African Journal of Microbiology Research Vol. 4(9), pp. 820-829, 4 May, 2010 Available online http://www.academicjournals.org/ajmr ISSN 1996-0808 © 2010 Academic Journals Full Length Research Paper Isolation and molecular characterization of phosphate solubilizing Enterobacter and Exiguobacterium species from paddy fields of Eastern Uttar Pradesh, India Arvind Kumar, Poonam Bhargava and Lal Chand Rai* Molecular Biology Section, Laboratory of Algal Biology, Center of Advanced Study in Botany, Banaras Hindu University, Varanasi-221005, India. Accepted 15 April, 2010 Six phosphate solubilizing bacteria (PSB) were isolated from paddy fields of Eastern Uttar Pradesh, India harboring low available phosphorus. Taxonomic delineation employing morphological, biochemical, 16S rRNA gene sequences and phylogenetic affiliations suggests that they are members of Enterobacter and Exiguobacterium genera. Of the six isolates, Enterobacter sp. LCR1 and LCR2 exhibited high level (568 - 642 g/ml) of phosphate solubilization in NBRIP liquid medium. Exiguobacterium sp. LCR4 and LCR5 showed increased phosphate solubilization efficiency under alkaline pH while Enterobacter sp. LCR3 remained unaffected. At high salt and temperature, Enterobacter sp. LCR1 and LCR2 produced 1.6 fold soluble phosphorus in comparison with earlier studies. Thus, these isolates may be useful for the development of potential bio-inoculants for soils having alkaline pH, high salt, temperature and insoluble phosphorus. Key words: Phosphate solubilizing bacteria, phylogenetic analysis, Enterobacter spp., Exiguobacterium spp., 16S rRNA gene sequencing. INTRODUCTION Injudicious agricultural practices and canal irrigation have Bacillus, Enterobacter, Azotobacter, Agrobacterium, not only disturbed the soil nutritional balance but also Achromobacter, Rhizobium, Burkholderia, Flavobacte- caused a significant increase in soil salinity and pH. Of rium and Microccocus isolated from the temperate the 400 - 1200 mg/kg of soil phosphorus present in countries have been reported to solubilize phosphorous agricultural fields (Rodríguez and Fraga, 1999), a large (Jeon et al., 2003; Rodríguez and Fraga, 1999; Son et fraction of this is locked in an insoluble form and only al., 2006) but their establishment and performance is <10% enters the plant-animal cycle (Kucey et al., 1989). largely hampered by environmental variables like salinity, Phosphatic fertilizers being very expensive, Indian pH and temperature. Thus these phosphate solubilizers farmers are compelled to cut down its application are highly unlikely to be successful in the Indian context. (Sundara et al., 2002). Further, since phosphorus availa- It is also known that the inocula developed from a bility from the phosphate reserves under neutral and particular soil fail to function as efficiently in soils having alkaline conditions is negligible, phosphate solubilizing different properties (Rodríguez and Fraga, 1999). Not- microbes assume special significance for ensuring withstanding, above the characterized phosphate availability of locked phosphate reserves in the soils (Patil solubilizing bacteria (PSBs) were identified only by one or et al., 2002). two approaches, that is, biochemical characteristics Several bacterial genera including Pseudomonas, and/or 16S rRNA gene sequencing (Pérez et al., 2007; Yi et al., 2008). Some reports dealing with the isolation and characterization of phosphate solubilizing bacteria are *Corresponding author. E-mail: [email protected] or also available from the Indian peninsula (Souza et al., [email protected]. Tel: +91-542-6701110. Fax: +91-542-2368174. 2000; Johri et al., 1999). However, these isolates were Kumar et al. 821 neither characterized at the molecular level nor their Isolation of phosphate solubilizing bacteria phylogenetic affiliations determined. Nevertheless, Indian isolates have been named after the name of the institute Bacterial isolation was carried out from each soil sample after homogenously suspending in sterile saline solution (0.85% sodium (National Botanical Research Institute, Lucknow, India) chloride). Aliquots of 106 diluted samples (serial dilutions) were such as NBRI1, NBRI2 etc where the work had been spread on Pikovskaya’s agar medium (Pikovskaya, 1948) and conducted but the physicochemical properties of the soils incubated in temperature controlled incubator shaker (Model-3597- ICOGMPR) at 30°C for 3 days. To avoid fungal contamination, 50 have never been analyzed. Thus this restricts their use at the national and international levels. µg/ml cycloheximide was added to the medium before plating (Black et al., 2003). Eleven colonies producing clear halos were selected While salinity affected area in India is estimated to be and purified on AT salt minimal medium (Johri et al., 1999). Six about 13 million hectare, the site selected for this study, colonies displaying differential phosphate solubilization in NBRIP Eastern Uttar Pradesh, is further affected by alkalinity liquid medium (Nautiyal, 1999) were further characterized in detail. (http://www.irri.org/cure/lowlandWG3.htm). In tropical countries including India, temperature during summer and rainy season ranges between 35 - 45°C, salt level in Morphological and biochemical characterization alkaline soil goes up to 2% and pH up to 10.5 unit Morphology was studied by gram staining under compound micro- (Nautiyal et al., 2000). Since rice is a staple crop in scope (KYOWA GETNER, OPTO-PLAN 2KT, Japan) having the different parts of the world including India and its demand facility of live image transfer to computer. Biochemical characteriza- is likely to increase ~ 35% by 2030 (FAO, 2002), there is tion of the isolated strains was carried out according to Brenner and a pressing need to isolate efficient PSBs, capable of Farmer (2005), Collee et al. (1996) and López-Cortés et al. (2006). proliferation in saline, alkaline soil distressed with high Utilization of different carbon sources was studied following addition of 50 mg/l of tetrazolium chloride as colour indicator to the basal temperature and characterize them by polyphasic growth medium (Janisiewicz and Bors, 1995). approach, and complimented with physicochemical properties of the resident soils. This paper reconciles the above points and presents novel data on the isolation DNA isolation and polyphasic characterization of PSBs and DNA was isolated using the phenol/chloroform/isoamyl alcohol Enterobacter capable of phosphate solubilization at high method (http://www.bio.vu.nl/geomicrob/protocols/) with slight temperature, salt and alkaline pH. modifications. Briefly, one ml of overnight grown culture was centrifuged at 8000 rpm for 5 min. The pellet was washed twice with TE buffer (Tris-HCl 10 mmol/l, EDTA 1 mmol/l, pH 8.0) and MATERIALS AND METHODS suspended in 567 µl TE buffer containing 2 mg/ml lysozyme. The suspension was incubated in a temperature controlled water bath at Soil sampling 37°C for 30 min. This was followed by addition of 3 µl proteinase K (20 mg/ml) and 30 µl of 10% SDS and incubated at 37°C for 1 h in Three soil samples were collected from paddy fields of Eastern a water bath. 100 µl of 5 mol/l NaCl was added and mixed Uttar Pradesh, India (82° 59’ East, 25° 15’ North and 82° 33’ East, thoroughly. To this, pre-warmed 80 µl of cetyl trimethyl ammonium 25° 8’ North). For each sample, three sub-samples (0 - 10 cm depth bromide (CTAB, 10%) was added and then incubated at 65°C for and 4 cm diameter) were collected and mixed thoroughly. These 10 min. Now samples were allowed to cool down to room tem- samples were stored in the laboratory at -70°C in a deep freezer perature and equal volume of phenol/chloroform/isoamyl alcohol (Krispcold, India). (25:24:1) was added and vortexed gently. This was subjected to centrifugation at 12000 rpm for 5 min at 4°C and the upper aqueous phase was aspirated out. Soil analysis Equal volume of chloroform/isoamyl alcohol (24:1) was now added to the aqueous phase, mixed by gentle vortexing and Soil samples were homogenously suspended in double distilled centrifuged at 12000 rpm for 5 min at 4°C. The clear aqueous water in the ratio of 1:2 (wet w/v) and centrifuged at 5000 rpm for 5 phase was precipitated using double volume of chilled ethanol and min at 25°C. Electrical conductivity (EC) and pH were measured one tenth volume of 3 mol/l sodium acetate (pH 5.2). Samples were from clear supernatants using conductivity meter 306 and pH left overnight at -20°C (Vestfrost deep freezer, Blue Star, India) to SYSTEM 361, respectively, of Systronics, India. allow DNA precipitation. Precipitated DNA pellet was collected by Total phosphorus present in the air dried soil samples was centrifugation at 12000 rpm for 10 min at 4°C. Pellet was washed extracted by strong acid (mixture of concentrated H2SO4:HClO4; with 70% ethanol and air dried followed by suspension in 100 µl of 4:1) digestion using V2O5 as a catalyst (López-Gutiérrez et al., TE buffer (Tris-HCl 10 mmol/l, EDTA 1 mmol/l, pH 8.0). The DNA 2004). Samples were digested by soil/acid mixture (1:30) in a fume sample so prepared was qualitatively checked on 0.8% agarose gel hood on hot plate at 80°C. After digestion, the final volume was and stored at -20°C for further work. made up to 25 ml by adding double distilled warm water. The available form of phosphorus was extracted with addition of 200 mg activated charcoal at a soil/NaHCO3 (0.5 mol/l, pH 8.5) ratio of 1:20 PCR amplification and sequencing of 16S rRNA gene (Olsen et al., 1954). The samples were shaken at 100 rpm in a tem- perature controlled incubator shaker at 25°C for 1 h. Both types of The PCR amplification of the partial genes encoding 16S rRNA was extraction samples were filtered through Whatman No.1 filter paper carried out in an Icycler (Bio-Rad, USA). Primers 8F: and extract was acidified (for available phosphorus only) to pH 5.0 AGAGTTTGATCCTGGCTCAG and 518R: using concentrated H2SO4. The extracted phosphorus in the clear ATTACCGCGGTGCTGG (Benlloch et al., 2002) were commercially supernatant was determined by molybdophosphoric acid method synthesized from Sigma Chemical Co., USA.