Pak. J. Bot., 46(2): 585-590, 2014. SUBFAMILIAL RELATIONSHIPS WITHIN SOLANACEAE AS INFERRED FROM atpβ-rbcL INTERGENIC SPACER ISHRAT JAMIL1, SYEDA QAMARUNNISA1, ABID AZHAR1, ZABTA K. SHINWARI2, SYED IRTIFAQ ALI1 AND MUHAMMAD QAISER3 1The Karachi Institute of Biotechnology and Genetic Engineering (KIBGE), University of Karachi, Karachi, Pakistan 2Department of Biotechnology, Quaid-i-Azam University, Islamabad, Pakistan 3University of Karachi, Karachi, Pakistan Abstract A phylogenetic analysis of family Solanaceae was conducted using sequence data from the chloroplast intergenic atpβ- rbcL spacer. Sequence data was generated from 17 species representing 09 out of 14 genera of Solanaceae from Pakistan. Cladogram was constructed using maximum parsimony method and results indicate that Solanaceae is mainly divided into two subfamilies; Solanoideae and Cestroideae. Four major clades within Solanoideae represent tribes; Physaleae, Capsiceae, Datureae and Solaneae are supported by high bootstrap value and the relationships among them are not corroborating with the previous studies. The findings established that subfamily Cestroideae comprised of three genera; Cestrum, Lycium and Nicotiana with high bootstrap support. Position of Nicotiana inferred with atpβ-rbcL sequence is congruent with traditional classification, which placed the taxa in Cestroideae. In the current study Lycium unexpectedly nested with Nicotiana with 100% bootstrap support and identified as a member of tribe Nicotianeae. Expanded sampling of other genera from Pakistan could be valuable towards improving our understanding of intrafamilial relationships within Solanaceae. Introduction The traditional classification of Solanaceae revised by D’Arcy (1991) and Hunziker (2001) based on different Chloroplast genome can be used as an excellent morphological and anatomical characteristics. This marker to establish phylogenetic relationships between classification mainly recognized two subfamilies, and within plant genera and families (Dong et al., 2012; Cestroideae and Solanoideae (D’Arcy, 1979, 1991; Shinwari et al., 1994). This is because of its structural Hunziker, 1979, 2001). In the early 1990’s, phylogenetic evolution, conservation rate (Palmer, 1991; Wolfe et al., relationships within Solanaceae have been studied by 1987), large but manageable size, very rare chloroplast coding and noncoding DNA sequences and recombination, uniparental transmission and the easiness the findings challenged classical views of taxonomy and proposed some new subfamilies within Solanaceae of amplification and sequencing of the genes (Dong et al., (Martins & Barkman, 2005; Olmstead et al., 1999, 2008). 2012; Hurst & Jiggins, 2005; Khan et al., 2013). Intrafamilial relationships within Solanaceae have Chloroplast genome contains many coding and noncoding been reported based on separate or combined analysis of regions including, rbcL, atpβ, matK, ndhF, rpl16, atpβ- mapped chloroplast DNA restriction sites, sequences of rbcL, rps4-trnS, rps16, trnH-psbA, trnL-F, trnS-G, etc. rbcL and ndhF genes and some nuclear genes (Bohs & that have been used for phylogenetic re-establishment in Olmstead, 1997; Martins & Barkman, 2005; Olmstead & different plant families (Gao et al., 2008; Hilu et al., Palmer, 1992; Olmstead et al., 1999). The atpβ-rbcL 2008; Kim & Jansen, 1995; Li, 2008; Peterson et al., spacer has been used to verify the monophyly of the 2010; Shinwari et al., 1994a; Wilson, 2009). Noncoding genus Capsicum (Walsh & Hoot, 2001) and no other regions (spacers) tend to evolve more rapidly than coding studies have been demonstrated with this spacer to infer sequences in chloroplast genome (Wolfe & Sharp, 1988). any relationship within Solanaceae. In Pakistan, The atpβ-rbcL intergenic spacer separating the plastid taxonomic status of medicinally important taxa of genes atpβ and rbcL was one of the first noncoding Solanaceae has been evaluated by SDS-PAGE analysis sequences used at various taxonomic levels for (Yousaf et al., 2006, 2008), however, no precise phylogenetic reconstruction (Chiang et al., 1998; phylogenetic analysis has been established yet that Ehrendorfer et al., 1994; Hoot & Douglas, 1998; Hoot & encompasses broad representation of the family. Taylor, 2001; Janssensad et al., 2006; Manen & Natali, The focus of the present study is to infer subfamilial 1995; Manen et al., 1994; Walsh & Hoot, 2001). relationship in the family Solanaceae using molecular Solanaceae is a cosmopolitan family and its members data from chloroplast noncoding atpβ-rbcL intergenic are mostly abundant and distributed in the tropical and spacer sequence. Such studies have already been warm temperate zones (D’ Arcy, 1991; Hawkes, 1992). successfully used to elucidate taxonomic relationships of The family Solanaceae mostly contains agronomically, difficult groups (Shinwari et al., 1994b; Shinwari, 1995). medicinally and economically important plant species Materials and Methods (Edmonds & Chweya, 1997; Yousuf et al., 2006; Abbas et al., 2013; Halamova et al., 2013). The family composed of Plant materials: Representative members of different ca.96 genera and more than 3000 species worldwide (D’ genera belonging to the family Solanaceae were collected Arcy 1991) and only 14 genera and 52 species have been from their natural habitat including different regions of reported from Pakistan (Nasir, 1985). Karachi and interior Sindh (Gharo) during their flowering 586 ISHRAT JAMIL ET AL., season in the year 2011-2012. All plant specimens were consensus sequence of all genera of Solanaceae by using morphologically identified with the help of Flora of Primer3 version 0.4.0. (Rozen & Skaletsky, 1998). The Pakistan (Nasir, 1985), herbarium sheets of 17 identified sequences of primers are given in Table 2. The PCR species were prepared and deposited in the herbarium, amplification was carried out under the following University of Karachi and voucher numbers were conditions, each amplification reaction (20µl) comprised recorded. Nucleotide sequences (atpβ-rbcL) of two 1X PCR buffer, 1.5mM MgCl2, 0.2mM dNTPs, 0.6µM of species including Lycianthes rantonni and Nicandra each primer, 1 unit of DNA Taq Polymerase, 100ng DNA physalodes were retrieved from Genbank and all species template and milli-Q water was added to make up the names, locality, voucher number and GenBank accession volume. Thermal cycler (Eppendorf, Germany) was numbers are listed in Table 1. programmed with the following parameters: Initial denaturation of the template DNA at 94°C for 4 minutes, DNA Extraction: Total genomic DNA was isolated from 35 cycles each consisting of a denaturation step at 94°C fresh young leaves using modified CTAB extraction for 30 seconds, annealing step 52°C for 35 seconds and protocol (Doyle & Doyle, 1987), re-suspended in 1X Tris- extension step at 72°C for 1.5 minutes, followed by a final EDTA buffer and stored at –20°C until further use. extension step of 72°C for 10 minutes. Amplified products were purified by using PCR purification kit Primer designing and PCR amplification: For primer (Bioneer, Korea) according to the manufacturer’s protocol designing, all available atpβ-rbcL intergenic spacer and sent to a commercial laboratory (Bioneer, Korea) for sequences of family Solanaceae were retrieved from Sanger sequencing. Sequencing was performed with both GenBank and aligned using ClustalW online software forward and reverse primers in order to eliminate the (Thompson et al., 1994). Primers were designed using chances of sequencing error. Table 1. Description of collected and retrieved species of family Solanaceae from Pakistan. Genus Specific name Locality Voucher number Accession number Capsicum Capsicum frutescens L. Karachi G. H. No. 86480 KF028643 Capsicum annuum L. Karachi G. H. No. 86538 KF028647 Cestrum Cestrum diurnum L. Karachi G. H. No.86532 KF028635 Cestrum nocturnum L. Karachi G. H. No.86535 KF028636 Datura Datura innoxia Miller Karachi G. H. No. 86478 KF028642 Datura stramonium L Karachi G. H. No. 86475 KF028641 Lycium Lycium edgeworthii Dunal Karachi G. H. No.86533 KF028645 Lycianthes Lycianthes rantonnei Carr AF397086 Physalis Physalis divaricata D. Don Karachi G. H. No. 86474 KF028646 Nicandra Nicandra physalodes (L.) Gaertn AJ490882 Nicotiana Nicotiana tabacum L. Karachi G. H. No. 86537 KF028648 Solanum Solanum esculentem L. Karachi G. H. No. 86481 KF028644 Solanum forskalii Dunal Karachi G. H. No.86534 KF028640 Solanum incanum L. Gharo G. H. No.86531 KF028639 Solanum melongena L. Karachi G. H. No. 86485 KF028638 Solanum nigrum L. Karachi G. H. No. 86479 KF028637 Withania Withania coagulans (Stocks) Dunal Karachi G. H. No. 86484 KF028633 Withania somnifera (L.) Dunal Karachi G. H. No. 86476 KF028634 Table 2. Sequence of family specific atpβ-rbcL primers of Solanaceae. Primer name Sequence Tm atpβ-rbcL -F 5’ AAATGTCCGCTAGCACGTC 3’ 52°C atpβ-rbcL -R 5’ AATTAAGAATTCTCACAACAACAAGG 3’ 54°C RELATIONSHIPS WITHIN SOLANACEAE AS INFERRED FROM ATPΒ-RBCL INTERGENIC SPACER 587 Phylogenetic analysis: Nucleotide sequence (atpβ-rbcL) Results of Nicandra physalodes was used as an out group. BLASTn (Altschul et al., 1990) similarity searches were Maximum parsimony analysis includes 17 species conducted for each sequence. Multiple sequence of Solanaceae belonging to different genera of alignment of 18 species representing different genera of Pakistan and Nicandra physalodes used as an Solanaceae was performed using ClustalW (Thompson et outgroup. Of 562 total characters, 414 were constant, al., 1994). The subfamilial relationship