CAMPBELL BIOLOGY IN FOCUS URRY • CAIN • WASSERMAN • MINORSKY • REECE 18 Genomes and Their Evolution Lecture Presentations by Kathleen Fitzpatrick and Nicole Tunbridge, Simon Fraser University © 2016 Pearson Education, Inc. SECOND EDITION Overview: Reading Leaves from the Tree of Life . Complete genome sequences exist for a human, chimpanzee, E. coli, and numerous other prokaryotes, as well as corn, fruit fly, house mouse, orangutan, and others . Comparisons of genomes among organisms provide information about the evolutionary history of genes and taxonomic groups © 2016 Pearson Education, Inc. Genomics is the study of whole sets of genes and their interactions . Bioinformatics is the application of computational methods to the storage and analysis of biological data © 2016 Pearson Education, Inc. Figure 18.1 © 2016 Pearson Education, Inc. Concept 18.1: The Human Genome Project fostered development of faster, less expensive sequencing techniques . The Human Genome Project officially began in 1990, and the sequencing was largely completed by 2003 . Even with automation, the sequencing of all 3 billion base pairs in a haploid set presented a formidable challenge . A major thrust of the Human Genome Project was the development of technology for faster sequencing © 2016 Pearson Education, Inc. The whole-genome shotgun approach was developed by J. Craig Venter and colleagues . This approach starts with cloning and sequencing random DNA fragments . Powerful computer programs are used to assemble the resulting short overlapping sequences into a single continuous sequence © 2016 Pearson Education, Inc. Figure 18.2-s1 Cut the DNA into overlapping fragments short enough for sequencing. Clone the fragments in plasmid or other vectors. © 2016 Pearson Education, Inc. Figure 18.2-s2 Cut the DNA into overlapping fragments short enough for sequencing. Clone the fragments in plasmid or other vectors. Sequence each fragment. CGCCATCAGT AGTCCGCTATACGA ACGATACTGGT © 2016 Pearson Education, Inc. Figure 18.2-s3 Cut the DNA into overlapping fragments short enough for sequencing. Clone the fragments in plasmid or other vectors. Sequence each fragment. CGCCATCAGT AGTCCGCTATACGA ACGATACTGGT CGCCATCAGT ACGATACTGGT Order the sequences into one AGTCCGCTATACGA overall sequence with computer software. …CGCCATCAGTCCGCTATACGATACTGGT… © 2016 Pearson Education, Inc. The whole-genome shotgun approach is widely used today . Newer sequencing techniques, called sequencing by synthesis, have resulted in massive increases in speed and decreases in cost of sequencing entire genomes . These sensitive techniques allow direct sequencing of fragments without a cloning step © 2016 Pearson Education, Inc. The new sequencing techniques have facilitated an approach called metagenomics . In this approach, DNA from a group of species in an environmental sample is collected and sequenced . Computer software sorts out the partial sequences and assembles them into their specific genomes © 2016 Pearson Education, Inc. Concept 18.2: Scientists use bioinformatics to analyze genomes and their functions . The Human Genome Project established databases and refined analytical software to make data available on the Internet . This has accelerated progress in DNA sequence analysis © 2016 Pearson Education, Inc. Centralized Resources for Analyzing Genome Sequences . Bioinformatics resources are provided by a number of sources . National Library of Medicine and the National Institutes of Health (NIH) created the National Center for Biotechnology Information (NCBI) . European Molecular Biology Laboratory . DNA Data Bank of Japan . BGI in Shenzhen, China © 2016 Pearson Education, Inc. GenBank, the NCBI database of sequences, doubles its data approximately every 18 months . Software is available that allows online visitors to search GenBank for matches to . A specific DNA sequence . A predicted protein sequence . Common stretches of amino acids in a protein and a three-dimensional model of the domain © 2016 Pearson Education, Inc. Sequences of DNA or proteins can be diagrammed as an evolutionary tree based on sequence relationships . The Protein Data Bank contains all three- dimensional protein structures that have been determined . This vast array of resources can be used by researchers anywhere in the world, free of charge © 2016 Pearson Education, Inc. Figure 18.3 © 2016 Pearson Education, Inc. Understanding the Functions of Protein-Coding Genes . DNA sequence may vary more than the protein sequence does . Scientists interested in proteins often compare the predicted amino acid sequence of a protein with that of other proteins . Protein function can be deduced from sequence similarity or a combination of biochemical and functional studies © 2016 Pearson Education, Inc. Understanding Genes and Gene Expression at the Systems Level . Genomics is a rich source of insights into questions about gene organization, regulation of expression, growth and development, and evolution . A project called ENCODE (Encyclopedia of DNA Elements) has yielded a wealth of information about protein-coding genes, genes for noncoding RNA, and sequences that regulate DNA replication, gene expression, and chromatin modification © 2016 Pearson Education, Inc. Systems Biology . Proteomics is the systematic study of the full protein sets (proteomes) expressed by cells . We must study when and where proteins are produced in an organism in order to understand the function of cells and organisms . Systems biology aims to model the dynamic behavior of whole biological systems based on the study of interactions among the system’s parts © 2016 Pearson Education, Inc. Application of Systems Biology to Medicine . A systems biology approach has several medical applications . The Cancer Genome Atlas project (completed in 2010) attempted to identify all the common mutations in three types of cancer by comparing gene sequences and expression in cancer versus normal cells . This was so fruitful that it will be extended to ten other common cancers . Silicon and glass “chips” have been produced that hold a microarray of most known human genes © 2016 Pearson Education, Inc. Analyzing which genes are over- or underexpressed in cancers may allow physicians to tailor treatment to particular patients and the specifics of their cancers . Ultimately, medical records may include an individual’s DNA sequence . The use of such sequences for personalized medicine has great potential © 2016 Pearson Education, Inc. Figure 18.4 © 2016 Pearson Education, Inc. Concept 18.3: Genomes vary in size, number of genes, and gene density . To date, the sequences of thousands of genomes have been completed . Tens of thousands of genomes are in progress or considered permanent drafts . 550 metagenomes are also in progress © 2016 Pearson Education, Inc. Genome Size . Genomes of most bacteria and archaea range from 1 to 6 million base pairs (Mb); genomes of eukaryotes are usually larger . Most plants and animals have genomes greater than 100 Mb; humans have 3,000 Mb . Within each domain there is no systematic relationship between genome size and phenotype © 2016 Pearson Education, Inc. Table 18.1 © 2016 Pearson Education, Inc. Table 18.1-1 © 2016 Pearson Education, Inc. Table 18.1-2 © 2016 Pearson Education, Inc. Number of Genes . Free-living bacteria and archaea have 1,500 to 7,500 genes . Unicellular fungi have about 5,000 genes . Multicellular eukaryotes can have up to at least 40,000 genes © 2016 Pearson Education, Inc. Number of genes is not correlated to genome size . For example, it is estimated that the nematode C. elegans has 100 Mb and 20,100 genes, while Drosophila has 165 Mb and about 14,000 genes . Vertebrate genomes can produce more than one polypeptide per gene because of alternative splicing of RNA transcripts © 2016 Pearson Education, Inc. Gene Density and Noncoding DNA . Humans and other mammals have the lowest gene density, or number of genes, in a given length of DNA . Multicellular eukaryotes have many introns within genes and noncoding DNA between genes © 2016 Pearson Education, Inc. Concept 18.4: Multicellular eukaryotes have much noncoding DNA and many multigene families . The bulk of most eukaryotic genomes encodes neither proteins nor functional RNAs . Sequencing of the human genome reveals that 98.5% does not code for proteins, rRNAs, or tRNAs . About a quarter of the human genome codes for introns and gene-related regulatory sequences © 2016 Pearson Education, Inc. The DNA between functional genes includes . Unique noncoding sequence such as gene fragments . Pseudogenes, former genes that have accumulated mutations and are now nonfunctional . Repetitive DNA, present in multiple copies in the genome . Some noncoding sequences are identical in humans, rats, and mice, strongly suggesting that these sequences have important functions © 2016 Pearson Education, Inc. Figure 18.5 Regulatory Exons (1.5%) sequences (5%) Introns Repetitive (~20%) DNA that includes transposable elements and related Unique sequences noncoding L1 (44%) DNA (15%) sequences Repetitive (17%) DNA unrelated to transposable Alu elements elements (10%) (14%) Large-segment Simple sequence DNA (3%) duplications (5–6%) © 2016 Pearson Education, Inc. Transposable Elements and Related Sequences . Both prokaryotes and eukaryotes have stretches of DNA that can move from one location to another within the genome, called transposable elements . The movement of these transposable genetic elements is called transposition . About 75% of repetitive DNA is made up of transposable