ONCOLOGY LETTERS 21: 95, 2021 P4HB: A novel diagnostic and prognostic biomarker for bladder carcinoma YUCAI WU1‑4*, YIJI PENG1‑4*, BAO GUAN1‑4, ANBANG HE1‑4, KUNLIN YANG1‑4, SHIMING HE1‑4, YANQING GONG1‑4, XUESONG LI1‑4 and LIQUN ZHOU1‑4 1Department of Urology, Peking University First Hospital; 2Institute of Urology, Peking University; 3National Urological Cancer Center; 4Urogenital Diseases (Male) Molecular Diagnosis and Treatment Center, Peking University, Xicheng, Beijing 100034, P.R. China Received May 30, 2020; Accepted October 23, 2020 DOI: 10.3892/ol.2020.12356 Abstract. Prolyl 4‑hydroxylase, beta polypeptide (P4HB) expressed in BLCA cells and tissues. The area under the curve protein is an endoplasmic reticulum (ER) molecular chap‑ value for P4HB expression to discriminate between tumor erone protein and has been reported to be overexpressed in and normal tissues was up to 0.888 (95% CI: 0.801‑0.975; multiple tumor types. However, the role of P4HB in bladder P<0.001) and 0.881 (95% CI: 0.825‑0.937; P<0.001) in TCGA cancer (BLCA) has not yet been elucidated. The aim of database and our database, respectively. Furthermore, the the present study was to investigate the prognostic value of expression level of P4HB was an independent risk factor for P4HB and the association between clinicopathological char‑ overall survival (OS) and recurrence‑free survival (RFS) by acteristics and P4HB in BLCA. P4HB expression levels were univariate and multivariate analyses. Kaplan‑Meier survival assessed through The Cancer Genome Atlas (TCGA) and analysis demonstrated that high P4HB expression was asso‑ Gene Expression Omnibus (GEO) databases, and validated ciated with low OS and RFS. Pathway enrichment analysis by reverse transcription‑quantitative polymerase chain reac‑ suggested that P4HB was involved in protein processing in tion (RT‑qPCR) and western blot analysis in BLCA tissues and the endoplasmic reticulum (ER), including N‑glycan modifica‑ cells. A total of 69 pairs of tumor and normal samples were used tion and protein metabolic processes responding to ER stress. to analyze the expression of P4HB via immunohistochemical PPI analysis revealed that the potential targets of P4HB were staining. A co‑expression network and functional enrichment mainly involved in posttranslational protein modification and analyses were conducted to investigate the biological func‑ response to ER stress. In conclusion, the expression level of tion of P4HB in BLCA. The protein‑protein interaction (PPI) P4HB aid in identifying patients with early‑stage BLCA and network was constructed by Search Tool for the Retrieval of predicting the prognosis of BLCA. Therefore, P4HB may be a Interacting Genes. The results showed that P4HB was highly novel diagnostic and prognostic biomarker for BLCA. Introduction Bladder cancer (BLCA) is the fourth most common malignancy Correspondence to: Dr Yanqing Gong or Dr Xuesong Li, in males and it has high incidence and mortality rates despite Department of Urology, Peking University First Hospital, 8 Xishiku improvements in its management over the past decade (1,2). Street, Xicheng, Beijing 100034, P.R. China E‑mail: [email protected] Non‑muscle invasive bladder cancer is the most common type E‑mail: [email protected] of BLCA because its low progression rates lead to longer patient survival times (3). However, 25‑30% of bladder tumors *Contributed equally are found to be muscle invasive at the time of diagnosis and these patients often have a poor prognosis despite optimal Abbreviations: BLCA, bladder cancer; P4HB, prolyl 4‑hydroxylase, treatment (4,5). The prognosis of BLCA is determined by the beta polypeptide; TCGA, The Cancer Genome Atlas; GEO, Gene initial tumor stage, but patients do not show specific symptoms Expression Omnibus; RT‑qPCR, reverse transcription‑quantitative in the early stages of BLCA. Therefore, identifying promising polymerase chain reaction; IHC, immunohistochemistry; OS, overall early molecular markers has an enormous application potential survival; RFS, recurrence‑free survival; ER, endoplasmic reticulum; for monitoring the onset of malignant tumors and improving GEPIA, gene expression profiling interactive analysis; GO, gene the clinical strategies for managing BLCA. ontology; KEGG, Kyoto Encyclopedia of Genes and Genomes; GSEA, gene set enrichment analysis; PPI, protein‑protein interaction; P4HB, also known as protein disulfide‑isomerase; is a NES, normalized enrichment score multifunctional protein that catalyzes the formation, breakage and rearrangement of disulfide bonds. It acts as a molecular Key words: prolyl 4‑hydroxylase, beta polypeptide, bladder cancer, chaperone that aids in ameliorating misfolded proteins in diagnostic, prognostic marker, ER stress response to ER stress (6). In addition, upregulation of P4HB has been reported in certain cancer types and overexpression 2 WU et al: P4HB: A NOVEL DIAGNOSTIC AND PROGNOSTIC BIOMARKER FOR BLADDER CARCINOMA of P4HB may promote the progression of malignant tumors, forward, 5'‑GGAGCGAGATCCCTCCAAAAT‑3' and reverse, including gastric cancer, clear cell renal cell carcinoma and 5'‑GGCTGTTGTC‑ATACTTCTCATGG‑3'. The PCR reac‑ colon cancer (7‑9). P4HB inhibition has been associated tion was performed as follows: 94˚C for 30 sec, then 40 cycles with chemosensitivity in glioblastoma multiforme via the at 94˚C for 5 sec and at 60˚C for 30 sec. All experiments were endoplasmic reticulum stress response pathways (10,11). In repeated at least three times. The relative expression level was addition, P4HB‑knockdown sensitized glioblastoma to radio‑ calculated by using 2‑ΔΔCq method (13). therapy by leading to ER stress and downregulating RAD51 gene expression (12). However, little is known regarding the IHC. The 5‑µm sections were cut from paraffin‑embedded association between P4HB and BLCA. The present study tissue samples, deparaffinized in xylene and rehydrated in therefore analyzed the prognostic value of P4HB and the asso‑ a descending alcohol series. Next, the sections were heated ciation between clinicopathological characteristics and P4HB (120˚C) for 20 min in citrate buffer (10 mmol/l; pH 6.0). in BLCA. Following treatment with 3% hydrogen peroxide to block the endogenous peroxidase activity, 10% normal goat serum was Materials and methods applied to reduce non‑specific binding for 1 h at room temper‑ ature. Subsequently, the sections were incubated with primary Tissue samples. A total of 69 BLCA tissues and adjacent rabbit anti‑human P4HB polyclonal antibody (1:10,000; cat. tissues were obtained from patients (age range, 37‑91 years; no. ab137110; Abcam) at 4˚C overnight. The sections were then mean age, 64.1 years) with BLCA at the Department of incubated with peroxidase‑conjugated secondary antibodies Urology, Peking University First Hospital who underwent (1:1,000; PV‑9000; OriGene Technologies, Inc.) for 20 min radical cystectomy between January 2007 and November 2012. at room temperature. All slides were washed three times Patients who were lost to follow‑up and had missing data were and then the PowerVision™ two‑step histostaining reagent excluded. The database included a population of 44 males and and the 3,3‑diaminobenzidine tetrahydrochloride substrate 25 females and the pathological diagnosis of these patients was kit (Zhongshan Golden Bridge Biotechnology) were used to transitional cell carcinoma. The histological characteristics of visualize the localization of the antigen according to the manu‑ these samples were evaluated by hematoxylin‑eosin staining facturer's protocol. Two experienced independent pathologists and confirmed by experienced urological pathologists. Fresh examined all tumor slides by examining three random fields of samples were fixed with 4% paraformaldehyde for 12‑24 h at view using a light microscope at x400 magnification (Olympus room temperature and then paraffin‑embedded for immuno‑ Corporation). The intensity of cellular staining was assigned histochemistry (IHC). The present study was approved by the a score of 0 (negative), 1 (weak), 2 (moderate) and 3 (strong). Biomedical Research Ethics Committee of Peking University The proportion of stained tumor cells was scored as 0 (0‑5%), First Hospital and written informed consent was obtained 1 (6‑25%), 2 (26‑50%), 3 (51‑75%) or 4 (>75%). The multiplica‑ from all patients. tion of these two variables was calculated as the final score. Cell culture. The cell lines (SV‑HUC‑1, T24, SW780 and 5637) Western blotting. Total proteins were extracted from cell were obtained from the American Type Culture Collection lines using NP‑40 lysis buffer, quantified using BCA protein and cultured according to the manufacturer's protocols. The assay reagent (Pierce; Thermo Fisher Scientific, Inc.), and normal human urinary tract epithelial SV‑HUC‑1 cell line was loaded onto 10% SDS gels (20 µg/lane). Proteins in the gel cultured in F‑12K medium (Gibco; Thermo Fisher Scientific, were transferred onto PVDF membranes (EMD Millipore) Inc.), while the T24 and SW780 cell lines were cultured in following electrophoresis. Following blocking at room temper‑ Dulbecco's modified Eagle's medium (Gibco; Thermo Fisher ature for 1 h with 5% skimmed milk, the membranes were Scientific, Inc.) and the 5637 cells were cultured in RPMI‑1640 incubated overnight at 4˚C with an antibody against P4HB (Gibco; Thermo Fisher Scientific, Inc.). All media contained (1:1,000; cat. no. ab137110; Abcam), followed by horseradish 10% fetal bovine serum (Gibco; Thermo Fisher Scientific, peroxidase‑labeled anti‑rabbit