Downloaded from genome.cshlp.org on October 6, 2021 - Published by Cold Spring Harbor Laboratory Press Technical The quantitation of mRNA expression dress these shortcomings. Syvanen et Comparison has the potential to be of critical value in al. (7) hybridized biotinylated PCR prod- of the a clinical setting but, to date, has been ucts to an oligonucleotide probe and im- limited by current quantitative PCR mobilized the complex to avidin-coated EnZ nle-Linked techniques. Many techniques evaluate beads. Saiki et al. (1~ showed that a PCR the relative differences in target product could be identified specifically Olig ucleotide amounts rather than determine the copy by hybridization to an oligonucleotide Sorbent Assay number, and there are safety and time probe immobilized on a nylon mem- concerns associated with 32p labeling of brane. The same principle has been ap- to the 32 PCR products. The recently developed plied to microtiter plate technology us- fluorescein-antifluorescein-based en- ing ELOSA by Inouye and Hondo (a~ and labeled PCR/ zyme-linked oligonucleotide sorbent as- Keller et al. (9'1~ Recently it was demon- Southern Blotting say (FAF-ELOSA) technique overcomes strated that a double-stranded PCR prod- many of these difficulties. We describe a uct obtained with a biotinylated primer Technique in comparison of results obtained by the and a fluorescein-labeled primer could 32p-labeled PCR/Southern blotting tech- be detected upon immobilization in an Quantitative nique to the FAF-ELOSA. Key features of avidin-coated plate and conjugation Analysis of the FAF-ELOSA technique include quan- with a FAF-ELOSA. (~ This technique titation by nonradioactive detection has been successfully used to measure Human and Rat based on relative amounts of PCR prod- drug resistance of human immunodefi- mRNA uct and a synthesized standard target. It ciency virus type 1 (HIV-1) isolates by is reproducible from a single cDNA prep- determining relative HIV-1 copy number aration or from samples derived from in the supernatant of cultured peripheral separate preparations. The technique blood monocytes. (12~ can easily be applied to clinical samples To our knowledge, none of these Joseph A. Carcillo, ~'2 Robert for the rapid determination of many dif- studies have used the FAF-ELOSA proto- A. Parise, 2 and Marjorie ferent specific mRNA expression studies. col to quantitate mRNA, nor have they Romkes-Sparks 2,3 We are currently applying this technique compared this quantitation with stan- for the detection of CYP450 mRNA ex- dard 3zp methodology. There have been 1Department of Anesthesiology and pression in a variety of human tissues reports that 32p incorporation into the Critical Care Medicine, 2Center for from control and cancer patient popula- PCR product shows a good correlation Clinical Pharmacology, and 3Center for tions. with slot blot (3~ and Northern blot (4~ for Environmental and Occupational Since the PCR method was first intro- the quantitation of the multidrug resis- Health and Toxicology, University of duced in 1985, (1~ the combination of re- tance gene mdr-1 expression and with in Pittsburgh, Pittsburgh, Pennsylvania verse transcription (RT) with PCR (RT- situ hybridization for progesterone re- 15261 PCR) has increasingly been utilized to ceptor mRNA. ~ In the present work we study gene expression. (2-s~ However, the compare the relative sensitivity of the use of mRNA quantitation as a clinical FAF-ELOSA with the sensitivity of the tool has been hampered by several limi- 32p-labeled PCR/Southern blotting tech- tations of currently utilized techniques, nique in quantitation of PCR products including the 32P-labeled PCR/Southern used to measure rat and human actin blotting technique. First, the 32P-labeled mRNA. Cytochrome P450 CYP2D6 and technique is considered semi-quantita- CYP2E1 mRNA expression in human he- tive rather than quantitative because of patic tissue are evaluated as an example the narrow linear range of film exposure of applying this technique to the analy- and scanning densitometry. Also, the sis of specific mRNAs of interest in clin- use of 32p precludes automated mass ical samples. analysis of clinical samples. Third, the quantitation of the target mRNA is de- pendent on the accuracy of the initial MATERIALS AND METHODS RNA quantitation and the relative effi- Primer and Standard DNA ciency of the RT. Finally, the blotting Sequences technique requires time periods that are not compatible with same day, diagno- The MacVector 4.1 (Kodak International sis-directed therapeutic interventions. Biotechnologies, Inc.) software package In addition to varying cycle number, was used to select oligonucleotide and using amplification of a control gene in standard sequences. The nucleotide se- parallel, or using a competitive template quences of the primers selected for am- as an internal control, (6) several investi- plification of [3-actin in rat (Table 1) and gators have developed biotin, fluores- [3-actin, CYP2D6, and CYP2E1 in human cein, and streptavidin techniques to ad- samples (Tables 1 and 2) are presented. 292 PCR Methods and Applications 3:292-2979 by Cold Spring Harbor Laboratory Press ISSN 1054-9803/94$5.00 Downloaded from genome.cshlp.org on October 6, 2021 - Published by Cold Spring Harbor Laboratory Press 11|1111 Technical Tips TABLE 1 Oligonucleotide Primers and Probes for Human and Rat J3-actin Primer Sequence Rat capture (ract.774Fb) GAGGCTCTCTTCCAGCCTT Rat reporter (ract.827Rf) TCATGGATGCCACAGGATTCC Rat 5' primer (ract.612F) TGAGAGGGAAATCGTGCGT Rat synthetic target ATCGGCAATGAGCGGTTCCGATGCCCCGAGGCTCTCTTCCAGCCTTCC TTCCTGGGTATGGAATCCTGTGGCATCCATGA Human capture (hact.intFb) GACAGGATGCAGAAGGAGAT Human reporter (hact.1013Rf) ATGATCTTGATCTTCATTGT Human 5' primer (hact.874F) AAACTACCTTCAACTCCATC Human synthetic target CCATGTACCCTGGCATTGCCGACAGGATGCAGAAGGAGATCACTGCC CTGGCACCCAGCACAATGAAGATCAAGGATCAT The capture probes for the PCR product tion method using an RNA isolation kit 32p End-labeling of the S' are listed, whereas the capture probes for (Stratagene, La Jolla, CA). The purity and oligonucleotide the standards are the reverse comple- quantity of the total RNA was deter- The 5' oligonucleotide was end-labeled ment. The 3' primer for human actin is a mined spectrophotometrically (Shi- with [32p]ATP with T4 polynucleotide ki- splice-junction-specific primer designed madzu UV-2101 PC UV-Vis scanning nase (U.S. Biochemical) by standard to avoid the amplification of any con- spectrophotometer). The RNA prepara- techniques. (14) taminating genomic DNA. The standard tion was treated with RNase-free DNase I oligonucleotides for both human and rat (Stratagene Cloning Systems) to digest [3-actin were synthesized to span the last any contaminating genomic DNA. PCR Amplification of cDNA 80 bp of the expected target PCR product sequence, including the 3' primer. Bi- To 1 I~1 of the cDNA product, a final con- RT of Total RNA to cDNA otin and fluorescein 5'-end labels were centration of I x PCR buffer [50 mM KC1, incorporated during oligonucleotide Total RNA was reverse transcribed and 10 mM Tris-HCl, (pH 8.3)]; 1 mM MgC12; synthesis. The biotin-labeled primers the cDNA product amplified. Briefly, 1 0.2 mM each of dATP, dCTP, dGTP, and were HPLC purified and the fluorescein- ~g of total RNA was mixed with 0.5 p.1 of dTTP; fluorescein-labeled 3' primer (0.25 labeled, and standard oligonucleotides RNasin RNase inhibitor (40 U/p.l) I~M); unlabeled 5' primer (0.25 R,M); and were purified on NAP-5 columns (Phar- (Promega) and random hexamers (2.5 2.5 units of AmpliTaq DNA polymerase macia) (refer to Fig. 1). p.M) in a total volume of 9.5 p.1. The mix- (Perkin Elmer Cetus) was added. The fi- ture was heated to 94~ for 2 min and nal reaction volume was 100 ixl (refer to cooled on ice for 5 min. To this mixture, Fig. 1). For the 3ZP-labeled PCR/Southern Tissue Collection and Total RNA a final concentration of RT buffer (lX), blotting technique, 106 cpm of 3zp end- Isolation dithiothreitol (0.01 M), and dNTP mix (1 labeled 5' primer was also added. The so- For inactivation of RNases, all solutions mM) was added to a total volume of 20 lution was overlaid with mineral oil and were treated for at least 12 hr with O. 1% ILl. The mixture was incubated at 41~ heated at 94~ for 5 min before the ad- (by volume) aqueous diethyl pyrocar- for 15 min, and 2 ~1 of Superscript RNase dition of AmpliTaq. The rat actin cDNA bonate solution. A human liver sample H- RT enzyme (200 U/pd); (GIBCO-BRL) was amplified under the following con- and a rat heart ventricle sample were fro- was added and incubated for an addi- ditions: 94~ for I min, 57~ for I min, zen at -80~ until total RNA was iso- tional 60 min at 41~ The mixture was and 72~ for 3 min, for up to 40 cycles. lated by the guanidinium thiocyanate heated to 99~ for 5 min to inactivate The human actin cDNA was amplified phenol-chloroform single-step extrac- the RT and cooled to 4~ under similar conditions, except the an- TABLE 20ligonucleotide Primers and Probes for Human CYP2D6 and CYP2E1 Primer Sequence CYP2D6 capture (2D6.148Fb) TGGGCAACCTGCTGCATGTG CYP2D6 reporter (2D6.170Rf) GGTCGAAGCAGTATGGTGTG CYP2D6 5' primer (2D6.ATG) ATGGGGCTAGAAGCACTGGT CYP2D6 synthetic target CCCACCAGGCCCCCTGCCACTGCCCGGGCTGGGCAACCTGCTGCATG TGGACTTCCAGAACACACCATACTGCTTCGACC CYP2E1 capture (2E1.67Fb) TGGAGGCAGGTGCACAGCAG CYP2E1 reporter (2E2.160Rf) TGGGAAGCGGGAAAGGGCCT CYP2E1 S' primer (2E1.ATG) ATGTCTGCCCTCGGAGTCAC CYP2E1 synthetic target GGCCTTCCTCCTGCTGGTGTCCATGTGGAGGCAGGTGCACAGCAGCT GGAATCTGCCCCCAGGCCCTTTCCCGCTTCCCA Downloaded from genome.cshlp.org on October 6, 2021 - Published by Cold Spring Harbor Laboratory Press Technical TipslllllllEE 5' 3' RNA film (XAR-2). The film was developed af- ter various exposure times and then an- reverse alyzed by scanning densitometry using transcription the Collage Analyst System (Fotodyne). 51 3' cDNA ! ............. 5 I Quantitative Analysis of the PCR amplification Fluorescein-labeled PCR Product 5' 3' with ELOSA 5'1 t"" 3' 3' 5' PCR product A standard curve was determined for 3'[~5 ' both the human and rat actin-synthe- sized 80-mer oligonucleotides with ap- ELOSA DETE(;TION propriate dilutions.