
Thaiszia - J. Bot., Košice, 30 (1): 093-101, 2020 THAISZIA https://doi.org/10.33542/TJB2020-1-07 JOURNAL OF BOTANY The phylogenetic position of Aglaodorum Schott (Araceae – Aroideae – Aglaonemateae) Hong Thien Van1, Nga Nguyen-Phi2 & Hong Truong Luu3 1 Institute of Biotechnology and Food technology, Industrial University of Ho Chi Minh City, 12 Nguyen Van Bao, Go Vap District, Ho Chi Minh City, Vietnam; [email protected] 2 Department of Ecology and Evolutionary Biology, University of Science, Vietnam National University HCMC, 227 Nguyen Van Cu, District 5, Ho Chi Minh City, Vietnam 3 Southern Institute of Ecology, Vietnam Academy of Science and Technology, 1 Mac Dinh Chi, District 1, Ho Chi Minh City, Vietnam Van H. T., Nguyen-Phi N. & Luu H. T. (2020): The phylogenetic position of Aglaodorum Schott (Araceae – Aroideae – Aglaonemateae). – Thaiszia – J. Bot. 30 (1): 093-101. Abstract: Analysis of chloroplast DNA sequences (trnL intron and trnL- trnF intergenic spacer) of the helophytic colony-forming Aglaodorum griffithii (Schott) Schott and other representative species of Araceae supported its placement within Aglaonema Schott. It is therefore proposed that Aglaodorum Schott should be recognised as a generic synonym of Aglaonema. Keywords: Araceae, Aglaonema griffithii, Aglaodorum griffithii, trnL, trnL-trnF. Introduction Aglaonema griffithii Schott was first described by Schott (1856) from Peninsular Malaysia. Two years later, he realized that this species have some differences from other species of Aglaonema Schott (see below) and so he created a new genus, Aglaodorum Schott, and transferred Aglaonema griffithii Schott into it (Schott 1858). Schott’s view was not always followed, however. For example, Teijsmann & Binnendijk (1863) described Aglaonema palustre Teijsm. & Binn., which is a synonym of Aglaodorum griffithii (Schott) Schott (Boyce et al. 2012), from Sumatra, and 93 Hooker (1883: 981) and Ridley (1925: 100) both treated Aglaodorum as a synonym of Aglaonema. Nevertheless, Engler, the great authority on Aroids after Schott, maintained Aglaodorum as a genus allied to but separate from Aglaonema (Engler 1915: 34), and since then Aglaodorum has been accepted as a monotypic genus the sole species of which is distributed in southern Cambodia, southern Vietnam, south and west through Peninsular Malaysia and Sumatra, and east to northern and western Borneo (Mayo et al. 1997; Boyce et al. 2012). The morphology of Aglaodorum griffithii is known to be extremely similar to that of Aglaonema, especially in the structure of spathe, male and female spadix, ovary, stigma, ovule and leaf blade (Nicolson 1969). However, there are some notable differences: Aglaodorum griffithii is traditionally distinguished from the species of Aglaonema by having one whorl of pistillate flowers (versus several whorls) and peduncles of 40-50 cm in length (versus the much shorter ones). Moreover, Aglaodorum griffithii has large green spongy fruits adapted to floating dispersal, spongy rhizomes, peduncles and petioles apparently adapted to growing on soft mud and in water, and is helophytic in open conditions, while Aglaonema species are terrestrial on tropical forest floor, almost always in shade and the fruits are red or more rarely pink and bird-dispersed (Schott 1858; Nicolson 1969; Mayo et al. 1997; Boyce et al. 2012). However, these morphological characteristics are known individually to vary greatly within other genera of Araceae. Arrangement of pistillate flowers in only one whorl is known in Aglaonema costatum N.E.Br. (Ridley 1925) and thus it is not a distinct characteristic for Aglaodorum. We therefore set about investigating whether these genera really can be maintained distinct. Here, we analyse molecular data of eleven taxa of Araceae and one Acoraceae in order to determine the phylogenetic affinity of Aglaodorum griffithii. We also evaluated taxonomic usefulness of morphological characters that have traditionally placed Aglaodorum griffithii within Aglaonema. Material and Methods Eleven taxa of Araceae and one Acoraceae used in this study were collected from southern regions of Vietnam (Tab. 1), including three species of Aglaonema. Each taxon had one sample except for Aglaodorum griffithii with three samples from the Mekong Delta provinces of Tien Giang (H. T. Van 103A), Ben Tre (H. T. Van 103B) and Long An (H. T. Van 103C). All voucher specimens are stored at SGN Herbarium. The trnL and trnL-trnF sequences obtained were submitted to GenBank and the assigned accession numbers are listed in Tab. 1. Total genomic DNA was extracted from fresh leaf tissues using a Genomic DNA Purification Mini Kit (Thermo, USA). The trnL intron and trnL-trnF IGS chloroplast DNA region were amplified by polymerase chain reaction (PCR). List of primers is shown in Tab. 2. The PCR reactions were performed in an Eppendorf Mastercycler Gradient using a volume of 25µl reaction mixture: 12.5 µl go taq green master mix (Promega, USA), 1.25µl of each forward and reverse primers (10 µM), 9.5µl ultrapure water and 0.5 µl DNA template (25ng). PCR cycles consisted of an initial denaturation 94 Tab. 1 Specimens of eleven Araceae and one Acoraceae species used in this study. Studied Species Accession numbers specimens (trnL intron/trnL-trnF (SGN) IGS) H.T.Van 99 Acorus calamus L. MN844006/MN844022 H.T.Van 103A Aglaodorum griffithii (Schott) Schott MN844014/MN844028 H.T.Van 103B Aglaodorum griffithii (Schott) Schott MN844015/MN844029 H.T.Van 103C Aglaodorum griffithii (Schott) Schott MN844016/MN844030 H.T.Van 23 Aglaonema cochinchinense Engl. MN844007/MN844023 H.T.Van 91 Aglaonema simplex (Blume) Blume MN844012/MN844026 H.T.Van 116 Aglaonema costatum form. immaculatum MN844008/MN844020 (Ridl.) Nicolson H.T.Van 79 Arisaema roxburghii Kunth MN844011/MN844025 H.T.Van 18 Colocasia esculenta (L.) Schott MN844013/MN844027 H.T.Van 62 Alocasia macrorrhizos (L.) G.Don MN844009/MN844024 H.T.Van 03 Amorphophallus paeoniifolius (Dennst.) MN844010/MN844021 Nicolson H.T.Van 102 Pistia stratiotes L. MN844018/MN844032 H.T.Van 61 Pothos chinensis (Raf.) Merr. MN844017/MN844031 H.T.Van 42 Typhonium trilobatum (L.) Schott MN844019/MN844033 for 5 min at 95°C; 35 cycles of denaturation (1 min at 94°C), annealing (1 min at 50°C) and extension (1:30 min at 72°C); and a final extension at 72°C for 10 min. The PCR products were visualized on 1.5 % agarose gel and sent for purification and direct sequencing at Nam Khoa Biotek Company Ltd (Vietnam) by using ABI 3130 XL Sequencer. For multiple alignments, the ClustalW (Thompson et al. 1994) was used to recognize the homology between sequences. Phylogenetic analysis was carried out with the software PAUP* 4.0a146 (Swofford 2002) and MrBayes (Ronquist & Huelsenbeck 2003) using the maximum parsimony and Bayesian methods with Acorus calamus L. (Acoraceae) as outgroup, following Cabrera et al. (2008); Cusimano et al. (2011); Nauheimer et al. (2012). The maximum parsimony trees were calculated based on chloroplast sequence data with gaps treated as missing data and heuristic search algorithms (Nei & Kumar 2000) with the following parameters: 1000 random addition sequence replicates, tree bisection reconnection (TBR) branch swapping, 10 parsimonious trees held after each replicate (Yulita et al. 2005; Harrison & Langdale 2006). All characters were equally weighted and treated as unordered (Fitch 1971). The fit of characters to the trees was also tested by calculating the consistency index (CI), the retention index (RI) and the rescaled consistency index (RC) (Kluge & Farris 1969; Farris 1989). The Bayesian Markov-chain Monte Carlo (MCMC) was constructed on the software MrBayes (Ronquist & Huelsenbeck 2003). The algorithm used in this study was a two million–generation MCMC with one cold and three heated chains, which was set to start from random trees and sampled every 100th generation. The standard deviation of split frequencies was used as an index to assess the convergence, the values of which 95 Tab. 2 Primers used in the present study. (*) direction of primer F (forward), R (reverse). Primers (*) Regions Sequence (5’-3’) References A (F) trnL intron CGAAATCGGTAGACGCTACG B (R) trnL intron GGGGATAGAGGGACTTGAAC Taberlet et al. (1991) C (F) trnL-trnF IGS GGTTCAAGTCCCTCTATCCC D (R) trnL-trnF IGS ATTTGAACTGGTGACACGAG Tab. 3 Mean pairwise genetic distances between ingroup species based on the combined data set of trnL intron and trnL-trnF IGS. 1 2 3 4 5 6 7 8 9 10 11 1. Aglaonema costatum 2. Aglaodorum griffithii 0.003 3. Aglaonema simplex 0.006 0.009 4. Aglaonema cochinchinense 0.017 0.020 0.020 5. Pothos chinensis 0.065 0.068 0.068 0.080 6. Amorphophallus 0.046 0.049 0.049 0.061 0.087 paeoniifolius 7. Alocasia macrorrhizos 0.061 0.065 0.065 0.073 0.105 0.051 8. Pistia stratiotes 0.078 0.082 0.082 0.087 0.127 0.068 0.053 9. Arisaema roxburghii 0.072 0.075 0.075 0.075 0.109 0.058 0.035 0.061 10. Typhonium trilobatum 0.059 0.063 0.062 0.071 0.104 0.046 0.038 0.054 0.046 11. Colocasia esculenta 0.056 0.060 0.059 0.068 0.096 0.043 0.028 0.046 0.038 0.030 reaching <0.005 are considered as a good convergence. The initial 10% of trees were discarded as burnin while the remaining of them were used to build up 50% majority- rule consensus trees. The pairwise genetic distances (Kimura 1980) were calculated using the software MEGA6 (Tamura et al. 2013). Results and discussion The length of combined data set (trnL intron and trnL-trnF IGS) ranged from 760 to 892 bp. The entire aligned length of two regions is 976 bp. The mean pairwise genetic distances between the genera based on the combined data set are shown in Tab. 3 with the lowest value belonging to Aglaonema and Aglaodorum. Accordingly, the genetic distances between Aglaodorum griffithii and Aglaonema costatum f.
Details
-
File Typepdf
-
Upload Time-
-
Content LanguagesEnglish
-
Upload UserAnonymous/Not logged-in
-
File Pages9 Page
-
File Size-