Urnula sp., an Endophyte of Dicksonia antarctica, Making a Fragrant Mixture of Biologically Active Volatile Organic Compounds Authors: Gary A. Strobel, Amy Ericksen, Joe Sears, Jie Xie, Brad Geary, and Bryan Blatt The final publication is available at Springer via http://dx.doi.org/10.1007/s00248-017-0947-5. Strobel, Gary A., Amy Ericksen, Joe Sears, Jie Xie, Brad Geary, and Bryan Blatt. "Urnula sp., an Endophyte of Dicksonia antarctica, Making a Fragrant Mixture of Biologically Active Volatile Organic Compounds." Microbial Ecology (February 2017). DOI: 10.1007/s00248-017-0947-5. Made available through Montana State University’s ScholarWorks scholarworks.montana.edu Urnula sp., an Endophyte of Dicksonia antarctica,Making a Fragrant Mixture of Biologically Active Volatile Organic Compounds Gary Strobel1 & Amy Ericksen2 & Joe Sears3 & Jie Xie4 & Brad Geary5 & Bryan Blatt2 Abstract Urnula sp. was isolated as an endophyte of Dicksonia waste, using stainless steel carbotraps, yielded over 180 mg of antarctica and identified primarily on the basis of its ITS sequence hydrocarbon-based products collected over 6 weeks of incubation. and morphological features. The anamorphic state of the fungus Similarly, because this organism is making one of the largest sets of appeared as a hyphomyceteous-like fungus as based on its features VOCs as any fungus examined to date, producing many com- in culture and scanning electron microscopy examination of its pounds of commercial interest, it has enormous biotechnical poten- spores. On potato dextrose agar (PDA), the organism makes a tial. The role of the VOCs in the biology and ecology of this endo- characteristic fragrance resembling peach pie with vanilla over- phytemayberelatedtotheantimicrobialactivitiesthattheypossess. tones. A GC/MS analysis done on the volatile organic compounds (VOCs) of this organism, trapped by carbotrap methodology, re- Keywords Endophyte . 4-Decene . Hydrocarbons . vealed over 150 compounds with high MS matching quality being Fragrance . Pathogenic fungi . Biofuel noted for 44 of these. Some of the most abundantly produced com- pounds included 4-decene, tridecane, 2-decene (E), 2-dodecene, (Z,E)-alpha-farnesene, butanoic acid, pentyl ester, and 1- Introduction hexanol,2-ethyl. In addition, vanillin, methyl vanillin, and many other fragrant substances were noted including isomenthol, pyr- It appears that all plants have the potential of hosting endophytic azine derivatives, and 3-decanone. In split plate bioassay tests on microorganisms. In fact, these microbes may be considered the potato dextrose agar (PDA), Botrytis cinerea, Ceratocystis ulmi, core of the plant microbiome [1]. While they do not cause any Pythium ultimum, Fusarium solani,andRhizoctonia solani were overt signs or symptoms of their appearance in the plant, endo- inhibited at levels of 24 to 50% of their normal growth on this phytes may exist as symbionts providing the host with some medium. Bioreactors supporting fungal growth on 50 g of beet pulp form of protection from various environmental insults such as insect or pathogen attack or potential environmental stresses [2]. Most of the evidence for the involvement of secondary products * Gary Strobel of the endophyte in the microbe/plant interaction is circumstan- [email protected] tial. Nevertheless, it appears that these microbes, as a biological group, continually seem to be proven as exciting novel sources 1 Department of Plant Sciences, Montana State University, of natural products [3]. Thus, unlike freely living microbes Bozeman, MT 59717, USA which may produce principles that are toxic to eukaryotes, this 2 Endophytics, 920 Technology Blvd, Bozeman, MT 59718, USA prospect seems less likely with endophytes. This may be the 3 Center for Lab Services/RJ Lee Group, 2710 North 20th Ave., case since the microbe lives in association with a higher organ- Pasco, WA 99301, USA ism, and the presence of toxic factors from the microbe would 4 State Key Laboratory of Silkworm Genome Biology, College of certainly limit the prospects of an endophytic association. Biotechnology, Southwest University, Chongqing 400715, People’s While a plethora of natural products with varying activities Republic of China and biological promise have been isolated from endophytes in 5 Department of Plant and Wildlife Sciences, Brigham Young the recent past, most of these compounds have been chemically University, Provo, UT 84602, USA characterized as solids obtained after extraction of the culture fluid [3–5]. The discovery of Muscodor albus, an endophyte of the plants. The harvested specimens were surface treated, cinnamon, revealed yet another potentially interesting trait of and internal tissue pieces were set out on plates of water agar endophytic microbes. This fungus produces a potent mixture (WA) and glycerol-arginine medium (GAM) [12]. The tissue of volatile organic compounds (VOCs) that either kill or strong- pieces were incubated at room temperature for several days. ly inhibit a wide range of pathogenic microorganisms [6]. Since Visible fungal growth from the tissue samples were picked as its initial discovery, at least 15 other species of this organism hyphal tips and sub-cultured and eventually transferred to have been discovered and all have in common the ability to PDA plates. The endophyte of interest was designated as produce biologically active (VOCs) [7, 8]. Interestingly, many En-22. It possessed an extremely pleasant fragrance of a fresh- of the other strains of Muscodor were obtained using the original ly baked Bpeach pie^ with a vanilla overtone. The organism M. albus isolate as an agent to screen or eliminate unwanted was not found in any other plant specimen collected in this microbes in the isolation process [9, 10]. On occasion, however, area including such species as Banksia marginata, Phebalim some fungi are able to withstand the lethality of the M. albus squameum, Leptospermum juniperium, Solanum aviculaue, VOCs and have been recovered from culture using M. albus as a and Pimelea axiflora. The organism En-22 was stored at selection source. Some of the fungi recovered from such sources −70 °C in the living Mycological Collection of the have proven both interesting and worthy of investigation since Department of Plant Sciences at Montana State University as many of them also make VOCs with biological activity and fuel entry 2409. Long-term storage of these rain forest endophytes potential. Among these have been Ascocoryne sarcoides, is best done on doubly autoclaved, thoroughly wetted, and Hypoxylon sp. (Nodulisporium sp.), and others [11–13]. leached (sterile) barley seeds at −70 °C. Since the original discovery of M. albus, we have constantly been aware of potential VOC components in endophytic cultures Scanning Electron and Light Microscopy because of their biological activities and the intrinsic value of the volatile compounds. It is surmised that tropical and semi-tropical The fungus, En-22, was viewed and photographed using scan- areas of the world possess still other interesting endophytes because ning electron microscopy (SEM). Scanning electron micros- of the high moisture and the biological diversity that exists there. copy was done in order to determine the morphological fea- For this reason, a plant collection was made in south coastal tures of the endophyte. The fungus was grown on γ-irradiated Australia especially in the limited areas in which tree ferns, i.e., carnation leaves on water agar plates that were incubated for Dicksonia antarctica, and other endemic plant species abound. 1 month at 23 °C. The En-22 samples (mycelium and spores) The search yielded an endophyte that appears to be an Urnula sp. were placed in ethanol with further drying to a critical point that makes a plethora of VOCs, and the mixture possesses biolog- and coated with gold for SEM. The instruments used were an ical activity. While certain Urnula spp. make secondary products FEI-XL 30 SEM-FEG on high-vacuum mode and an that are antagonistic to fungi, there are no reports of this fungal Everhart-Thornley detector [12]. genus making bioactive VOCs [14, 15]. The imperfect stage of the fungus is hyphomyceteous like; in that, is makes large conidia ITS-Based Phylogenetic Analysis in culture on sterile carnation leaves. Thus, this report describes the fungal endophyte, the composition of its VOC mixture, and the Ribosomal gene sequence of ITS-5.8 S ribosomal gene se- biological activities associated with the VOCs. The report also quence was used for En-22. Two samples of En-22 were used points out the economic potential of some of the Urnula sp. for analysis. Samples of the fungus were taken at both 3 and VOCs and the importance of these individual compounds to a 5 weeks after growing on PDA [16]. Prepman Ultra Sample number of industries including foods, flavoring, fragrance, Preparation Reagent was used for DNA template preparation bioenergy, and synthetic chemistry. The role of this fungus in the using instructions from the manufacturer (Applied environment can only be surmised at this point, but the availing Biosystems, USA). Regions of ITS that were amplified in circumstantial evidence strongly points to a definite role of fungal the polymerase chain reaction (PCR) process were with the VOCs in the host/plant relationship leading to a potential protection universal primers ITS1 (5′ TCCGTAGGTGAACCTGCGG device to the host plant. 3′) and ITS4 (5′ TCCTCCGCTTATTGATATGC 3′) The pro- gram for ITS region amplification had the following condi- tions: lid temperature of 103 °C; initial denaturation done for Methods 3 min at 94 °C; annealing and Taq operation cycle done for 35 times with 94 °C for 15 s, 50 °C for 30 s, and 72 °C for 45 s; Isolating the Endophyte followed by the final lengthening process at 72 °C for 5 min. The reaction mixture that was used in the PCR amplification A sample of the host plant (D. antarctica)(38°45′ 245″ S, was 20 μl with 11.8 μl of autoclaved, distilled water, 2.1 μlof 143° 33′ 329″ E) was obtained by clipping terminal stem ×10 PCR buffer with 1.5 mM MgCl2, 1.1 μl of 2 mM of dNTP pieces (ca.