Supporting Information Millay et al. 10.1073/pnas.1600101113 SI Materials and Methods GG-3′ and TMEM8a-R: 5′-TCAGGTCACTGTGTACAACTC-3′; Cell Culture and Primary Myoblast Isolation. C2C12 cells were and TMEM8b-F: 5′-ATGAACATGCCCCAGTCACTA-3′ and purchased from American Type Culture Collection and propa- TMEM8b-R: 5′-TCAGCTGACACAGATGCTGC-3′.Human gated in DMEM (Sigma) containing 10% heat-inactivated FBS and zebrafish myomaker cDNAs were synthesized by GenScript and supplemented with antibiotics; 10T1/2 fibroblasts were also and cloned into pBabe-X. purchased from American Type Culture Collection and passaged in the same media. C2C12 cells were differentiated by switching RNA Analysis. Total RNA was extracted from either mouse to media containing 2% heat-inactivated horse serum and antibiotics. tissue or cultured cells with TRIZOL (Invitrogen) and cDNA- All solutions described as a percentage are based on vol/vol. Primary synthesized using SuperScript III Reverse Transcriptase with LacZ/loxP myoblasts were isolated from myomaker ;Pax7-CreERT2 mice random hexamer primers (Invitrogen). Gene expression was after treatment with vehicle (WT) or five injections of tamoxifen assessed using standard quantitative PCR approaches with (KO) at a dose of 0.075 mg/g body weight. After dosing with either Power Sybr Green or Taqman Master Mix (Applied Bio- vehicle or tamoxifen, the gastrocnemius and tibialis anterior systems). Analysis was performed on a 7900HT Fast Real-Time were injured with cardiotoxin (10 μM; Sigma). Three days after PCR Machine (Applied Biosystems) with the following Sybr primers: Myomaker-F: 5′-ATCGCTACCAAGAGGCGTT-3′ injury, muscles were harvested and placed into gentleMACS C ′ ′ Tubes (Miltenyi Biotec) containing 2% collagenase (Type I; and Myomaker-R: 5 -CACAGCACAGACAAACCAGG-3 ; Tmem8a-F: 5′-CCAGCAACAGCAAGGAGAG-3′ and Tmem8a-R: Invitrogen) in low-glucose DMEM (Invitrogen). To dissociate 5′-GCTGCCATACCAGCTGTAGA-3′;andTmem8b-F:5′-TTAA- muscle, the C tubes were placed on a Miltenyi GentleMACS TGTCCGTGTGGGTCAC-3′ and Tmem8b-R: 5′-CAGAGCCAT- Dissociator and subjected to two cycles of digestion. Dispase AGACAGCAGCA-3′. As an internal control, 18S was used. (4.8 units/mL; Roche) was added to the digested muscle, in- cubated at 37 °C for 2 h, triturated using a pipette and 20-gauge μ Retroviral Generation and Cell Mixing. Ten micrograms of retroviral needle, passed through a 40- m filter, and centrifuged. The plasmid DNA was transfected using FuGENE 6 (Roche) into mononuclear cells were preplated for 20 min to remove non- Platinum E Cells (Cell Biolabs), which were plated on a 100-mm myoblast populations and then, plated on a collagen-coated plate culture dish at a density of 3 × 106 cells per dish 24 h before in growth media (20% FBS/Ham F10, 2.5 ng/mL bFGF; In- transfection. Forty-eight hours after transfection, viral media vitrogen). To enrich for myoblasts, cultures were incubated in a were collected, filtered through a 0.45-mm cellulose filter, and small volume of PBS, and the myoblasts were dislodged by mixed with Polybrene (Sigma) at a final concentration of 6 μg/mL. knocking the plate lightly. To induce myogenesis, the cultures For live staining experiments, C2C12 cells were plated on 35-mm were placed in differentiation media (2% horse serum, DMEM). culture dishes at a density of 1 × 105 cells per dish 24 h before infection with 3 mL viral media. Eighteen hours after infection, CRISPR-Mediated Genome Editing in C2C12 Cells. Freshly plated low- μ virus was removed, and cells were washed with PBS, which was passage C2C12 cells were transfected with 4 g pX330 (with replaced with differentiation media; 10T1/2 fibroblasts (∼50–60% myomaker guide RNA) and 4 μg pcDNA3-EGFP using 16 μL × 6 confluent on a 100-mm plate) were infected with 10 mL virus for Lipofectamine 2000. We transfected 1 10 C2C12 cells in a 18 h. After infection, cells were washed three times, trypsinized, 60-mm culture dish, and the medium was changed 16 h post- mixed with C2C12 cells at a 1:1 ratio (1.5 × 105 each cell type), transfection. Forty-eight hours after transfection, we sorted sin- + and plated on a 35-mm dish in 10% FBS and DMEM. The cul- gle GFP cells into 96-well plates using FACS. These cells were tures were differentiated the next day, and GFP and myosin ex- maintained in DMEM containing 20% FBS with antibiotics at pression were analyzed 4 d after differentiation. subconfluent densities. The cell lines were genotyped by ampli- fying a 435-bp region surrounding the predicted site of Cas9 RNA FISH. To detect myomaker expression at all stages of cell activity using the following primers: F: 5′-CAGTGCTGAG- differentiation, cultures were fixed (10 min at room temperature TCTGAAAGGGATA-3′ and R: 5′-TAAGCTCTGCAAAG- in 3.7% formaldehyde in PBS) at 24 h after seeding (day 0) and CAGCAAG-3′. This PCR product was then digested with NspI then, at 24-h intervals (days 1–3) followed by RNA FISH. After to genotype for editing of exon 2 of myomaker. An amplicon fixation, cells were washed twice with PBS and permeabilized in 70% from a WT clone (NspI site maintained) exhibited 317- and 118-bp ethanol for at least 1 h at 4 °C. Cells were subsequently incubated in bands after digestion, and an amplicon from a KO clone (NspI site Buffer A (2× SSC, 10% formamide) at room temperature for 5 min disrupted) remained at 435 bp. and then, hybridized with 125 nM probe in hybridization buffer (2× SSC, 10% formamide, 10% dextran sulfate) in humidified dark Cloning and Viral Infection. Each myomaker-FLAG construct was chambers at 37 °C for 16 h. After hybridization, cells were incubated generated by independently cloning the regions immediately in Buffer A for 30 min at 37 °C. Nuclei were stained with 6 ng/mL upstream (5′ PCR product) and downstream (3′ PCR product) Hoechst in Buffer A for 30 min at 37 °C. Cells were subsequently of the site of insertion and then, using these products in a standard incubatedin2× SSC at room temperature. Images were acquired PCR sewing reaction to generate full-length myomaker-FLAG within 5 h posthybridization with Nikon A1R+ LUNV on a Ti-E plasmids. The FLAG nucleotide sequence used was GATTA- Inverted Microscope. A set of probes specific to myomaker introns CAAGGATGACGACGATAAG, and for each internal FLAG with Quasar 570 Dye was designed using Stellaris Probe Designer, construct, we engineered a glycine–glycine–serine linker on both version 4.1 (Table S2). For GFP RNA FISH, commercially available sides of the epitope to aid in protein folding. The signal sequence Stellaris FISH Probe eGFP with Quasar 570 Dye was used. used upstream of FLAG was ATGAAGACGATCATCGCCC- TGAGCTACATCTTCTGCCTGGTGTTCGCC as previously Western Blot Analysis. Cells were washed two times with ice-cold described (27). TMEM8a was cloned from adult kidney cDNA, PBS and scraped into an Eppendorf tube. The cells were pelleted and TMEM8b was cloned from adult brain cDNA using the fol- and resuspended in lysis buffer (50 mM Tris·Cl,pH7.4,150mM lowing primers: TMEM8a-F: 5′-ATGGGCCGGGTTGGGGCCG- NaCl,1%TritonX-100,1%NonidetP-40,0.1%SDS).Protein Millay et al. www.pnas.org/cgi/content/short/1600101113 1of7 concentration was determined. and equal amounts (50 μg) were cubation with Alexa-Fluor secondary antibodies for 1 h. We used prepared with loading buffer [1× Laemmli (Bio-Rad) with 5% anti-mouse M2 Flag antibody (Sigma) at 1:500 and myosin an- β-mercaptoethanol]. Samples were incubated at room temper- tibody (MY32; Sigma) at 1:200. Nuclei were stained with Hoechst ature for 5 min (not boiled) and separated by 12% SDS/PAGE. (Invitrogen). For staining of live cells, we first washed the cells After SDS/PAGE, the gel was transferred to a PVDF membrane with PBS and incubated in blocking buffer (3% BSA/PBS) for Millipore), blocked in 5% milk in Tris-buffered saline (TBS)-Tween, 15 min. Primary antibody incubation was then performed on ice and incubated with M2 FLAG antibody (1:5,000; Sigma). GAPDH followed by fixation with 4% PFA/PBS and incubation with sec- (1:10,000; Millipore) was used as a loading control. We used a rabbit ondary antibody. These cultures were visualized on a Zeiss LSM anti-mouse secondary antibody conjugatedtoHRPfordetection. 780 Confocal Microscope. ImageJ was used to merge images. Immunocytochemistry. Immunocytochemistry was performed by Statistical Analyses. All data are presented as means with SEMs fixing cells with 4% paraformaldehyde (PFA)/PBS, permeabili- and were performed in replicates multiple times as indicated in zation with 0.2% Triton X-100 in PBS, blocking with 3% BSA/ the figures. P values were calculated using unpaired t test using PBS, incubation with primary antibody for at least 2 h, and in- GraphPad Prism 6 software. P < 0.05 was considered significant. Fig. S1. Genomic deletion of myomaker exon 2 after CRISPR/Cas 9 mutagenesis. A 435-bp fragment within exon 2 was amplified from genomic DNA from each myomaker KO clonal cell line and ligated into a shuttle vector (TOPO vector). Ten TOPO clones were then sequenced to identify the insertions or deletions after nonhomologous end joining (NHEJ) repair of the double-strand break. The missing nucleotides are indicated by dashes, and the total number of nu- cleotides disrupted is shown at the end of each line. For clones 1A3 and 1B1, the repair differed for each allele (displayed as A and B sequences). Sequencing of 10 TOPO clones from 1B5 showed the same sequence, suggesting identical repair of both alleles. Millay et al. www.pnas.org/cgi/content/short/1600101113 2of7 Fig. S2. Myomaker epitope-tagged constructs do not rescue fusion defect in myomaker KO myoblasts. (A) Myomaker KO myoblasts were infected with various myomaker-FLAG constructs and induced to differentiate.