ORIGINAL ARTICLE Oestrogen receptor alpha gene polymorphisms relationship with semen variables in infertile men A. Zalata1, H. A. Abdalla1, Y. El-Bayoumy2 & T. Mostafa3 1 Department of Medical Biochemistry, Faculty of Medicine, Mansoura University, Mansoura, Egypt; 2 Department of Dermatology & Andrology, Faculty of Medicine, Mansoura University, Mansoura, Egypt; 3 Department of Andrology & Sexology, Faculty of Medicine, Cairo University, Cairo, Egypt Keywords Summary Hormones—male infertility—oestrogen— polymorphism—semen This study aimed to assess the association of oestrogen receptor alpha (ER-a) gene polymorphisms and semen variables in infertile oligoasthenoteratozoo- Correspondence spermic (OAT) men. In all, 141 men were grouped into fertile men (n = 60) Prof. Dr. Taymour Mostafa, Department of and infertile OAT men (n = 81). They were subjected to assessment of semen Andrology & Sexology, Faculty of Medicine, analysis, acrosin activity, serum reproductive hormones and genotyping of Cairo University, Cairo 11562, Egypt. ER-a gene. Frequencies of p and x alleles in ER-a gene PvuII and XbaI poly- Tel. +2 01005150297; Fax: +2 23654133; morphisms were more prevalent among fertile men compared with infertile E-mail: [email protected] OAT men. Presence of P and X alleles was associated with increased incidence of male infertility for genotypes PP, XX compared with genotypes pp and xx (OR = 2.8; 95% CI: 2.36–6.97; P = 0.001 and OR = 4.1, 95% CI: 1.49–11.39; P = 0.001, respectively). The mean of semen variables and sperm acrosin activ- Accepted: April 8, 2013 ity were significantly higher in cases associated with pp than PP and in xx than XX genotypes of ER-a gene. Mean levels of all serum reproductive hormones doi: 10.1111/and.12123 demonstrated nonsignificant differences in different ER-a genotypes except oes- trogen that was elevated in PP and XX ER-a gene genotypes. It is concluded that as oestrogen is concerned in male gamete maturation, ER-a gene polymor- phisms might play a role in the pathophysiology of male infertility. identified and the most abundant one, is found in all Introduction human reproductive tissues. ER-a knockout male mice The traditional view of oestradiol as the ‘female’ hormone resulted in impaired spermatogenesis and sperm produc- and of testosterone as the ‘male’ hormone has been chal- tion because of testicular atrophy and dilation of efferent lenged due to the increased interest in elucidating the role ductules due to inhibited fluid resorption (Hewitt & of oestrogens in males. Additionally, the increased interest Korach, 2003; Carreau et al., 2010). in the role of oestrogen in male reproduction stems from Kukuvitis et al. (2002) suggested that ESR1 PvuII and various reports that exposure to oestrogens in the envi- XbaI polymorphisms have an effect on azoospermic or ronment may have detrimental effects on the male repro- idiopathic severe oligozoospermic men. Guarducci et al. ductive development and/or health (Foster et al., 2008; (2006) showed that specific allelic combinations of ER-a, Zalata et al., 2008; Hofny et al., 2010). which confer a stronger oestrogen effect, may negatively Oestrogen receptors (ERs) are members of the nuclear influence human spermatogenesis. Su et al. (2010) added receptor (NR) superfamily that mediates the pleiotropic that polymorphisms of oestrogen-related genes jointly effects of oestrogen in a diverse range of developmental confer susceptibility to human spermatogenic defect at and physiological processes playing an important role in the pre-receptor, receptor and post-receptor levels. Lately, mediating oestrogen action on target tissues (El-Shafei Guido et al. (2011) added a role for E2/ERs in human et al., 2011; Filipiak et al., 2013). Two subtypes of ERs sperm physiology in modulating sperm metabolism and are known; ER-a encoded by the ESR1 gene on chromo- detrimental effects related to the pathophysiology of vari- some 6 and ERb encoded by the ESR2 gene on cocele association where Wang et al. (2011) pointed to chromosome 14 (Enmark et al., 1997). ER-a, the first that spermatogenic arrest may be related to a complex 618 © 2013 Blackwell Verlag GmbH Andrologia 2014, 46, 618–624 A. Zalata et al. ER-a gene polymorphism series of disorders in cell signal transduction involving T and E2 were estimated by enzyme immunoassay (Diag- androgen receptor (AR) and ER-a. nostics Systems Laboratories, Webster, TX, USA). This study aimed to assess the association of ER-a gene polymorphisms and semen variables in infertile men. Genotyping of ER-a DNA was extracted from EDTA anti-coagulated blood for Materials and methods PCR amplification (Cai et al., 2003). Reagents: (i) PCR- This study included 141 Egyptian men after IRB approval Master-Mix Y (PeQLab Biotechnologie GmbH, Erlangen, and informed consents. They were grouped into healthy Germany). 2x PCR-Master-Mix Y with 1.25U Taq DNA fertile men (n = 60) and infertile oligoasthenoteratozoo- polymerase/25 ll, 40 mM Tris–HCl (pH 8.55 at 25 °C), spermic men (OAT) (n = 81). Fertile men were healthy 32 mM (NH4)2SO4,4mM MgCl2, 0.02% Tween 20, volunteers that achieved conception within 1 year with 0.4 mM dNTPs mix (dATP, dCTP, dGTP, dTTP); (ii) normozoospermic semen parameters. Inclusion criteria sterile double-distilled water; (iii) two primers (Eurofins included the same ethnic origin (Caucasians). Exclusion MWG Operon, Ebersberg, Germany). criteria were varicocele, hormonal therapy, hypogona- Forward primer: 5′- CTGCCACCCTATCTGTATCTTT dism, smoking, Y chromosome deletions and karyotype TCCTATTCTCC – 3′. abnormalities. Reverse primer: 5′- TCTTTCTCTGCCACCCTGGCGT All men were subjected to history taking, clinical exam- CGATTATCTGA – 3′. ination and semen analysis. Semen analysis was carried Oligonucleotide primers were stored in the form of out twice 10 days apart after 4–5 days of sexual absti- aliquots at À30 °C until the time of use. Stock solution À nence using computer-assisted semen analysis (Auto- was diluted with sterile water to reach l0 pmol ll 1. sperm) (Fertipro, Beernem, Belgium) according to WHO Thermal cycler was used for amplification. The following guidelines (2010). Sperm morphology was evaluated by mix was prepared for each sample: 25 ll29 PCR-Mas- phase contrast microscope. Spermatozoa were separated ter-Mix Y, 30 pmol forward primer (3 ll), 30 pmol using Sil-select gradient (Fertipro N.V., Industriepark reverse primer (3 ll), 3 ll template DNA, 16 ll sterile Noord, Beernem, Belgium), and the purified spermatozoa double-distilled water to reach 50 ll. This mix was put in a were used for assessment of acrosin activity assessment. thin wall PCR microcentrifuge tube. The tube was mixed In addition, serum follicle-stimulating hormone (FSH), gently and centrifuged at 1957 g for 10 s. Amplification luteinizing hormone (LH), testosterone (T), prolactin was performed with initial denaturation at 94 °C for (PRL) and oestrogen (E2) were estimated in addition to 3 min, 36 cycles of denaturation at 94 °C for 45 s then genotyping of ER-a. annealing at 61 °C for 45 s then extension at 72 °C for 2 min and final extension at 72 °C for 7 min. Restriction endonuclease PvuII analysis: 0.5 ll(6U)of Acrosin activity assessment the restriction endonuclease PvuII (Mbiotech Inc., Seoul, Gelatin-covered slides were prepared by spreading 20ll Korea), 10 ll amplified PCR product, 2.0 ll buffer B 5% gelatin (Merck, Darmstadt, Germany) in distilled [6 mM Tris–HCl (pH 7.5 at 37 °C), 6 mM MgCl2, 50 mM water on the slides that were then air-dried, stored at NaCl, 1 mM DTT] and 7.5 ll sterile distilled water were 4 °C overnight, fixed and washed in phosphate-buffered used. The reaction mixture was incubated in 37 °C water saline (Zalata et al., 2012). Purified spermatozoa were bath for 16 h then subjected to agarose gel electrophoresis diluted 1 : 10 in PBS containing 15.7 mM a-D-glucose. (8 ll restriction analysis + 2 ll loading dye) using 2% À Semen samples were smeared on prepared slides and agarose gel containing 2 ll10mgml1 ethidium bro- incubated in a moist chamber at 37 °C for 2 h. The halo mide for 1 h at 70 V. In agarose gel of digested products diameter around any 10 spermatozoa in the ejaculate was of ER-a gene by PvuII restriction enzyme, PP genotype measured in phase contrast with an eyepiece micrometer. indicated absent PvuII restriction site from both alleles The halo formation rate was calculated/slide as the per- giving one band at 1.30 kb, pp genotype indicated pres- centage of spermatozoa showing a halo evaluating 100 ence of PvuII restriction site on both alleles, giving two spermatozoa. Acrosin activity index was calculated by bands at 0.85, 0.45 kb and Pp genotype indicated multiplying the halo diameter X the halo formation rate. presence of PvuII restriction sites on one of the two alleles, giving three bands at 1.30, 0.85, 0.45 kb (Fig. 1). Restriction endonuclease XbaI analysis: 1 ll (10 U) of Reproductive hormones estimation the restriction endonuclease XbaI (Fermentas Inc, Glen Blood samples were used to separate sera for FSH, LH, PRL Burnie, MD, USA), 10 ll amplified PCR product, 2.0 ll by enzyme-linked immunosorbent assay where serum total 10 9 buffer tango [33 mM tris-acetate (pH = 7.9), 10 mM © 2013 Blackwell Verlag GmbH 619 Andrologia 2014, 46, 618–624 ER-a gene polymorphism A. Zalata et al. Lane 1 Lane 2 Lane 3 Lane 4 Lane 5 Lane 6 Lane 7 Lane 8 1500 1300 1000 850 900 800 700 600 500 Fig. 1 Agarose gel of digested products of 450 ER-a gene by PvuII restriction enzyme. PP 400 genotype indicated absence of PvuII restric- tion site from both alleles giving one band at 300 1.30 kb (lanes 4, 6). pp genotype indicated presence of PvuII restriction site on both alleles, giving two bands at 0.85 kb, 0.45 kb 200 (lanes 3, 5, 8).