US 20190323078A1 ( 19) United States (12 ) Patent Application Publication ( 10) Pub . No. : US 2019 /0323078 A1 McKernan et al. ( 43 ) Pub . Date: Oct. 24 , 2019 ( 54 ) REAGENTS , METHODS, AND LIBRARIES Publication Classification FOR BEAD -BASED SEQUENCING (51 ) Int. Cl. C120 1 /6874 ( 2006 .01 ) (71 ) Applicant : APPLIED BIOSYSTEMS, LLC , C120 1 /6869 ( 2006 . 01) Carlsbad , CA (US ) C120 1 /6844 (2006 . 01 ) (72 ) Inventors : Kevin McKernan , Woburn , MA (US ) ; C120 1 /68 ( 2006 .01 ) Alan BLANCHARD , Middleton , MA B82Y 30 / 00 ( 2006 . 01 ) (US ) ; Lev KOTLER , Allston , MA B82Y 15 / 00 ( 2006 .01 ) (US ) ; Gina COSTA , Carlsbad , CA C12Q 1 /6837 (2006 . 01) (US ) ( 52 ) U . S . CI. CPC . .. .. .. C12Q 1 /6874 (2013 .01 ) ; C12Q 1 /6869 (2013 .01 ) ; C12Q 1 /6844 ( 2013 .01 ) ; C12Q (21 ) Appl. No. : 16 / 405 ,534 1 /6837 (2013 .01 ) ; B82Y 30 /00 (2013 .01 ) ; B82Y 15 / 00 ( 2013 .01 ) ; C12Q 1/ 68 ( 2013. 01 ) May 7 , 2019 (22 ) Filed : (57 ) ABSTRACT The present invention provides methods for determining a Related U . S . Application Data nucleic acid sequence by performing successive cycles of (63 ) Continuation of application No . 15 /291 , 982, filed on duplex extension along a single stranded template . The Oct. 12 , 2016 , now Pat. No . 10 , 323 , 277 , which is a cycles comprise steps of extension , ligation , and , preferably , continuation of application No. 14 /057 ,055 , filed on cleavage . In certain embodiments the methods make use of Oct. 18 , 2013 , now Pat . No . 9 ,493 , 830 , which is a extension probes containing phosphorothiolate linkages and continuation of application No . 13 / 737 ,534 , filed on employ agents appropriate to cleave such linkages . The Jan . 9 , 2013 , now Pat . No . 9 ,217 , 177 , which is a invention provides methods of determining information continuation of application No. 12 /628 , 209 , filed on about a sequence using at least two distinguishably labeled Nov . 30 , 2009 , now abandoned , which is a continu probe families . In certain embodiments the methods acquire ation of application No . 12 /220 , 201 , filed on Jul. 21 , less than 2 bits of information from each of a plurality of 2008 , now abandoned , which is a continuation of nucleotides in the template in each cycle . In certain embodi application No . 11 / 345 , 979 , filed on Feb . 1 , 2006 , ments the sequencing reactions are performed on templates now abandoned . attached to immobilized beads. The invention further pro (60 ) Provisional application No . 60 /722 , 526 , filed on Sep . vides sets of labeled extension probes containing phospho 30 , 2005 , provisional application No . 60 /699 , 541 , rothiolate linkages . In addition , the invention includes per filed on Jul . 15 , 2005 , provisional application No . forming multiple sequencing reactions on a single template 60 /673 , 749, filed on Apr. 21, 2005 , provisional ap by removing initializing oligonucleotides and extended plication No . 60 /656 , 599, filed on Feb . 25 , 2005 , strands and performing subsequent reactions using different provisional application No. 60 /649 ,294 , filed on Feb . initializing oligonucleotides . 1 , 2005 . Specification includes a Sequence Listing . Patent Application Publication Oct. 24 , 2019 Sheet 1 of 56 US 2019 /0323078 A1 ???????FIG . powood1A 31 300 on n 4151w * w ANNEALLIGATE w w Gerhabalababababah w w ww * TIFY /CLEAVEI MAMA w w w ANNEALLIGATE w w w w w w m IDENTIFYICLEAVE m m m m m VImm mmw + + + + + + + + + + Patent Application Publication Oct. 24 , 2019 Sheet 2 of 56 US 2019 /0323078 A1 FIG . 1B1 30. 31 30 _ _ - 20 10 41 i 51 ANNEALLIGATE A zza 100 oso IDENTIFY / CLEAVE wwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwww z wwwwwwwwwwwwwwwwww wwwwwwwwww120 00 ANNEAL /LIGATE CONTRO har 2 . 2 . 2 . 201. + 52 * IDENTIFY /CLEAVE + + + + Patent Application Publication Oct. 24 , 2019 Sheet 3 of 56 US 2019 /0323078 A1 FIG . 2 COLOR 5 RED ? ? ? ? ? YELLOWwwwwwwwwwwwwwwwwwwww w N N N N N GREEN * * * N N N N N BLUE NN NN N T Patent Application Publication Oct. 24 , 2019 Sheet 4 of 56 US 2019 /0323078 A1 ???FIG . 3A ?? 71 ?? + + + + + + + + ?? ????????????????????? ?????????????????????? ??????????? ?? ??? ????????? + + + + + + + + + + + ???? ? ?? ??? ??? ??????? ?????????? ???? www ??????? ?????????? Patent Application Publication Oct. 24 , 2019 Sheet 5 of 56 US 2019 /0323078 A1 Yobooob jana ?? GCCG ? ? ? FIG.3B DouboooAcoTE ForradooTEMPLATEACCAAATGGCACCCAATTIIGCATCCCAGGGGCATTACCGAATGGAGCCGTATO oooooor TA6 boos Primer5(1-4)C Primer2(n-1) Primer3(n-2) Primer4(n-3) Primer6(n-5)A Primer1 Patent Application Publication Oct. 24 , 2019 Sheet 6 of 56 US 2019 /0323078 A1 Cleavable linkerA Base VO Base w + + + + + + + 0000OOOOOOOOOOOOOOOOOOOOSamman + + + + + + + + , Phosphorothiolate linkage S - P bond cleaved by Ag + under mild conditionsproga FIG . 4A Patent Application Publication Oct. 24 , 2019 Sheet 7 of 56 US 2019 /0323078 A1 Cleavable0000 linkerNw Base . :MONTERR wwwwwwwww 1BBase Phosphorothiolate linkage43 Y Y S - P bond cleaved by Ag + under mildWU M conditions FIG . 4B Patent Application Publication Oct. 24 , 2019 Sheet 8 of 56 US 2019 /0323078 A1 5 'S scheme Hexamers of the form : 5 ' - O - P - 0 - X - O - P - S - NNNNN * . 3 " 5 ' -O - P -0 - X -O - P - S-NNN NNNNN8 no * - 31 - 60 Hybridize 30 5 ' NNNNNNNNNNNNNta cu - OH TATUTINTLIINNNNNNN RIINIINTAT TXT VINNNN forma Ligate (e . g ., Tth ), cap by polymerase extension , and cleave ( e. g ., Ag + ) pland hangLand 5 NNNNNNNNNNNNNXLA - O - P - 0 10 VIVVIRTAT{agy Cum ta N VIN1 Phosphatase 3 .1V dia TR Y TNTYTTET LY V NNNN V MIVVINA 1 FIGboooooo . 5A 3 ' S scheme Hexamers of the form : 5 ' Ng * NNNN - S - PO- X - OH - 3 ' 5 ' Ng * NNNN - S- P - O - X -OH - 3 ' Hybridize 30 O - P - O -NNNNNNNNNNNNNN 3 NNNNNNNNNNNNNYNNNNNNNNNNNNNNwo Ligate ( e . g . ,T4 ) Phosphatase treat unligated templates Cleave ( e .g ., Ag + ) O -PO -XNNNNNNNNNNNNNN 100 3 NNNNNNNNNNNNNYNNNNNNNNNNNNNNy V 1 ** * 50 FIG . 5B Patent Application Publication Oct. 24 , 2019 Sheet 9 of 56 US 2019 /0323078 A1 CleavebridgingP-Sbondwith Hybridizeprimer.AddDNA ligasewithfour5-endlabeled octamershavingdifferent3 basesandfluorescentlabels. Useofinosines()oruniversal Imagebeadsandrecordfirst basedownstreamoftheprimer bedu!basesdecreasescomplexityof octamerlibrary. afterligationofthecorrect CCXXXXXXXCCWwwwwwwwwwwwwwwwww silvernitratetoreleaseBead) fluorophoreandexposea5' Step1:Ligate Step2:Image octamer. Step3:Cleave phosphate. 3'(Bead) G-NISI1 L C-NIsl KALMAROKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKKLACULAMALLAXACAXACAKAKALIKACAKLACKALMACAXALLALILACCXXXWWWXWALLACCWXWWXXANAXXXWWWWWXXXALLWWXXX.CWCWCXXXXXXXXXXKLUKKAVUUR 200 XXWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWX WWWWWWWWWWWW T-NISI TemplateSequence TemplateSequence TemplateSequence Sequencingbycycledoligonucleotideligationandcleavage 3 7p5'A-NIS11 . A-NISI1 AgNO3AgNO3 . XXX WWWX MIX Ligase th LIL WWW . MAAR AXON wy OU an NSTALACIONES O fo K.XXXWAAR PARA WKIAATITIL ANNARS Erion Shehe AdapterSequence AdapterSequence www AdapterSequence war wir KULU AAAAAAAAA WWW . + XXXXXXX Primer Primer XWEDY. Primer TXAKURIS & & FIG.6A ???????????????? FIG.6B & OXXXXXXXXXXXXXX FIG.6C WWWWWWWWWW Patent Application Publication Oct. 24 , 2019 Sheet 10 of 56 US 2019 /0323078 A1 WWW.WOO terminatingatthen-2,134 ofbases(e.g,-1612 additionalcyclesofligationand terminatingatthen-1position 18,24303642485460 thesequenceofevery6thbase 31,37434955616773 Step5:ResetPrimer;RepeatCycles 66,727884after15cycles). Steps6-9:RepeatResets/Cycles Step4:RepeatLigation/cleavage (e.g,bases17131925 Heat-stripextendedstrands. andrepeatligation/cleavage Repeatstep5usingprimers andn-5positionstoreadthe (2EndReads-170bases) Extendstrandbyperforming cycle15cleavageusingthesamesetoflabeledoctamers.Determine 79,85after15cycles) interveningbases. ReadLength-85bases ????????????????????????????????????????????????????????????????. primernewHybridizea15cycle 3(Bead)cyclestosequencethenextset '(Bead) Bead)(3'* 15Cycle* 3 cycle4 cycle3. Y-NISH 19 Ligase & om . www 18 ????????????????????????????????????? cycle2Cycle34. Ligase 1G-CAT A-NIY1NCTsl 12 IC-NAGNSI - Bergsson GALICILAA 6 Cycle2cycle1 ???????????????????????????????? (n-1)cyclecycie23 -5 P ta WA AAAAAAAAAIATU hành thi X WWWWW Basepositionn-1 XX XXX *XKKOMMUNE CHRIWWWwww celu SELURUHwwwwwwwww .4 wwwwwwww Primer-5)(n XXXK KKKKKKXXXXXXXXXXXX MITTALIGINIAI* KICHAKAXKACXX. Baseposition Baseposition A ??????????????????????????? Primer:_3 -JULIANNINGEN China WA wwwwwwwwwwwwwwwwwwww FIG.6D FIG.6E FIG.6F * poocoon * * ??????? * bootoval Patent Application Publication Oct. 24 , 2019 Sheet 11 of 56 US 2019 /0323078 A1 NABZ CSSN kumised DMTO DMTO Triflicanhydride Pyridine/DCM Naci/Triethylamine DCM NABZ Phos.Reagent/Tetrazole NHBZ V NHBZ N BzCl/pyridine NHB7 ? 4 1.NaOHIEIOHDMTO 2.PyrilDowex NNaOH/EtOH,DMTO SynthesisSchemefor3'-ThiophosphoramiditesofdAanddG NABZ NWBZ WWWWWWWWW HOpyridine!/TMSC.1 wwwwwwwwwwww 3.MCOH/H20 SCOPH 2.Bz20 DMTO. DMTO. wwwwwwwwww PhCOSC FIG.7 DMTCI Pyridine Patent Application Publication Oct. 24 , 2019 Sheet 12 of 56 US 2019 /0323078 A1 * * * oligiotgtcrcact5'' *ARRA11 * XXXXXXXX* +9bpexactmatch nuk > = = R 16 = E * 2ndcleavable FAMPrimer FAMPrimer|+9bpoligo : 2 : * : * * * - * - : z : 2 * +8bpcleavageproduct bodohuwunurddobogbouwwoodwooowwwwwwwwwwwwwwwwwwwwwwwww FAMPrimer LNUDUMA*#ANAK +4bpcleavageproduct XXXWWWwwww Oligio WWWWWWYN FAMPrimer ww 3'tgctrotct5 XWA* +13bpligationproduct *XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX #*WAK1stcleavable w FAMPrimer wwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwww