SUPPLEMENTARY INFORMATION Yeast strain constructions Strain CHY01 was constructed by introducing HO URA3 plasmid YCp50-HO into strain H1895 for mating type switching. The resulting diploid was transformed with a sui1::hisG-URA3-hisG disruption cassette contained on pCFB01 to delete chromosomal SUI1. The diploid was than transformed with sc SUI1 LEU2 plasmid pCFB02. Sporulation and tetrad dissection were carried out to select a Ura+ Leu+ ascospore. Uracil auxotrophy was regained by growing the ascospore clone on 5-fluoro-orotic acid (5-FOA) plates, and the resulting strain was transformed with sc SUI1 URA3 plasmid p1200. pCFB02 was eliminated by growing in YPD medium, to yield strain CHY01. Strain JCY03 was constructed by crossing CHY01 with a Leu+ transformant of H2995 harboring YCplac111 and conducting sporulation and tetrad dissection to isolate Trp- Leu+ His- Ura+ ascospores that are unable to grow on 5-FOA medium and are resistant to sulfometuron (GCN2+). The strain was then plated on YPD to lose the LEU2 plasmid and thereby obtain strain JCY03. Plasmid constructions and site-directed mutagenesis. Construction of plasmid pCFB01 containing the sui1::hisG-URA3-hisG disruption cassette was as follows. Sequences immediately 5’ of the SUI1 ORF were amplified by PCR using primers CHA28 (GCAGATCTGAATTCATTCTGGACATCCTG) and CHA29 (GGCGGTTTCGTCGGATCCTGTGTCGGCG), introducing EcoRI and BamHI restriction sites (sequences underlined) at the ends of the fragment. Sequences immediately 3’ of the SUI1 ORF were amplified with primer CHA26 (CATTGTCAAGGATCCAGAAATGGGGG) and CHA27 (CAGATTCAAATCGGTCGACCCCATGATAATG), introducing BamHI and SalI restriction 1 sites at the ends. The PCR products were double-digested with the corresponding restriction enzymes, vector pUC18 was double digested with EcoRI and SalI, and plasmid pNKY51 (Alani et al. 1987) containing the hisG::URA3::hisG cassette was digested with BamHI (to liberate the cassette on a BamHI fragment), and a ligation reaction was carried out with all four fragments to produce pCFB01. LEU2 plasmids p4389 and pCFB03 containing His-SUI1 were constructed as follows. A PCR product was amplified from SUI1 plasmid p1200 using the “upstream” primer CHA22 (5’ CCGGGTCGGAAGCTTAAACCAGTGACAC) and the “downstream” primer CHA182 (5’ GATTTCAGATTCTCAATGGAGTGGTGGTGGTGGTGGTGCATACGATTTGCTTCAGCT ATATTAATATATTCC), which contains a novel HindIII site present 5’ of the SUI1 ORF and the complement of the coding sequences for the His6 tag immediately following the ATG start codon. p1200 was also amplified with the upstream primer CHA183 (5’ GAAGCAAATCGTATGCACCACCACCACCACCACTCCATTGAGAATCTGAAATCATTT GATCC) and downstream primer CHA27 (5’ CAG ATTCAAATCGGTCGACCCCATGATAATG) to produce a fragment with the coding sequences for the His6 tag and a novel SalI site downstream of the SUI1 ORF. The two PCR products were joined by fusion PCR using primers CHA22 and CHA27 and the resulting fragment was double-digested with HindIII and SalI and inserted between the corresponding sites in hc LEU2 vector YEplac181 to make p4389, and into sc LEU2 vector YCplac111 to make pCFB03. Mutations were introduced into the His-SUI1 allele on p4389 or pCFB03 by PCR fusion using the mutagenic primers listed in Table S2. For example, to construct pCFB101, plasmid pCFB03 was amplified with primers CHA33 (GCTCACTCATTAGGCACCCCAGGC) and 2 CHA102 (Table S2) as well as with primers CHA101 (Table S2) and CHA34 (GTTGGGAAGGGCGATCGGTGCGG). The PCR products were joined by fusion PCR, double digested with HindIII and SalI and cloned into YCplac111, yielding pCFB101. The same strategy was employed to construct mutant plasmids pCFB129, pCFB130 and pCFB134. For mutant plasmids pJCB01 and pJCB03, the GeneTailorTM site-directed mutagenesis system (Invitrogen) was employed with the corresponding primers listed in Table S2 and using pCFB03 as template. pJCB02 and pJCB04 were constructed by digesting pJCB01 and pJCB03 with HindIII and XbaI and inserting the His-SUI1 fragments into YEplac181. To construct plasmids for expressing recombinant His6-eIF1 proteins from the T7 promoter, pCFB03, pCFB101 and pCFB129 were amplified with primer JCO-01 (CGCCGCCATATGCACCACCACCAC), to introduce a NdeI restriction site at the 5’ end of the ORF, and primer JCO-02 (CCCAAGCTTTTAAAACCCATGAAT), to introduce a HindIII restriction site at the 3’ end of the SUI1 ORF. The product was double digested with NdeI and HindIII and cloned into the vector pT7-7 to obtain pJCB05, pJCB06 and pJCB07. pJCB08 was constructed in the same manner but primer JCO-02-2 (CCCAAGCTTTTAAAACCGATGAAT) was used instead of JCO-02. Biochemical assays with yeast extracts For measuring luminescence in WCEs of strains harboring pRaugFFuug, cells were lysed with Passive Lysis Buffer (Promega) for 40-60 min and luminescence was measured with a BMG FLUOstar OPTIMA 96 well plate reader. The instrument injects firefly luciferase buffer (15 mM Tris [pH 8.0], 25 mM glycylglycine, 4 mM EGTA, 2 mM ATP, 1 mM DTT, 15 mM MgSO4, 0.1 mM CoA, 75 M luciferin, final pH adjusted to 8.0), measures luminescence, then 3 injects renilla luciferase buffer (0.22 M citric acid-sodium citrate buffer [pH 5.0], 1.1 M NaCl, 2.2 mM Na2EDTA, 0.44 mg/ml BSA, 1.3 mM NaN3, 1.43 M coelenterazine, final pH adjusted to 5.0), which quenches the firefly reaction and provides the substrate for the renilla reaction. For analysis of polysome profiles and fractionation of native PICs from cross-linked cells, WCEs were made from 300 ml of cells grown to an OD600 of 1.0 in SC medium. Cells were transferred to a 500 ml centrifuge tube containing 75 g of shaved ice and the tube was inverted five times. HCHO was added to 1% and the tube was inverted 10 times and left on ice for 1 h. Glycine was added to 0.1 M and the cells were collected by centrifugation for 10 min at 7000 rpm in a Sorvall RC5B rotor. The pellet was resuspended in 7 ml of buffer B (20 mM Tris (pH 7.5), 50 mM KCl, 10 mM MgCl2) supplemented with EDTA-free protease inhibitor tablet (Roche), 5 mM NaF, 1 mM dithiothreitol, 1 mM phenylmethylsulfonylfluoride (PMSF). The cell suspension was transferred to a 15 ml conical tube and centrifugated for 5 min at 4200 rpm in a Beckman J-6B centrifuge and the supernatant was decanted. One vol of cells was resuspended in 1.3 vol of buffer B and 1.3 vol of glass beads, and cells were lysed by vortexing eight times for 30 s with 30 s intervals on ice. The lysate was centrifugated for 5 min at 4200 rpm and the supernatant was transferred to an Eppendorf tube. The extract was cleared by two consecutive centrifugations at 13,000 rpm for 5 and 10 min in an Eppendorf 5415D centrifuge, collecting the supernatant while avoiding the lipid layer at the top and the pellet. The WCEs were separated by sedimentation through sucrose gradients as described previously (Asano et al. 2000). For analysis of 43S complexes, 700 μL fractions were collected, mixed with 6X loading dye [300 mM Tris-HCl pH 6.8, 12% (w/v) SDS, 0.6% (w/v) bromophenol blue, 60% (v/v) glycerol and 600 mM -mercaptoethanol] and boiled for 10 min to reverse the cross-links. 20 μL samples were separated on 4-20% Tris-Glycine polyacrylamide gels (Criterion, BioRad). After 4 electroblotting to nitrocellulose membranes, membranes were probed with polyclonal antibodies against the appropriate initiation factors and 40S ribosomal proteins. Antibodies against eIF3b, eIF5, eIF2 (Phan et al. 1998), eIF2 (Dever et al. 1992), eIF1A (Olsen et al. 2003) and eIF1 (Valasek et al. 2004) have been described. RPS2 antibody (generated in rabbit) was kindly provided by Jon Warner. For resedimentation experiments, the conventional protocol was followed except that twofold-greater A260 units of WCEs were resolved on the gradient and, following the first sedimentation, the 40S fractions were pooled, diluted with 10 volumes of buffer B supplemented with 1mM dithiothreitol, concentrated using an Amicon Ultra-4 centrifugal filter device (Millipore), and sedimented through a second sucrose gradient under the same conditions used for the first gradient separation. Biochemical assays in the reconstituted yeast system Reagent preparation Initiation factors eIF1, eIF1A, eIF5 and mutant variants of these proteins were purified using the IMPACT system for purification of intein fusion proteins as described (Algire et al. 2002). eIF1A and eIF1 were labeled using expressed protein ligation (Maag and Lorsch 2003). His- tagged eIF2 was overexpressed in yeast and purified as described (Algire et al. 2002). 40S subunits were purified as described previously (Algire et al. 2005). Model mRNAs of the sequences 5-GGAA[UC]7UAUG[CU]10C-3 and 5-GGAA[UC]7UUUG[CU]10C-3 were synthesized using T7 polymerase run-off transcription and purified by denaturing polyacrylamide gel electrophoresis as described (Lorsch and Herschlag 1999). Yeast initiator tRNA was synthesized from a hammerhead fusion template using T7 polymerase run-off 5 35 transcription, as described (Algire et al. 2005), and [ S]Met-tRNAi and stoichiometrically- charged Met-tRNAi were prepared as described (Kapp and Lorsch 2004). 43S Complex Formation Assays Gel shift assays were performed as described previously (Algire et al. 2002). Experiments 35 measuring the rate of TC binding were performed with limiting S-Met-tRNAi (0.5 nM) and saturating GDPNP (1 mM), eIF2 (200 nM), eIF1 (1 M), eIF1A (1 M) and mRNA(AUG) (2 M) or mRNA(UUG) (50 M) and 10 nM 40S subunits. Reactions were stopped with a chase of unlabeled ternary complex. This chase prevented additional labeled TC from forming 43S complex, keeping the reaction from progressing. The chase was made at 6X concentration and consisted of 6 mM GDPNP, 2.1 M eIF2, 900 nM unlabeled Met-tRNAi with buffer as described above. Controls indicate that the chase is stable for many hours, and that labeled 43S complex is stable for longer than one hour after chasing. A control in which the chase was added before the labeled TC demonstrated that the chase was effective.