Use of Different Taq DNA Polymerases for Detection of Chlamydia Trachomatis in Cervical Samples

Use of Different Taq DNA Polymerases for Detection of Chlamydia Trachomatis in Cervical Samples

ORIGINAL ARTICLE | ARTIGO ORIGINAL | ARTÍCULO ORIGINAL doi: 10.5123/S2176-62232015000400003 Use of different Taq DNA polymerases for detection of Chlamydia trachomatis in cervical samples O uso de diferentes Taq DNA polimerases para a detecção de Chlamydia trachomatis em amostras cervicais El uso de diferentes Taq DNA polimerasas para la detección de Chlamydia trachomatis en muestras cervicales Francisca Laís de Araújo Oliveira Rafael de Souza Rodrigues Instituto de Saúde e Biotecnologia de Coari, Universidade Federal do Instituto de Saúde e Biotecnologia de Coari, Universidade Federal do Amazonas, Coari, Amazonas, Brasil Amazonas, Coari, Amazonas, Brasil Maria Joana Nunes de Azevedo Renato dos Santos Reis Instituto de Saúde e Biotecnologia de Coari, Universidade Federal do Instituto de Saúde e Biotecnologia de Coari, Universidade Federal do Amazonas, Coari, Amazonas, Brasil Amazonas, Coari, Amazonas, Brasil Anderson Nogueira Barbosa Danielle Albuquerque Pires Rocha Instituto de Saúde e Biotecnologia de Coari, Universidade Federal do Instituto de Saúde e Biotecnologia de Coari, Universidade Federal do Amazonas, Coari, Amazonas, Brasil Amazonas, Coari, Amazonas, Brasil ABSTRACT INTRODUCTION: Chlamydia trachomatis is a small gram-negative bacterium sexually transmitted, which progresses asymptomatically in the majority of infected people, causing long-term damage mainly in the female reproductive system. The polymerase chain reaction (PCR) has been the diagnostic method most widely used in recent epidemiological studies by presenting superior sensitivity than the other sensitivity tests. For a good performance of PCR, the choice of enzymes is very important because they have different characteristics that influence their performance. OBJECTIVE: To analyze and compare the detection of C. trachomatis using three commercial enzymes Taq DNA polymerases in 280 cervical samples. METHODS: The enzymes used were: Taq DNA Polymerase Recombinant (Invitrogen, USA), Platinum® Taq DNA Polymerase (Invitrogen, USA) and Platinum® Taq DNA Polymerase High Fidelity (Invitrogen, USA). RESULTS: 280 cervical samples from women living in Coari City, Amazonas State, Brazil were analyzed, whose average age was 36.3 years old, the majority had low educational level, their first sexual intercourse was around 15.7 (SD = 0.7) with an average number of 3.7 children. 42.5% had clinical complaints during the visit, with a predominance of vaginal discharge, itching, pelvic pain and painful urination. Of the 280 samples, four (1.4%) were positive using the recombinant Taq DNA polymerase, seven (2.5%) using the enzyme Platinum® Taq DNA Polymerase and 11 (3.9%) specimens were positive using Platinum® Taq DNA Polymerase High Fidelity. Statistical analysis showed no difference between groups (p = 0.186). CONCLUSION: Enzyme Taq DNA polymerases with different properties show differences in performance in the detection of C. trachomatis. Keywords: Taq Polymerase; Chlamydia trachomatis; Molecular Diagnostic Techniques. Correspondence / Correspondência / Correspondencia: Danielle Albuquerque Pires Rocha Universidade Federal do Amazonas Estrada Coari Mamiá, 305. Bairro: Espírito Santo CEP: 69460-000 Coari-Amazonas-Brazil E-mail: [email protected] http://revista.iec.pa.gov.br Rev Pan-Amaz Saude 2015; 6(4):19-24 19 Oliveira FLA, et al. Use of different Taq DNA polymerases for detection of Chlamydia trachomatis INTRODUCTION a common Taq polymerase (recombinant), Platinum® Taq ® Chlamydia trachomatis is a bacterium belonging DNA polymerase and Platinum Taq DNA polymerase to the family Chlamydiaceae, genus Chlamydia, with HiFi (Invitrogen, Brazil). Chlamydia pecorum, Chlamydia pneumoniae and MATERIALS AND METHODS Chlamydia psittaci, these latter two are also pathogenic in humans. This bacterium was considered to be a SAMPLE virus for many years because of its small size and its The population consisted of women cared at 11 metabolic peculiarities. It is now known, however, that of the city's basic healthcare units, during their routine this is a small bacterium from 0.2 to 1.5 µm in size, exams. The sample consisted of the participation of 280 gram-negative, obligate intracellular parasite, devoid women, sequentially registered in this study according of motility which uses adenosine triphosphate (ATP) to spontaneous demand. This research was conducted 1,2 produced by the host cell for its survival . in compliance with all ethical issues listed to researches C. trachomatis is sexually transmitted and the on human beings and approved by the Ethical Research leading cause of permanent infertility in women, Committee (CAEE n˚ 0010.0.115.000-10) from occurring when the tubal damage is irreversible3. Other Universidade Federal do Amazonas. The inclusion medical conditions caused by chlamydia are salpingitis, criteria were: sexually active women, over 18 years old, endometritis, pelvic inflammatory disease, ectopic who agreed to participate in this study and signed an pregnancy, premature birth, low birth weight, neonatal informed consent (IC) document, regardless of clinical death, among other complications4. complaints or pregnancy status. Exclusion criteria: hysterectomized women and women undergoing recent In Brazil, the real prevalence of this infection is antibiotic treatment (three months) or treatment for any unknown because there is little official data on the recent genital infection. Women were interviewed about epidemiology of sexually transmitted disease. The lack of clinical, socioeconomic and behavioral factors. All women populational studies and organized screening programs were submitted for clinical examination, including pelvic hinder the visibility of problems. Therefore, most of the one. The samples were collected using vaginal speculum available data comes from regional investigations, and endocervical brush, packed in a 1.5 mL microtube which, taken together, help to understand the profile of containing 400 µL of TRIS-EDTA buffer (TRIS-HCl 10 mM this silent infection4,5,6,7,8,9. and EDTA 1 mM ph 8.0) and frozen immediately. The methods used for diagnosis of chlamydia are cell culture, direct immunofluorescence, enzyme-linked DNA EXTRACTION immunosorbent assay (ELISA), Hybrid Capture and After thawing at room temperature, the samples polymerase chain reaction (PCR). Of these, PCR has were subjected to the process of DNA extraction with been widely used in recent epidemiological studies by the DNeasy Blood & Tissue Kit (QIAGEN, Germany). presenting superior sensitivity than the other tests4,10. For a Then, a PCR was carried out to check the efficiency good performance of PCR, the choice of DNA polymerase of extraction of DNA using the primer pair ISO2G14. is very important. Since its discovery, the Taq DNA DNA amplification was carried out in a final volume polymerases have been improved over time, and today of 25 µL, containing 5 U of Platinum Taq DNA there are a variety of commercial enzymes to use in PCR. Polymerase, 5 pmol of primers pair, 5 µL of reaction Taq DNA polymerase is a recombinant thermostable buffer 5X, 25 mM of MgCl2, 10 mM of dNTP, 2 µL enzyme that synthesizes DNA in the presence of of sample and water. The PCR cycling protocol was: dNTPs and a primer. The enzyme consists of a single 95° C for 2 min, 40 cycles of 95° C for 1 min, 50° C for 1 min and 72° C for 1 min, elongation at 72° C for polypeptide with a molecular weight of 94 kDa. The 5 min. recombinant enzyme is purified from Thermus aquaticus polymerase gene and cloned in Escherichia coli. PCR FOR C. trachomatis DNA DETECTION Platinum Taq DNA polymerase is an enzyme that has It was used the primer pair KL1/KL2 the technology of antibody bound to it, which blocks its (5' TCCGGAGCGAGTTACGAAGA 3'/5' action at room temperature and causes the separation AATCAATGCCCGGGATTGGT 3')15, which amplifies between the enzyme and the antibody only during the a fragment of 241 bp. For the recombinant initial denaturation at 94° C (Hot-Start technology). Taq DNA polymerase enzyme and Platinum Taq Thus, it avoids the synthesis of DNA from non-specific DNA polymerase, the reaction final volume annealing at lower temperatures. The Platinum Taq DNA was 25 µL, containing 5 U of enzyme, 5 pmol polymerase High Fidelity (HiFi) is an enzyme that has a of each primer, 2.5 µL of reaction buffer 10X, high fidelity in the incorporation of nucleotides due to 50 mM of MgCl , 10 mM of dNTP, 2.5 µL of sample its activity revising 3' → 5' exonuclease (proofreading) 2 and water. The reactions obeyed the following and also has the Hot-Start technology increasing the thermocycle: 94° C for 30 s, 40 cycles of 94° C for 11,12,13 specificity of the reaction . 30 s, 54° C for 30 s and 72° C for 2 min, ending with The aim of this study was to compare the 72° C for 5 min. For Platinum Taq DNA polymerase performance of three Taq DNA polymerases having HiFi, the reaction final volume was 25 µL, containing different properties for the detection of C. trachomatis: 5 U of enzyme, 5 pmol of each primer, 2.5 µL of 20 Rev Pan-Amaz Saude 2015; 6(4):19-24 Oliveira FLA, et al. Use of different Taq DNA polymerases for detection of Chlamydia trachomatis reaction buffer 10X, 50 mM of MgSO4, 10 mM of DISCUSSION dNTP, 2.5 µL of sample and water. The reactions Infection with C. trachomatis is one of the most followed thermocycle conditions: 94° C for 30 s, prevalent sexually transmitted infections (STI) today, 40 cycles of 94° C for 30 s, 54° C for 30 s and 68° C behind only the viral STI. The main problem in the ® for 2 min, ending with 68° C for 5 min (Veriti Thermal control of this STI is its asymptomatic nature and its Cycler, Applied Biosystems). The PCR products were difficult diagnosis, has long been considered as a "silent visualized using a transilluminator on agarose gel 2.0% epidemic". With the evolution of diagnostic methods, stained with GelRed™ (Biotium Inc., USA), subjected molecular techniques for detection of this pathogen – to electrophoresis. A positive control and water were such as PCR and hybrid capture – showed to be more included as a negative control in each reaction.

View Full Text

Details

  • File Type
    pdf
  • Upload Time
    -
  • Content Languages
    English
  • Upload User
    Anonymous/Not logged-in
  • File Pages
    6 Page
  • File Size
    -

Download

Channel Download Status
Express Download Enable

Copyright

We respect the copyrights and intellectual property rights of all users. All uploaded documents are either original works of the uploader or authorized works of the rightful owners.

  • Not to be reproduced or distributed without explicit permission.
  • Not used for commercial purposes outside of approved use cases.
  • Not used to infringe on the rights of the original creators.
  • If you believe any content infringes your copyright, please contact us immediately.

Support

For help with questions, suggestions, or problems, please contact us