repair [30]. of hrf-1Homologshave of only hrf-1 been have identified only been in identified LdMNPV, Dasychirain LdMNPV, pudibunda Dasychira nucleopolyhedrovirus pudibunda nucleopolyhedrovirus (DapuNPV) [31], and(DapuNPV) Orgyia pseudotsugata [31], and Orgyia multiple nucleopolyhedroviruspseudotsugata multiple (OpMNPV) nucleopolyhedrovirus [32], while (OpMNPV) baculovirus [32], homologs while baculovirus of DNA ligasehomologs III haveof DNA been foundligase only III have in LdMNPV, been found Lymantria only in LdMNPV, xylina nucleopolyhedrovirus Lymantria xylina nucleopoly (LyxyMNPV-5)hedrovirus [33 (LyxyMNPV-], Sucra jujuba nucleopolyhedrovirus5) [33], Sucra jujuba (SujuNPV) nucleopolyhedrovirus [34], and Orgyia leucostigma(SujuNPV) nucleopolyhedrovirus[34], and Orgyia (OrleNPV)leucostigma [35 ]. nucleopolyhedrovirusWhile the LdMNPV (OrleNPV) and LyxyMNPV-5 [35]. DNA ligase sequences share significant sequence identity, BLASTpWhile queries the withLdMNPV any ofand the LyxyMNPV-5 other baculovirus DNA ligas DNAe ligasesequences III sequencesshare significant returned sequence matches withidentity, insect BLASTp DNA ligases queries and with not any baculovirus of the other homologs, baculovirus suggesting DNA ligase that baculovirusIII sequences DNA returned ligase matches with insect DNA ligases and not baculovirus homologs, suggesting that baculovirus DNA III homologs are not closely related to each other and may have been independently acquired by their ligase III homologs are not closely related to each other and may have been independently acquired respective viruses. by their respective viruses. 3.3.4. chaB (ac58/59 and ac60) Genes 3.1.4. chaB (ac58/59 and ac60) Genes Alphabaculoviruses and some betabaculoviruses contain homologs of the bacterial ion transport Alphabaculoviruses and some betabaculoviruses contain homologs of the bacterial ion transport regulator gene chaB [36,37]. These homologs often occur as an adjacent pair of ORFs that correspond regulator gene chaB [36,37]. These homologs often occur as an adjacent pair of ORFs that correspond to AcMNPV ORFs ac58/59 (chaB1) and ac60 (chaB2). The OpbuNPV-MA genome sequence also to AcMNPV ORFs ac58/59 (chaB1) and ac60 (chaB2). The OpbuNPV-MA genome sequence also contains two adjacent chaB homologs encoded by ORF49 and ORF50, but a BLASTp search with contains two adjacent chaB homologs encoded by ORF49 and ORF50, but a BLASTp search with ORF49ORF49 yielded yielded matches matches that that consisted consisted mostlymostly of bacterial chaBchaB genegene products products with with few few matches matches to to baculovirusbaculoviruschaB chaBsequences. sequences. In MEIn andME MLand phylograms,ML phylograms, separate separate clusters clusters were formed were formed that contained that thecontained betabaculovirus the betabaculoviruschaB homologs, chaB the homologs, alphabaculovirus the alphabaculovirusac58/59 homologs, ac58/59 the alphabaculovirushomologs, the ac60alphabaculovirushomologs, and ac60 the homologs, bacterial chaB and thegenes bacterial (Figure chaB6). genes ORF49 (Figure was positioned6). ORF49 was as apositioned sister taxon as a to thesister bacterial taxonchaB to theclade bacterial in the chaB ML clade phylogram, in the ML and phylogram, was placed and within was theplaced bacterial within clade the bacterial in the ME phylogram,clade in the but ME neither phylogram, arrangement but neither enjoyed arrangement >50% bootstrap enjoyed > support.50% bootstrap ORF50 support. was placed ORF50 with was the ac58/59placedsequences with the ac58/59 in a basal sequences position. in a basal position.

Alphabaculovirus group II ChaB2 (Ac60) (20) LeseNPV-AH1 ORF71 -/86 SpliNPV-AN1956 ORF49 SpltNPV-G2 ORF53 Betabaculovirus (5) HearNPV-G4 ORF52 OpbuNPV-MA ORF49 Bacterial ChaB (14) OpbuNPV-MA ORF50 75/53 Alphabaculovirus group II 61/93 ChaB1 (Ac58/59) (23)

0.2

FigureFigure 6. 6.Phylogenetic Phylogenetic inference inference from from alignedaligned viral and and bacterial bacterial cation cation transporter transporter (ChaB) (ChaB) homologs. homologs. An ML phylogram inferred from the alignment of ChaB amino acid sequences is shown with An ML phylogram inferred from the alignment of ChaB amino acid sequences is shown with bootstrap bootstrap values (>50%) at interior branches for ME and ML analysis (ME/ML) where they occur. values (>50%) at interior branches for ME and ML analysis (ME/ML) where they occur. Branches Branches for ChaB sequences encoded by bacteria, betabaculoviruses, alphabaculovirus chaB1 for ChaB sequences encoded by bacteria, betabaculoviruses, alphabaculovirus chaB1 (ac58/59) genes, (ac58/59) genes, and alphabaculovirus chaB2 (ac60) genes have been collapsed, and the numbers of and alphabaculovirus chaB2 (ac60) genes have been collapsed, and the numbers of taxa in each of these taxa in each of these nodes are indicated in parentheses. OpbuNPV sequences are indicated with red nodes are indicated in parentheses. OpbuNPV sequences are indicated with red arrows. The virus and arrows. The virus and bacterial taxa and their accession numbers are as listed in Table S1. bacterial taxa and their accession numbers are as listed in Table S1. Viruses 2017, 9, 307 11 of 20

3.3.5. Two ORFs with Sequence Similarity to Nicotinamide Riboside Kinase 1 (nrk1) BLASTp queries with OpbuNPV-MA ORF95 returned several matches with group II alphabaculovirus NRK1 sequences, suggesting that this ORF encodes a baculovirus nicotinamide riboside kinase 1 homolog. Although ORF58 also exhibits sequence similarity with baculovirus NRK1 sequences by BLAST, the top BLASTp matches for ORF58 are betabaculovirus sequences. There is no significant sequence similarity between the ORF58 and ORF95 amino acid sequences. Other alphabaculovirus nrk1 ORFs encode polypeptides that are approximately 360 amino acids, while the sequence encoded by ORF95 is only 159 amino acids. The ORF95 sequence aligns with the C-terminal end of other baculovirus NRK1 sequences—a region which contains a sequence matching a number of different phosphatase domains. In contrast, ORF58 appears to be a full-length homolog of the nrk1-like ORFs found in betabaculovirus genomes. Cellular NRK1 is involved in the biosynthesis of nicotinamide adenine dinucleotide (NAD+) [38,39], but the function of the baculovirus NRK1 homologs is unclear.

3.3.6. DNA Photolyase (phr) ORF92 of the OpbuNPV-MA genome encodes a protein with significant sequence similarity to DNA photolyases from a variety of insect sources and a DNA photolyase homolog from Spodoptera frugiperda granulovirus (SpfrGV-VG008) [40]. A small number of photolyase sequences have been identified from alpha- and betabaculoviruses [34,41–43], but only one of these homologs—PHR2 from Chrysodeixis chalcites nucleopolyhedrovirus (ChchNPV)—has been demonstrated to be capable of catalyzing the repair of UV-induced cyclobutane pyrimidine dimers [44]. Phylograms inferred from an alignment of baculovirus and insect photolyase amino acid sequences support previous findings that photolyase sequences from plusiine baculoviruses occur as a monophyletic group [45], but baculovirus sequences as a whole did not form a monophyletic group in this analysis (Figure7). The OpbuNPV-MA photolyase sequence grouped with sequences from Spodoptera sp. betabaculoviruses in both ME and ML phylograms, but bootstrap support for this position was <50%.

3.3.7. Ribonucleotide Reductase Large Subunit (rr1), Small Subunit (rr2), and dUTPase (dut) Ribonucleotide reductase and dUTPase are cellular enzymes involved in the biosynthesis of deoxynucleotides [46,47]. Large DNA viruses often encode homologs of these enzymes [48,49]. To date, ORFs encoding homologs of dUTPase (dut) and the large and small subunits of ribonucleotide reductase (rr1 and rr2, respectively) have been identified in isolates of 23 alphabaculovirus species and 8 betabaculovirus species. Most of these viruses encode homologs for both the ribonucleotide reductase subunits and the dUTPase, while some encode either the ribonucleotide reductase subunits or the dUTPase. ORFs encoding all three homologs—rr1, rr2, and dut—were found in the OpbuNPV-MA sequence. BLASTp queries with the OpbuNPV-MA dUTPase sequence encoded by ORF108 did not return any matches with other baculovirus dUTPase homologs. The lack of significant sequence similarity with other baculovirus dut ORFs has been observed with other baculovirus dut genes [50]. Prior phylogenetic analyses of baculovirus DUT sequences have indicated that the dut genes in baculoviruses are the consequence of multiple gene acquisition events [51,52], and it is possible that the OpbuNPV-MA dut sequence also derives from an independent instance of horizontal gene transfer. The amino acid sequence encoded by OpbuNPV-MA rr1 (ORF130) also returned no matches with baculovirus rr1 homologs when used in a BLASTp search. Only a single baculovirus rr2 gene (LdMNPV-BNP rr2b) occurred among the matches found with a search using OpbuNPV-MA rr2 (ORF122). For both OpbuNPV-MA subunit ORFs, the matches consisted of sequences from a variety of viral and cellular sources. Viruses 2017, 9, 307 11 of 20

3.1.5. Two ORFs with Sequence Similarity to Nicotinamide Riboside Kinase 1 (nrk1) BLASTp queries with OpbuNPV-MA ORF95 returned several matches with group II alphabaculovirus NRK1 sequences, suggesting that this ORF encodes a baculovirus nicotinamide riboside kinase 1 homolog. Although ORF58 also exhibits sequence similarity with baculovirus NRK1 sequences by BLAST, the top BLASTp matches for ORF58 are betabaculovirus sequences. There is no significant sequence similarity between the ORF58 and ORF95 amino acid sequences. Other alphabaculovirus nrk1 ORFs encode polypeptides that are approximately 360 amino acids, while the sequence encoded by ORF95 is only 159 amino acids. The ORF95 sequence aligns with the C-terminal end of other baculovirus NRK1 sequences—a region which contains a sequence matching a number of different phosphatase domains. In contrast, ORF58 appears to be a full-length homolog of the nrk1-like ORFs found in betabaculovirus genomes. Cellular NRK1 is involved in the biosynthesis of nicotinamide adenine dinucleotide (NAD+) [38,39], but the function of the baculovirus NRK1 homologs is unclear.

3.1.6. DNA Photolyase (phr) ORF92 of the OpbuNPV-MA genome encodes a protein with significant sequence similarity to DNA photolyases from a variety of insect sources and a DNA photolyase homolog from Spodoptera frugiperda granulovirus (SpfrGV-VG008) [40]. A small number of photolyase sequences have been identified from alpha- and betabaculoviruses [34,41–43], but only one of these homologs—PHR2 from Chrysodeixis chalcites nucleopolyhedrovirus (ChchNPV)—has been demonstrated to be capable of catalyzing the repair of UV-induced cyclobutane pyrimidine dimers [44]. Phylograms inferred from an alignment of baculovirus and insect photolyase amino acid sequences support previous findings that photolyase sequences from plusiine baculoviruses occur as a monophyletic group [45], but baculovirus sequences as a whole did not form a monophyletic group in this analysis (Figure 7). The OpbuNPV-MA photolyase sequence grouped with sequences from Spodoptera sp. betabaculoviruses in both MEViruses and 2017ML, 9 ,phylogra 307 ms, but bootstrap support for this position was <50%. 12 of 20

99/99 Diptera (3) Alphabaculovirus Bemisia tabaci DNA photolyase Betabaculovirus -/86 Entomopoxvirinae Limulus polyphemus DNA photolyase Apis mellifera DNA photolyase Insecta -/99 90/94 MSEV-Tucson DNA photolyase -/82 Lepidoptera (5) 99/100 OpbuNPV-MA ORF92 SpfrGV-VG008 DNA photolyase 96/99 SpltGV-K1 DNA photolyase LdMNPV-BNP DNA photolyase ChchNPV DNA photolyase PHR2 PsinSNPV IE DNA photolyase 83/- Plusiine group II alphabaculoviruses 100/100 ChchNPV DNA photolyase PHR1 97/86 TnSNPV-Candada DNA photolyase SujuNPV-473 DNA photolyase

0.1

Figure 7. Phylogenetic inference from aligned viral and insect DNA photolyase homologs. An ML Figure 7. Phylogeneticphylogram inferred inference from the from alignment aligned of DNA viral photolyase and insect amino DNA acid sequences photolyase is shown homologs. with An ML phylogram bootstrapinferred values from (>50%) the alignment at interior branches of DNA for ME ph andotolyase ML analysis amino (ME/ML) acid wheresequences they occur. is shown with bootstrap valuesThe sequence (>50%) for atBacillus interior cereus branchesATCC 14579 for DNA ME photolyaseand ML analysis (GenBank accession(ME/ML) No. where AAP10079) they occur. The was included as an outgroup. The classification of each taxon is indicated with a color-coded text sequence forbackground. Bacillus cereus Branches ATCC for DNA 14579 photolyases DNA fromphotolyase the insect (GenBank orders Diptera accession and Lepidoptera No. AAP10079) are was included ascollapsed, an outgroup. and the numbers The ofclassification taxa in each of theseof each nodes aretaxon indicated is indicated in parentheses. with The OpbuNPVa color-coded text background.sequence Branches is indicated for DNA with a redphotolyases arrow, and sequences from the from insect alphabaculoviruses orders Diptera of the lepidopteranand Lepidoptera are subfamily Plusiinae are indicated with a bracket. The virus and insect taxa and their accession numbers collapsed, andare as the listed numbers in Table S1.of taxa in each of these nodes are indicated in parentheses. The OpbuNPV sequence is indicated with a red arrow, and sequences from alphabaculoviruses of the lepidopteran subfamily PlusiinaeIn phylograms are ofindicated ORF130 (RR1)with and a bracket. other selected The RR1virus sequences, and insect the taxataxa occurred and their in one accession numbersgroup are consistingas listed ofin nudivirus,Table S1. alphabaculovirus, and betabaculovirus sequences, and a second group consisting of OpbuNPV-MA ORF130, a clade containing most of the alphabaculovirus RR1 sequences in the tree, and a collection of alphabaculovirus, hytrosavirus, insect, and cnidiarians (Figure8). OpbuNPV-MA ORF130 occupied a basal position relative to all the other sequences in the second group in both the ME and ML phylograms, although bootstrap support for this position was >50% only in the ML phylogram. Phylogenetic inference with ORF122 (RR2) and other selected RR2 sequences produced trees with a topology that was strikingly similar to the RR1 tree (Figure9). The RR2 ME and ML phylograms also consisted of a group with nudivirus, alphabaculovirus, and betabaculovirus sequences and a group consisting of a clade containing most of the alphabaculovirus sequences and a collection of RR2 sequences from cellular and other viral sources. The OpbuNPV-MA RR2 sequence was placed in the same basal position in the second group occupied by OpbuNPV-MA RR1 in the RR1 phylograms, with bootstrap support >50% for both trees. In both the RR1 and RR2 trees, the sequences from LdMNPV-5/6, DapuNPV-ML1, and OpMNPV were grouped with the betabaculovirus and nudivirus sequences, while other alphabaculovirus sequences (including the second LdMNPV-5/6 RR2 sequence, RR2B) occurred in the second group. Viruses 2017, 9, 307 13 of 20 Viruses 2017, 9, 307 13 of 20

82/100 Coleoptera (4 taxa) Zootermopsis nevadensis RR1 Bemisia tabaci RR1 Insecta Pediculus humanus corporis RR1 Alphabaculovirus -/62 Hemiptera (2 taxa) Betabaculovirus 63/98 Nudiviridae -/60 99/ Diptera (2 taxa) -/ 100 Hytrosaviridae 68 Lepidoptera (5 taxa) 69/59 97/100 69/91 Cnidaria (2 taxa) -/96 SpliNPV-AN1956 RR1 100 SpltNPV-G2 RR1 /100 MdSGHV RR1 -/72 Alphabaculovirus group II (18 taxa) OpbuNPV-MA ORF130 Nilaparvata lugens 100/100 endogenous nudivirus RR1 93/99 OrNV-Ma07 RR1 GbNV RR1 100/100 CpGV-M1 RR1 93/83 DisaGV-Parana-2009 RR1 100/99 PhopGV-T RR1 PiGV-Cambridge RR1 AgseGV-DA RR1 0.5 91/98 EpapGV-Oliveros.Santa Fe RR1 74/100 LdMNPV-5/6 RR1 -/100 DapuNPV-ML1 RR1 -/100 OpMNPV RR1

FigureFigure 8. Phylogenetic8. Phylogenetic inference inference from from aligned aligned viral viral and cellularand cellular ribonucleotide ribonucleotide reductase reductase large subunitlarge (RR1)subunit homologs. (RR1) homologs. An ML phylogram An ML phylogram inferred frominferred the from alignment the alignment of RR1 amino of RR1 acid amino sequences acid sequences is shown withis shown bootstrap with values bootstrap (>50%) values at interior (>50%) branchesat interior for branches ME and for ML ME analysis and ML (ME/ML) analysis (ME/ML) where they where occur. Thethey sequence occur. The for Bacillussequence thuringiensis for Bacillus thuringiensisIBL200 RR1 IBL200 (GenBank RR1 accession (GenBank no. accession EEM97377) no. EEM97377) was included was as anincluded outgroup. as The an classificationoutgroup. The of classification each taxon is of indicated each taxon with is a color-codedindicated with text a background,color-coded excepttext forbackground, unique taxa except of phylum for unique Cnidaria taxa and of thephylumNilaparvata Cnidaria lugens and endogenousthe Nilaparvata nudivirus lugens endogenous (which is not nudivirus (which is not actually classified as a nudivirus). Branches for RR1 sequences from phylum actually classified as a nudivirus). Branches for RR1 sequences from phylum Cnidaria; the insect orders Cnidaria; the insect orders Coleoptera, Diptera, Hemiptera, and Lepidoptera, and group II Coleoptera, Diptera, Hemiptera, and Lepidoptera, and group II alphabaculoviruses are collapsed, and alphabaculoviruses are collapsed, and the numbers of taxa in each of these nodes are indicated in the numbers of taxa in each of these nodes are indicated in parentheses. The OpbuNPV sequence is parentheses. The OpbuNPV sequence is indicated with a red arrow. The sequences in this tree and indicated with a red arrow. The sequences in this tree and their accession numbers are as listed in their accession numbers are as listed in Table S1. Table S1.

Viruses 2017, 9, 307 14 of 20 Viruses 2017, 9, 307 14 of 20

Bemisia tabaci RR2 Orchesella cincta RR2 Rhodnius prolixus RR2 Halyomorpha halys RR2 Zootermopsis nevadensis RR2 Pediculus humanus corporis RR2 Insecta Nyssomyia neivai RR2 Alphabaculovirus Betabaculovirus -/ Coleoptera (3 taxa) 100 Nudiviridae -/ Diptera (2 taxa) 68 MdSGHV RR2 Hytrosaviridae LdMNPV RR2B Ascoviridae -/ Lepidoptera (5 taxa) 89 -/56 TnAV-2c RR2 SpltNPV-G2 RR2 -/ 100 SpliNPV-AN1956 RR2 71/ Entomopoxvirinae (3 taxa) 93 -/ Fungi (3 taxa) -/69 89 -/ Bacteria (2 taxa) 86 -/59 Nosema ceranae RR2 79/91 69/96 Alphabaculovirus group II (17 taxa) OpbuNPV-MA ORF122 GbNV RR2 -/61 Nilaparvata lugens endogenous nudivirus RR2 98/99 OrNV-Ma07 RR2 52/- CpGV-M1 RR2 -/72 -/79 DisaGV-Parana-2009 RR2 PhopGV-T RR2 -/100 PiGV-Cambridge RR2 1 AgseGV-DA RR2

-/82 EpapGV-Oliveros.Santa Fe RR2 -/99 LdMNPV-5/6 RR2A -/99 DapuNPV-ML1 RR2 -/99 OpMNPV RR2

FigureFigure 9. 9. Phylogenetic inference inference from from aligned aligned viral viral and cellularand cellular ribonucleotide ribonucleotide reductase reductase small subunit small subunit(RR2) homologs. (RR2) homologs. An ML An phylogram ML phylogram inferred inferred from thefrom alignment the alignment of RR1 of RR1 amino amino acid acid sequences sequences is isshown shown with with bootstrap bootstrap values values (>50%) (>50%) at at interior interior branches branches for for ME ME and and ML ML analysis analysis (ME/ML) (ME/ML) where where theythey occur. occur. The The sequence sequence for for BacillusBacillus thuringiensis thuringiensis IBL200IBL200 RR2 RR2 (GenBank (GenBank accession accession no. no. EEM97378) EEM97378) was includedwas included as an as outgroup. an outgroup. The Theclassification classification of ofeach each taxon taxon is is indicated indicated with aa color-codedcolor-coded text text background,background, except except for for unique unique taxa taxa of ofsubfamily subfamily EntomopoxvirinaeEntomopoxvirinae, kingdoms, kingdoms Fungi Fungi and and Bacteria, Bacteria, and theand Nilaparvata the Nilaparvata lugens lugensendogenousendogenous nudivirus nudivirus (which (which is not actually is not actually classified classified as a nudivirus). as a nudivirus). Branches forBranches RR1 sequences for RR1 sequencesfrom the entomopo from thexviruses, entomopoxviruses, the fungi, the bacteria fungi, the, the bacteria, insect orders the insect Coleoptera, orders Diptera,Coleoptera, and Diptera,Lepidoptera, and Lepidoptera, and group II and alphabaculov group II alphabaculovirusesiruses are collapsed, are collapsed, and the numbers and the numbers of taxa in eachof taxa of inthese each nodes of these are nodes indicated are indicated in parentheses. in parentheses. The OpbuNPV The OpbuNPV sequence sequence is indicated is indicated with with a red a arrow.red arrow. The sequences The sequences in this in thistree treeand and their their accession accession numbers numbers are are as aslisted listed in inTable Table S1. S1.

3.4.3.4. Relationship Relationship of of OpbuNP OpbuNPV-MAV-MA to Other Baculoviruses TheThe OpbuNPV-MA OpbuNPV-MA polyhedrin polyhedrin ( polh) nucleotidenucleotide sequencesequence fromfrom the the genome genome shared shared 99.2% 99.2% and and 99.0%99.0% with with the the partial partial polh sequences ofof OpbuNPV-MA1OpbuNPV-MA1 (GenBank (GenBank accession accession No. No. HQ663848) HQ663848) and and OpbuNPV-UK1OpbuNPV-UK1 (HQ663847) previouslypreviously generated generated by by Burand Burand et al.et [al.8]. [8]. Additionally, Additionally, the OpbuNPV-MA the OpbuNPV- MAp74 p74sequence sequence from from the genomethe genome shared shared 100% 100% sequence sequence identity identity with with the OpbuNPV-MA the OpbuNPV-MA partial partialp74 p74sequence sequence generated generated by by Broadley Broadley et al.et al. [9]. [9]. These Thes resultse results indicate indicate that that the the OpbuNPV OpbuNPV preparations preparations fromfrom Massachusetts Massachusetts winter winter moth moth populations andand anan OpbuNPVOpbuNPV geographicgeographic isolate isolate from from the the United United KingdomKingdom are are variants variants of of the the same virus sequencedsequenced ininthis this study. study. AA previous previous analysis analysis of of the relationships ofof OpbuNPV-MAOpbuNPV-MA with with other other baculoviruses, baculoviruses, based based on on phylogeneticphylogenetic inference inference from from nucleotide alignments ofof thethe polyhedrinpolyhedrin( polh(polh)) and andp74 p74genes, genes, placed placed OpbuNPV-MAOpbuNPV-MA among among group group II alphabaculoviruses [[9].9]. TheThe absenceabsence ofof aa gene gene encoding encoding the the GP64 GP64 buddedbudded virus virus envelope envelope pr proteinotein also denotes OpbuNPV-MA asas a a group group II II alphabaculovirus. alphabaculovirus. The The top top matchesmatches from from BLASTp BLASTp queries queries with with OpbuNPV-MA ORFsORFs encodingencoding baculovirus baculovirus homologs homologs consisted consisted mostly of a wide variety of group II alphabaculoviruses, but did not indicate a particularly close mostly of a wide variety of group II alphabaculoviruses, but did not indicate a particularly close relationship with any specific virus. The sequence identities between 97 conserved baculovirus homologs in OpbuNPV-MA (excluding BRO and P6.9 sequences) and their top matches by BLASTp

Viruses 2017, 9, 307 15 of 20 relationship with any specific virus. The sequence identities between 97 conserved baculovirus homologsViruses 2017 in OpbuNPV-MA, 9, 307 (excluding BRO and P6.9 sequences) and their top matches by BLASTp15 of 20 ranged from 24.6% (LEF-3) to 82.9% (polyhedrin), with a median sequence identity of 44.5%. ranged from 24.6% (LEF-3) to 82.9% (polyhedrin), with a median sequence identity of 44.5%. The The pairwise sequence identities for 37 core gene homologs in OpbuNPV-MA (excluding P6.9) ranged pairwise sequence identities for 37 core gene homologs in OpbuNPV-MA (excluding P6.9) ranged from 31.9% (DNA helicase) to 74.1% (LEF-9), with a median sequence identity of 50.5%. from 31.9% (DNA helicase) to 74.1% (LEF-9), with a median sequence identity of 50.5%. PhylogeneticPhylogenetic inference inference from from the concatenatedthe concatenated alignments alignments of the of 38 the core 38 gene core amino gene acidamino sequences acid placedsequences OpbuNPV-MA placed OpbuNPV-MA in a clade with in other a clade alphabaculoviruses, with other alphabaculoviruses, but in a basal but position in a basal relative position to the grouprelative II alphabaculoviruses to the group II alphabaculoviruses (Figure 10). This placement(Figure 10). wasThis strongly placement supported was strongly in both supported ME and in ML phylograms.both ME and The ML separation phylograms. of group The separation I and group of grou II alphabaculovirusesp I and group II alphabaculoviruses into distinct monophyleticinto distinct cladesmonophyletic was also confirmed clades was by also this confirmed analysis. by this analysis.

100/100 Alphabaculovirusgroup I

100/100 TnSNPV-Canada ChchNPV -/63 PsinNPV-IE 100/ MacoNPV-A 90/2 100 100/100 MacoNPV-B 100/ 100 MabrNPV-K1 -/100 100/ SfMNPV-3AP2 100 100/100 SeMNPV-US1 100/100100/ SpltNPV-II 100 100/100AgipMNPV-Illinois AgseNPV-B 97/68 100/100 AgseNPV-A PespNPV-GR_167 100/100 BusuNPV-Hubei 100/ SujuNPV-473 100 -/84 Alphabaculovirusgroup II 82/100 OrleNPV-CFS-77 100/100 100/ EupsNPV-Hangzhou 100 HespNPV 100/ -/71 100 EcobNPV-A1 ApciNPV

100/ LafiNPV-GR15 100 100/100 LdMNPV 5/6

100/100 LyxyNPV-5 -/96 PeluSNPV-B 100/ ClbiNPV-DZ1 100 AdhoNPV-ADN001 68/99 100/100 UrprNPV-Southern Brazil HearNPV-G4 LeseNPV-AH1 100/100 SpliNPV-AN1956 100/100 SpltNPV-G2 OpbuNPV-MA

100/100 Betabaculovirus 0.5

Figure 10. Relationships of OpbuNPV-MA and representative isolates of other baculovirus species, Figure 10. Relationships of OpbuNPV-MA and representative isolates of other baculovirus species, inferred from the predicted amino acid sequences of baculovirus core genes. The ML phylogram was inferred from the predicted amino acid sequences of baculovirus core genes. The ML phylogram was constructed from the concatenated alignments of 38 baculovirus core gene amino acid sequences constructed from the concatenated alignments of 38 baculovirus core gene amino acid sequences using using the ME method. Shown is a subtree of a tree that also included viruses of the genera the ME method. Shown is a subtree of a tree that also included viruses of the genera Gammabaculovirus Gammabaculovirus and Deltabaculovirus. Branches for betabaculoviruses and the group I and Deltabaculovirus. Branches for betabaculoviruses and the group I alphabaculoviruses are collapsed, alphabaculoviruses are collapsed, and the numbers of taxa in those nodes are shown in parentheses. andGroup the numbers II alphabaculoviruses of taxa in those are nodes indicated are with shown brackets. in parentheses. Bootstrap values Group >50% II alphabaculoviruses for both ME and ML are indicatedanalysis with are brackets.indicated for Bootstrap each interior values branch >50% (ME/ML). for both OpbuNPV-MA ME and ML analysis is indicated are with indicated a red arrow, for each interiorred branch, branch and (ME/ML). red box OpbuNPV-MAsurrounding the istaxon. indicated The taxa with and a sequences red arrow, used red in branch, the analysis and are red as box surroundinglisted in Table the taxon. S1. The taxa and sequences used in the analysis are as listed in Table S1.

Viruses 2017, 9, 307 16 of 20

4. Discussion Two cypoviruses—Operophtera brumata cypovirus 18 (OpbuCPV18) and Operophtera brumata cypovirus 19 (OpbuCPV19)—were discovered along with a non-occluded reovirus present in both O. brumata larvae and an associated parasitoid in winter moth populations in the Orkney Isles north of Scotland and characterized by Graham and coworkers [18,19]. OpbuCPV and OpbuNPV were detected in the same larval cadavers, with a frequency of co-occurrence that varied among the populations sampled and ranged from 0% to 70.8% [18]. The OpbuCPV isolates also were found to be capable of vertical transmission. Given the above, it is possible that the presumptive OpbuCPV OBs discovered in an OB preparation from the Massachusetts OpbuNPV-killed cadavers were carried over by winter moths that invaded North America from Europe. Sequencing of the RNA segments in the Massachusetts larval OB preparation will determine whether the Massachusetts larvae are carrying OpbuCPV18 and OpbuCPV19, or a different cypovirus. Such knowledge will also allow for screening of North American populations of winter moth for the presence and frequency of cypovirus infections. While there have been other reports of the co-occurrence of cypoviruses and baculoviruses [53,54], there are few studies documenting the interaction of these two groups of viruses during co-infection. In a book chapter on cypoviruses, Belloncik and Mori [55] cite a publication in a French language journal and a conference presentation purporting to show a synergistic effect on mortality of insects infected with both cypoviruses and baculoviruses. They also allude to unpublished results of tissue culture co-infections that suggest interference between the two types of viruses [55]. The most comprehensive study on the interaction of cypoviruses and baculoviruses examined the results of infection of two lepidopteran hosts (Choristoneura fumiferana and Malacosoma disstria), with matched pairs of baculoviruses and cypoviruses from these hosts [56]. With both hosts and their baculovirus/cypovirus pairs, prior infection with the cypovirus was found to interfere with a subsequent infection with the baculovirus, retarding the development of nuclear polyhedrosis. Dependent on how prevalent cypoviruses are among North American populations, interference by a cypovirus may explain observations of a lack of OpbuNPV pathogenicity against North American winter moth larvae. One purpose for sequencing the OpbuNPV-MA genome was to assess the genetic variability that could be sampled to identify genotypes that—either singly or in combination—would exhibit greater pathogenicity against winter moth larvae. The assembled sequence reads of the genome revealed a low level of genetic variation in the OpbuNPV-MA genome, such that isolating different genotypes from OpbuNPV-MA to test in bioassays would be technically challenging. In contrast, a significant degree of genetic variation was detected in populations of winter moth in its native habitat in Scotland by restriction endonuclease analysis [7]. The low level of genetic variation observed in OpbuNPV-MA may be due to a population bottleneck [57]. The low percentages of polymorphism abundance in the OpbuNPV-MA genome sequence assembly is consistent with a narrow bottleneck and a very low number of founder genotypes—possibly only a single founder genotype. The potential of producing single-genotype baculovirus populations from low-dose infections has been demonstrated in laboratory studies [58,59]. It is not known if the low genetic variability is specific to the stock used to sequence OpbuNPV-MA. If so, it suggests that a bottleneck event occurred during production of the stock. Alternatively, if the lack of variability is discovered to be a feature of OpbuNPV populations in Massachusetts winter moth larvae, then the bottleneck event may have occurred during the invasion of Massachusetts by the winter moth. PCR and sequencing with primers designed to amplify a loci known to be variable among baculovirus isolates (for example, the bro genes) should provide more information on the extent to which the low variability reported for the OpbuNPV-MA genome sequence is present in other virus populations. Assuming that the low degree of variability is widespread among other populations of OpbuNPV in Massachusetts, it may also be a factor in the apparent lack of pathogenicity observed with this virus. Other studies have found that infections with mixtures of genotypes cause more mortality than single-genotype infections [60,61]. Such observations suggest that the OpbuNPV-MA isolate may be missing genotypes that are required for optimal levels of pathogenicity. Viruses 2017, 9, 307 17 of 20

Analysis of the OpbuNPV-MA ORFs indicates that it represents a divergent lineage among the group II alphabaculoviruses. Phylogenetic inference with core gene amino acid sequence alignments placed OpbuNPV-MA on a branch by itself and basal to the clade containing other alphabaculovirus taxa. These results suggests that the lineage leading to OpbuNPV appeared early during the evolution and diversification of the alphabaculoviruses. Sequence data from the alphabaculovirus of the related moth Operopthera bruceata—a native North American geometrid species—suggests that the O. bruceata nucleopolyhedrovirus (OpbrNPV) is also part of this lineage [9].

5. Conclusions Examination of the OBs of OpbuNPV-MA and determination of its genome sequence have pointed to potential explanations for why OpbuNPV-MA is not more of a mortality factor among North American populations of the winter moth. It is anticipated that further research on cypoviruses and other isolates of alphabaculoviruses of the winter moth and related species should increase our understanding of factors affecting the development of viral disease in winter moth populations and expand our insight into the evolution of baculoviruses. In addition, genome sequences of OpbuNPV from other locations may yield more information on the genetic variability normally present among populations of this virus.

Supplementary Materials: The following are available online at www.mdpi.com/1999-4915/9/10/307/s1. Figure S1: Frequencies of polymorphisms in the OpbuNPV-MA genome assembly; Table S1: Names, abbreviations, and GenBank accession numbers of taxa used in phylogenetic inference; Table S2: OpbuNPV-MA open reading frames (ORFs) and homologous repeat regions (hrs). Acknowledgments: The authors thank Pallavi Thapa (USDA-ARS) for assistance with ORF annotation and alignments. No specific funding was used for this work. Author Contributions: R.L.H., J.D.M., G.R.B. and J.P.B. conceived and designed the experiments; D.L.R., J.D.M. and G.R.B. performed the experiments; R.L.H. and D.L.R. analyzed the data; J.P.B. contributed reagents; R.L.H. and J.P.B. wrote the paper. Conflicts of Interest: The authors declare no conflict of interest.

References

1. Herniou, E.A.; Arif, B.M.; Becnel, J.J.; Blissard, G.W.; Bonning, B.; Harrison, R.L.; Jehle, J.A.; Theilmann, D.A.; Vlak, J.M. Baculoviridae. In Virus taxonomy: Ninth Report of the International Committee on Taxonomy of Viruses; King, A.M.Q., Adams, M.J., Eds.; Elsevier: Oxford, UK, 2011; pp. 163–174. 2. Harrison, R.L.; Hoover, K. Baculoviruses and other occluded insect viruses. In Insect Pathology, 2nd ed.; Vega, F.E., Kaya, H.K., Eds.; Academic Press: Boston, MA, USA, 2012; pp. 73–131. 3. Rohrmann, G.F. Baculovirus Molecular Biology, 3rd ed.; National Center for Biotechnology Information (US): Bethesda, MD, USA, 2013. 4. Roland, J.; Embree, D.G. Biological control of the winter moth. Ann. Rev. Entomol. 1995, 40, 475–492. [CrossRef] 5. Elkinton, J.; Boettner, G.; Liebhold, A.; Gwiazdowski, R. Biology, Spread, and Biological Control of Winter Moth in the Eastern United States; Service, U.F., Ed.; Forest Health Technology Enterprise Team: Morgantown, West Virginia, USA, 2015. 6. Embree, D.G. The role of introduced parasites in the control of the winter moth in Nova Scotia. Can. Entomol. 1966, 98, 1159–1168. [CrossRef] 7. Graham, R.I.; Tyne, W.I.; Possee, R.D.; Sait, S.M.; Hails, R.S. Genetically variable nucleopolyhedroviruses isolated from spatially separate populations of the winter moth Operophtera brumata (Lepidoptera: Geometridae) in Orkney. J. Invertebr. Pathol. 2004, 87, 29–38. [CrossRef][PubMed] 8. Burand, J.P.; Kim, W.; Welch, A.; Elkinton, J.S. Identification of a nucleopolyhedrovirus in winter moth populations from Massachusetts. J. Invertebr. Pathol. 2011, 108, 217–219. [CrossRef][PubMed] 9. Broadley, H.J.; Boucher, M.; Burand, J.P.; Elkinton, J.S. The phylogenetic relationship and cross-infection of nucleopolyhedroviruses between the invasive winter moth (Operophtera brumata) and its native congener, bruce spanworm (O. bruceata). J. Invertebr. Pathol. 2017, 143, 61–68. [CrossRef][PubMed] Viruses 2017, 9, 307 18 of 20

10. Cunningham, J.C.; Tonks, N.V.; Kaupp, W.J. Viruses to control winter moth, Operophtera brumata, (Lepidoptera: Geometridae). J. Entomol. Soc. B. C. 1981, 78, 17–24. 11. Guo, F.-B.; Zhang, C.-T. ZCURVE_V: A new self-training system for recognizing protein-coding genes in viral and phage genomes. BMC Bioinform. 2006, 7, 9. [CrossRef][PubMed] 12. Alva, V.; Nam, S.Z.; Soding, J.; Lupas, A.N. The MPI bioinformatics toolkit as an integrative platform for advanced protein sequence and structure analysis. Nucleic Acids Res. 2016, 44, W410–415. [CrossRef] [PubMed] 13. Thompson, J.D.; Higgins, D.G.; Gibson, T.J. Clustal w: Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 1994, 22, 4673–4680. [CrossRef][PubMed] 14. Katoh, K.; Misawa, K.; Kuma, K.; Miyata, T. MAFFT: A novel method for rapid multiple sequence alignment based on fast Fourier transform. Nucleic Acids Res. 2002, 30, 3059–3066. [CrossRef][PubMed] 15. Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular Evolutionary Genetics Analysis version 7.0 for bigger datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [CrossRef][PubMed] 16. Stamatakis, A. Raxml version 8: A tool for phylogenetic analysis and post-analysis of large phylogenies. Bioinformatics 2014, 30, 1312–1313. [CrossRef][PubMed] 17. Attoui, H.; Mertens, P.P.C.; Becnel, J.; Belaganahalli, S.; Bergoin, M.; Brussaard, C.P.; Chappell, J.D.; Ciarlet, M.; del Vas, M.; Dermody, T.S.; et al. Reoviridae. In Virus Taxonomy: Ninth Report of the International Committee on Taxonomy of Viruses; King, A.M.Q., Adams, M.J., Eds.; Elsevier: Oxford, UK, 2011; pp. 541–637. 18. Graham, R.I.; Rao, S.; Possee, R.D.; Sait, S.M.; Mertens, P.P.; Hails, R.S. Detection and characterisation of three novel species of reovirus (Reoviridae), isolated from geographically separate populations of the winter moth Operophtera brumata (Lepidoptera: Geometridae) on Orkney. J. Invertebr. Pathol. 2006, 91, 79–87. [CrossRef] [PubMed] 19. Graham, R.I.; Rao, S.; Sait, S.M.; Mertens, P.P.; Hails, R.S.; Possee, R.D. Characterisation and partial sequence analysis of two novel cypoviruses isolated from the winter moth Operophtera brumata (Lepidoptera: Geometridae). Virus Genes 2007, 35, 463–471. [CrossRef][PubMed] 20. Van Oers, M.M.; Vlak, J.M. Baculovirus genomics. Curr. Drug Targets 2007, 8, 1051–1068. [CrossRef] [PubMed] 21. Chateigner, A.; Bezier, A.; Labrousse, C.; Jiolle, D.; Barbe, V.; Herniou, E.A. Ultra deep sequencing of a baculovirus population reveals widespread genomic variations. Viruses 2015, 7, 3625–3646. [CrossRef] [PubMed] 22. Garavaglia, M.J.; Miele, S.A.; Iserte, J.A.; Belaich, M.N.; Ghiringhelli, P.D. The ac53, ac78, ac101, and ac103 genes are newly discovered core genes in the family Baculoviridae. J. Virol. 2012, 86, 12069–12079. [CrossRef] [PubMed] 23. Javed, M.A.; Biswas, S.; Willis, L.G.; Harris, S.; Pritchard, C.; van Oers, M.M.; Donly, B.C.; Erlandson, M.A.; Hegedus, D.D.; Theilmann, D.A. Autographa californica multiple nucleopolyhedrovirus ac83 is a per os infectivity factor (PIF) protein required for occlusion-derived virus (ODV) and budded virus nucleocapsid assembly as well as assembly of the PIF complex in ODV envelopes. J. Virol. 2017, 91, e02115–02116. [CrossRef][PubMed] 24. Bideshi, D.K.; Renault, S.; Stasiak, K.; Federici, B.A.; Bigot, Y. Phylogenetic analysis and possible function of bro-like genes, a multigene family widespread among large double-stranded DNA viruses of invertebrates and bacteria. J. Gen. Virol. 2003, 84, 2531–2544. [CrossRef][PubMed] 25. Derks, M.F.; Smit, S.; Salis, L.; Schijlen, E.; Bossers, A.; Mateman, C.; Pijl, A.S.; de Ridder, D.; Groenen, M.A.; Visser, M.E.; et al. The genome of winter moth (Operophtera brumata) provides a genomic perspective on sexual dimorphism and phenology. Genome Biol. Evol. 2015, 7, 2321–2332. [CrossRef][PubMed] 26. Clem, R.J. Viral IAPs, then and now. Semim. Cell Dev. Biol. 2015, 39, 72–79. [CrossRef][PubMed] 27. Kuzio, J.; Pearson, M.N.; Harwood, S.H.; Funk, C.J.; Evans, J.T.; Slavicek, J.M.; Rohrmann, G.F. Sequence and analysis of the genome of a baculovirus pathogenic for Lymantria dispar. Virology 1999, 253, 17–34. [CrossRef] [PubMed] 28. Chen, C.J.; Quentin, M.E.; Brennan, L.A.; Kukel, C.; Thiem, S.M. Lymantria dispar nucleopolyhedrovirus HRF-1 expands the larval host range of Autographa californica nucleopolyhedrovirus. J. Virol. 1998, 72, 2526–2531. [PubMed] Viruses 2017, 9, 307 19 of 20

29. Ishikawa, H.; Ikeda, M.; Alves, C.A.; Thiem, S.M.; Kobayashi, M. Host range factor 1 from Lymantria dispar nucleopolyhedrovirus (NPV) is an essential viral factor required for productive infection of NPVs in IPLB-Ld652Y cells derived from L. dispar. J. Virol. 2004, 78, 12703–12708. [CrossRef][PubMed] 30. Pearson, M.N.; Rohrmann, G.F. Characterization of a baculovirus-encoded ATP-dependent DNA ligase. J. Virol. 1998, 72, 9142–9149. [PubMed] 31. Krejmer, M.; Skrzecz, I.; Wasag, B.; Szewczyk, B.; Rabalski, L. The genome of Dasychira pudibunda nucleopolyhedrovirus (DapuNPV) reveals novel genetic connection between baculoviruses infecting moths of the Lymantriidae family. BMC Genom. 2015, 16, 759. [CrossRef][PubMed] 32. Ahrens, C.H.; Russell, R.L.; Funk, C.J.; Evans, J.T.; Harwood, S.H.; Rohrmann, G.F. The sequence of the Orgyia pseudotsugata multinucleocapsid nuclear polyhedrosis virus genome. Virology 1997, 229, 381–399. [CrossRef][PubMed] 33. Nai, Y.S.; Wu, C.Y.; Wang, T.C.; Chen, Y.R.; Lau, W.H.; Lo, C.F.; Tsai, M.F.; Wang, C.H. Genomic sequencing and analyses of Lymantria xylina multiple nucleopolyhedrovirus. BMC Genom. 2010, 11, 116. [CrossRef] [PubMed] 34. Liu, X.; Yin, F.; Zhu, Z.; Hou, D.; Wang, J.; Zhang, L.; Wang, M.; Wang, H.; Hu, Z.; Deng, F. Genomic sequencing and analysis of Sucra jujuba nucleopolyhedrovirus. PLoS ONE 2014, 9, e110023. [CrossRef] [PubMed] 35. Thumbi, D.K.; Eveleigh, R.J.; Lucarotti, C.J.; Lapointe, R.; Graham, R.I.; Pavlik, L.; Lauzon, H.A.; Arif, B.M. Complete sequence, analysis and organization of the Orgyia leucostigma nucleopolyhedrovirus genome. Viruses 2011, 3, 2301–2327. [CrossRef][PubMed] 36. Li, L.; Li, Z.; Chen, W.; Liu, C.; Huang, H.; Yang, K.; Pang, Y. Characterization of Spodoptera exigua multicapsid nucleopolyhedrovirus orf100 and orf101, two homologues of E. coli ChaB. Virus Res. 2006, 121, 42–50. [CrossRef][PubMed] 37. Li, Z.; Li, L.; Yu, H.; Li, S.; Pang, Y. Characterization of two homologues of ChaB in Spodoptera litura multicapsid nucleopolyhedrovirus. Gene 2006, 372, 33–43. [CrossRef][PubMed] 38. Magni, G.; Amici, A.; Emanuelli, M.; Orsomando, G.; Raffaelli, N.; Ruggieri, S. Enzymology of NAD+ homeostasis in man. Cell. Mol. Life Sci. 2004, 61, 19–34. [CrossRef][PubMed] 39. Ratajczak, J.; Joffraud, M.; Trammell, S.A.; Ras, R.; Canela, N.; Boutant, M.; Kulkarni, S.S.; Rodrigues, M.; Redpath, P.; Migaud, M.E.; et al. Nrk1 controls nicotinamide mononucleotide and nicotinamide riboside metabolism in mammalian cells. Nat. Commun. 2016, 7, 13103. [CrossRef][PubMed] 40. Cuartas, P.E.; Barrera, G.P.; Belaich, M.N.; Barreto, E.; Ghiringhelli, P.D.; Villamizar, L.F. The complete sequence of the first Spodoptera frugiperda betabaculovirus genome: A natural multiple recombinant virus. Viruses 2015, 7, 394–421. [CrossRef][PubMed] 41. Willis, L.G.; Seipp, R.; Stewart, T.M.; Erlandson, M.A.; Theilmann, D.A. Sequence analysis of the complete genome of Trichoplusia ni single nucleopolyhedrovirus and the identification of a baculoviral photolyase gene. Virology 2005, 338, 209–226. [CrossRef][PubMed] 42. Biernat, M.A.; Ros, V.I.; Vlak, J.M.; van Oers, M.M. Baculovirus cyclobutane pyrimidine dimer photolyases show a close relationship with lepidopteran host homologues. Insect Mol. Biol. 2011, 20, 457–464. [CrossRef] [PubMed] 43. Wang, Y.; Choi, J.Y.; Roh, J.Y.; Liu, Q.; Tao, X.Y.; Park, J.B.; Kim, J.S.; Je, Y.H. Genomic sequence analysis of granulovirus isolated from the tobacco cutworm, Spodoptera litura. PLoS ONE 2011, 6, e28163. [CrossRef] [PubMed] 44. Van Oers, M.M.; Lampen, M.H.; Bajek, M.I.; Vlak, J.M.; Eker, A.P. Active DNA photolyase encoded by a baculovirus from the insect Chrysodeixis chalcites. DNA Repair 2008, 7, 1309–1318. [CrossRef][PubMed] 45. Xu, F.; Vlak, J.M.; van Oers, M.M. Conservation of DNA photolyase genes in group II nucleopolyhedroviruses infecting plusiine insects. Virus Res. 2008, 136, 58–64. [CrossRef][PubMed] 46. Jordan, A.; Reichard, P. Ribonucleotide reductases. Annu. Rev. Biochem. 1998, 67, 71–98. [CrossRef][PubMed] 47. Nyman, P.O. Introduction. DUTPases. Curr. Protein. Pept. Sci. 2001, 2, 277–285. [CrossRef][PubMed] 48. Chen, R.; Wang, H.; Mansky, L.M. Roles of uracil-DNA glycosylase and dUTPase in virus replication. J. Gen. Virol. 2002, 83, 2339–2345. [CrossRef][PubMed] 49. Shackelton, L.A.; Holmes, E.C. The evolution of large DNA viruses: Combining genomic information of viruses and their hosts. Trends Microbiol. 2004, 12, 458–465. [CrossRef][PubMed] Viruses 2017, 9, 307 20 of 20

50. Harrison, R.L.; Rowley, D.L.; Mowery, J.; Bauchan, G.R.; Theilmann, D.A.; Rohrmann, G.F.; Erlandson, M.A. The complete genome sequence of a second distinct betabaculovirus from the true armyworm, Mythimna unipuncta. PLoS ONE 2017, 12, e0170510. [CrossRef][PubMed] 51. Theze, J.; Takatsuka, J.; Nakai, M.; Arif, B.; Herniou, E.A. Gene acquisition convergence between entomopoxviruses and baculoviruses. Viruses 2015, 7, 1960–1974. [CrossRef][PubMed] 52. Ardisson-Araujo, D.M.; Pereira, B.T.; Melo, F.L.; Ribeiro, B.M.; Bao, S.N.; de, A.Z.P.M.; Moscardi, F.; Kitajima, E.W.; Sosa-Gomez, D.R.; Wolff, J.L. A betabaculovirus encoding a gp64 homolog. BMC Genom. 2016, 17, 94. [CrossRef][PubMed] 53. Harper, J.D. Interactions between baculoviruses and other entompathogens, chemical pesticides, and parasitioids. In The Biology of Baculoviruses. Volume II, Practical Application for Insect Control; Granados, R.R., Federici, B.A., Eds.; CRC Press: Boca Raton, FL, USA, 1986; pp. 133–155. 54. Laitinen, A.M.; Otvos, I.S.; Levin, D.B. Geographic distribution of cytoplasmic polyhedrosis virus infection in Douglas-fir tussock moth larvae, Orgyia pseudotsugata, in British Columbia. J. Invertebr. Pathol. 1996, 67, 229–235. [CrossRef][PubMed] 55. Belloncik, S.; Mori, H. Cypoviruses. In The Insect Viruses; Miller, L.K., Ball, L.A., Eds.; Plenum Press: New York, NY, USA, 1998; pp. 337–370. 56. Bird, F.T. Infection and mortality of spruce budworm, Choristoneura fumiferana, and forest tent caterpillar, Malacosoma disstria, caused by nuclear and cytoplasmic polyhedrosis viruses. Can. Entomol. 1969, 101, 1269–1285. [CrossRef] 57. Zwart, M.P.; Elena, S.F. Matters of size: Genetic bottlenecks in virus infection and their potential impact on evolution. Annu. Rev .Virol. 2015, 2, 161–179. [CrossRef][PubMed] 58. Smith, I.R.; Crook, N.E. In vivo isolation of baculovirus genotypes. Virology 1988, 166, 240–244. [CrossRef] 59. Zwart, M.P.; Hemerik, L.; Cory, J.S.; de Visser, J.A.; Bianchi, F.J.; Van Oers, M.M.; Vlak, J.M.; Hoekstra, R.F.; Van der Werf, W. An experimental test of the independent action hypothesis in virus-insect pathosystems. Proc. Biol. Sci. 2009, 276, 2233–2242. [CrossRef][PubMed] 60. Hodgson, D.J.; Hitchman, R.B.; Vanbergen, A.J.; Hails, R.S.; Possee, R.D.; Cory, J.S. Host ecology determines the relative fitness of virus genotypes in mixed-genotype nucleopolyhedrovirus infections. J. Evol. Biol. 2004, 17, 1018–1025. [CrossRef][PubMed] 61. Clavijo, G.; Williams, T.; Simon, O.; Munoz, D.; Cerutti, M.; Lopez-Ferber, M.; Caballero, P. Mixtures of complete and pif1- and pif2-deficient genotypes are required for increased potency of an insect nucleopolyhedrovirus. J. Virol. 2009, 83, 5127–5136. [CrossRef][PubMed]

© 2017 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).