Assessing Integrity of Insect RNA Application Note Nucleic Acid Analysis Authors Abstract Jeffrey A. Fabrick and J. Joe Hull Assessing total RNA integrity is important for the success of downstream RNA Pest Management and Biocontrol applications. The Agilent 2100 Bioanalyzer system with the RNA Integrity Number Research Unit, (RIN) provides a quantitative measure of RNA degradation. Although RINs may not Agricultural Research Service, be ascertained for RNA from all organisms, namely those with unusual or complex United States Department of RNA profiles, this Application Note demonstrates the applicability of total RNA Agriculture, quality assessment of different insect species with the 2100 Bioanalyzer system Maricopa, AZ, USA and its relevance to downstream quantitative RT-PCR experiments. Introduction Experimental RNA extraction Total RNA was extracted from insect In general, the success of downstream Materials RNA applications depends on the tissues using a TissueLyser and TRI quality and integrity of the extracted TissueLyser was obtained from Qiagen Reagent. For RNA degradation, tissues total RNA. Therefore, evaluating levels (Valencia, CA, USA). TRI Reagent, were homogenized in 2-mL round-bottom of degradation in RNA samples is OPTIZYME DNase I and a NanoDrop microfuge tubes with two steel critical. Electrophoretic separation and 1000 spectrophotometer were from beads in PBS buffer (700 µL) or TRI visual inspection of the highly abundant Thermo Fisher Scientific (Waltham, Reagent (positive controls), and held ribosomal RNAs (rRNAs) – 16S and MA, USA). An Agilent 2100 Bioanalyzer at room temperature for 0, 5, 10, 30, or 23S in prokaryotes and 18S and 28S in system (G2940CA or G2943CA) and the 60 minutes. TRI Reagent (100 µL) was eukaryotes – in RNA profiles are the RNA 6000 Nano Kit (p/n 5067-1511), added at each respective time point most common methods for assessing AffinityScript Multiple Temperature to stop further RNA degradation. RNA the integrity of extracted total RNA. Reverse Transcriptase (p/n 600105), and concentration and 260/280 ratios were In addition to this visual inspection of Brilliant III SYBR (p/n 600886) were from determined using a spectrophotometer. the total RNA profile, the Agilent 2100 Agilent Technologies (Santa Clara, CA, Genomic DNA was removed by treating Bioanalyzer system provides a USA). The CFX96 Touch Real-Time PCR 1 μg of total RNA with DNase I. quantitative measure of the RNA integrity Detection System from BioRad (Hercules, with the patented RNA Integrity Number CA, USA) was used for quantitative RNA analysis 1 RT-PCR. (RIN) , an established industry standard RNA samples were heated to 70 °C, for RNA quality assessment before any and analyzed with the 2100 Bioanalyzer RNA-dependent application. Samples system using the RNA 6000 Nano kit Aedes aegypti, Culex quinquefasciatus, according to the manufacturer’s Although the RNA profiles from Musca domestica, and Helicoverpa zea instructions6. All analyses were eukaryotes are dominated by the were purchased from Benzon Research performed using the Agilent 2100 Expert presence of conserved 18S and 28S (Carlisle, PA, USA). Drosophila Software. rRNA species, the total RNA profiles melanogaster were purchased from from insects differ substantially from Carolina Biological Supply (Burlington, cDNA synthesis and other profiles, as the 28S rRNA of NC, USA). Pectinophora gossypiella, most insects contains an endogenous real‑time qPCR 2-4 Bemisia tabaci, and Lygus hesperus hidden break . Denaturation causes the were obtained from laboratory strains cDNA was generated from 0.5 μg total hydrogen bonds to dissociate, and two reared at USDA-ARS, U.S. Arid Land RNA using an AffinityScript Multi fragments of similar size are generated, Agricultural Research Center (Maricopa, Temperature cDNA synthesis kit following and closely migrate with the 18S rRNA. AZ, USA). Apis mellifera hives were the manufacturer‘s recommended Additionally, the 5.8S rRNA is base-paired maintained at the University of Arizona protocol at 55 °C for 60 minutes. qPCR to this 28S complex, and is also released Maricopa Agricultural Center (Maricopa, was performed using Brilliant III SYBR under denaturing conditions. When RNA AZ, USA), with original source from the on a qPCR thermocycler. After the samples are not heat-denatured, the USDA-ARS Carl Hayden Bee Research initial denaturation step at 95 °C for expected 18S and 28S rRNA peaks are 3 minutes, 40 cycles were performed 5 Center (Tucson, AZ, USA). Camponotus observed in the total RNA profile . floridanus and Zootermopsis nevadensis at 95 °C for 5 seconds, and 67 °C for 10 seconds. Three technical replicates This Application Note describes the were kindly provided by Jürgen Liebig, Arizona State University (Tempe, AZ, USA) were performed for each sample. Table 1 complexity of insect RNA, and the summarizes the PCR primers. challenges associated with integrity and Myzus persicae was kindly provided determination using the 2100 Bioanalyzer by Kerry Oliver, University of Georgia system. Here, a large variety of insect (Athens, GA, USA). species were analyzed for total RNA quality using the 2100 Bioanalyzer system, and the obtained RNA profiles and RIN were compared. In addition, the effect of degraded insect RNA on the outcome of quantitative RT-PCR experiments was evaluated. 2 Table 1. Nucleotide primers used in quantitative RT-PCR. Results and Discussion Primer Sequence (5’-3’) RNA profiles of diverse Dm actin rt 719 F GACCGACTACCTGATGAAGATCC insect species Dm actin rt 821 R AACATAGCACAGCTTCTCCTTGA Total RNA was extracted from Aa GAPDH rt 736 F CTGAACAAGCCTGCTACTTATGC various insect species (Ae. aegypti, Aa GAPDH 859 R TATCACCAACGAAGTCAGTGGAG C. quinquefasciatus, D. melanogaster, Lh GAPDH rt 307 F GAGAAGGCCTCTGCTCATTTAGA M. domestica, A. mellifera, C. floridanus, Lh GAPDH rt 414 R GTCATACGCTTCAAGGTTGACAC Z. nevadensis, H. zea, P. gossypiella, Lh actin rt 683 F TGGCCACCGCCGCGTCCT B. tabaci, L. hesperus, and M. persicae) using a TRI Reagent-based RNA Lh actin rt 787 R AGAGGGCTTCGGGGCACCTG extraction method with 70 °C heat treatment. The obtained total RNA samples were analyzed using the 2100 Bioanalyzer system and the RNA Nano kit (Figure 1). AB C DE F GH I JKL Figure 1. Electrophoretic separation of different insect total RNA using an Agilent 2100 Bioanalyzer system with the Eukaryotic Total RNA Nano assay. Representative electropherograms of Ae. aegypti (A), C. quinquefasciatus (B), D. melanogaster (C), M. domestica (D), A. mellifera (E), C. floridanus (F), Z. nevadensis (G), H. zea (H), P. gossypiella (I), B. tabaci (J), L. hesperus (K), and M. persicae (L) are shown. The peak at approximately 23 seconds corresponds to the Lower Marker. 3 Figures 1A-D shows electropherograms Because RIN was specifically developed Insect RNA degradation depends from representative Diptera (Ae. aegypti, for the analysis of the eukaryotic total on RNA extraction C. quinquefasciatus, D. melanogaster, RNA, it was evaluated if RIN was also Although RIN cannot be reliably used and M. domestica). Putative ribosomal meaningful for insect RNA samples that for insect RNA, the electropherogram 18S and 28S bands are visible in all have different RNA profiles, as shown in is a useful tool for the assessment of dipterans. Two hymenopteran species Figure 1. RNA degradation. As a demonstration, (A. mellifera and C. floridanus) show total insect RNA from L. hesperus, diverse RNA profiles (Figures 1E and 1F) Table 2 summarizes the determined D. melanogaster, and Ae. aegypti was in which the A. mellifera pattern consists RIN values for each species from the extracted in TRI Reagent or PBS at of a single major peak that contains 2100 Expert Software. Because of the room temperature for 0, 5, 10, 30, or both 18S and heat-labile 28S ribosomal eukaryotic total RNA algorithm used 60 minutes, and analyzed with the RNA2. The C. floridanus RNA profile lacks and the relative positioning of putative 2100 Bioanalyzer system and the both 18S and 28S bands. RNA from the 18S, 28S, and other minor peaks found RNA Nano 6000 kit. Figure 2 shows the isopteran termite Z. nevadensis shows in RNA from different insects, RINs were obtained electropherograms. an RNA profile unique to this species not always automatically calculated. For example, RINs were not determined for (Figure 1G), with four major distinct The electropherograms clearly show C. quinquefasciatus, D. melanogaster, peaks. Representatives from Lepidoptera RNA degradation over time when A. mellifera, L. hesperus, and M. persicae, (H. zea and P. gossypiella) are shown extracted directly in PBS for L. hesperus, although many of these profiles seem in Figure 1H-I, and have similar profiles D. melanogaster, and Ae. aegypti to contain intact ribosomal RNAs with overlapping putative 18S/28S (Figure 2). In contrast, the RNA profiles (Figure 1). RINs were calculated for some peaks. Several hemipterans (B. tabaci, and putative 18S and 28S RNA peaks insect RNA (Ae. aegypti, M. domestica, L. hesperus, and M. persicae) are shown are preserved when RNA is extracted C. floridanus, Z. nevadensis, H. zea, in Figure 1J-L, each with unique RNA using TRI Reagent, even after 1 hour P. gossypiella, and B. tabaci). profiles. Specifically, the putative 28S at room temperature. The RNA profiles peak is reduced in L. hesperus, and RNA Because of the unique profiles of insect show clear evidence of degradation with peaks resolve at later retention times for RNA and the differences in rRNA, RIN fragmentation of RNA and decrease in M. persicae. was calculated for some insect species fluorescence intensity of 18S and 28S peaks, after only 5 minutes in PBS. The Figure 1 demonstrates that the total but not for others and the validity of RIN degradation further increases with the RNA electropherogram traces differ for insect total RNA was not proven. incubation time. This demonstrates that substantially depending on the insect the total RNA electropherograms from species. This needs to be considered the 2100 Bioanalyzer system provide when judging the total RNA quality based useful information to judge RNA integrity on the profile. within insect species.