
J Med Genet 1999;36:57–58 57 Short reports J Med Genet: first published as 10.1136/jmg.36.1.57 on 1 January 1999. Downloaded from A small interstitial deletion in the GPC3 gene causes Simpson-Golabi-Behmel syndrome in a Dutch-Canadian family Jian Y Xuan, Rhiannon M Hughes-Benzie, Alex E MacKenzie Abstract prisingly, a family member with the apparent Deletions in the heparan sulphate proteo- stigmata of SGBS including Wilms tumour glycan encoding glypican 3 (GPC3) gene appeared not to inherit the SGBS chromosome have recently been documented in several in a previous linkage study.2 The definition of Simpson-Golabi-Behmel syndrome the GPC3 mutation has allowed the unequivo- (SGBS) families. However, no precisely cal documentation of a normal GPC3 status in defined SGBS mutation has been pub- this child. lished. We report here a 13 base pair DNA (extracted from peripheral blood and deletion which causes a frameshift and tumour tissues) was obtained from members of premature termination of the GPC3 gene the SGBS family and unrelated controls. PCR in the Dutch-Canadian SGBS family in amplification of exon 2 of the GPC3 gene was whom the trait was originally mapped. Our performed using the oligonucleotide primers analysis shows that a discrete GPC3 disa- EX2 A (5' gtttgccctgtttgccatg 3') and EX2 B (5' bling mutation is suYcient to cause SGBS. caaataatgatgccactaagc 3') producing a 329 bp Furthermore, our finding of a GPC3 nor- fragment in normal subjects.8 The reactions mal daughter of an SGBS carrier with contained 1 µg of DNA, 50 ng of each primer, skeletal abnormalities and Wilms tumour 0.2 mmol/l of each of the four dNTPs (dATP, raises the possibility of a trans eVect from dCTP, dGTP, and dTTP), and 1.2 U of Ta q the maternal carrier in SGBS kindreds. DNA polymerase in a total of 25 µl. Reactions were denatured at 94°C for four minutes (J Med Genet 1999;36:57–58) http://jmg.bmj.com/ followed by 30 cycles at 94°C for one minute, Keywords: Simpson-Golabi-Behmel syndrome; glypi- 60°C for one minute, 72°C for one minute, and can 3; Wilms tumour extension at 72°C for 7.5 minutes. The PCR products were cloned (TA cloning kit, Invitro- gen) and sequenced using the PRISMTM dye Simpson-Golabi-Behmel syndrome (SGBS) is terminator cycle sequencing core kit with Molecular Genetics an X linked condition characterised by pre- and AmpliTaq@ DNA polymerase, FS (ABI). The Laboratory, Children’s postnatal overgrowth, coarse facies, congenital primer used for sequencing was EX2 A. All on September 23, 2021 by guest. Protected copyright. Hospital of Eastern heart defects, cleft lip and palate, enlarged and Ontario, Ottawa, DNA sequencing was performed on an Applied dysplastic kidneys, skeletal abnormalities, and Biosystems 373A automated DNA sequencer. Ontario K1H 8L1, 1 Canada an increased risk of embryonal tumours. A A preliminary indication of the mutation site A E MacKenzie Dutch-Canadian SGBS family including 13 in this Dutch-Canadian family has been shown J Y Xuan female carriers and seven aVected males with by a failure of an exon 2 PCR using exonic typical SGB syndrome has been previously primers (fig 5, family a in reference 3). To Departments of reported. Three children under the age of 2 Biochemistry and define the molecular lesion fully, we conducted 12 8 Pediatrics, University developed Wilms tumour in this kindred. PCR with intronic primers. The aVected male of Ottawa, Ottawa, Recently, a membrane associated heparan was found to generate a smaller band on agar- Ontario K1H 8M5, sulphate proteoglycan, glypican 3 (GPC3), has ose gel in comparison to the normal control. Canada been identified as the SGBS gene.3 GPC3 is a Sequencing of the subcloned PCR products A E MacKenzie member of the glypican related integral mem- showed a 13 bp deletion of nucleotides brane proteoglycans (GRIPS) which are linked Southern Alberta 391-403 in exon 2 (fig 1) predicted to generate Cancer Research to the cell surface via glycosyl phosphatidylinosi- a frameshift with a premature stop codon at nt Centre, University of tol and modulate the interaction between 445-447 (TAA) resulting in a truncated 79 Calgary, Calgary, growth factors and receptors.3–5 GPC3 encodes amino acid protein. An ApaI restriction site at Alberta T2N 4N1, a protein of 580 amino acids and, despite a nt 401-406 was disrupted by the deletion. Canada comparatively small 2.3 kb transcript, spans Digestion of the PCR products with ApaI R M Hughes-Benzie more than 500 kb of genomic sequence. showed 180 and 149 bp bands for normal con- Correspondence to: Deletions in the GPC3 gene have been found in trols, a single 316 bp fragment for aVected Dr MacKenzie. a number of SGBS kindreds supplying strong subjects, and all three bands for carriers (fig 2). evidence that such mutations are responsible for The long range deletions observed in some Received 13 March 1998 367 Revised version accepted for SGBS. We report here the mutational analy- SGBS kindreds, the large size of the GPC3 publication 26 May 1998 sis of the Dutch-Canadian SGBS family. Sur- gene itself, combined with the multisystemic 58 Xuan, Hughes-Benzie, MacKenzie J Med Genet: first published as 10.1136/jmg.36.1.57 on 1 January 1999. Downloaded from Figure 2 ApaI digestion of PCR products. The top panel is the partial pedigree of the Dutch-Canadian SGBS family. BL: DNA extracted from blood. WT: DNA extracted from Wilms tumour. The patterns of the ApaI digestion are shown below the pedigree. PCR products amplified with EX2 A and EX2 B from aVected males, carrier, and control DNA from the family were digested with ApaI and run on a 2% agarose gel. Wilms tumour patients in this kindred (data not shown). One model which would link somatic overgrowth to embryonal tumorigenesis in SGBS is a simple increase in mitotic activity leading both to hyperplasia and increased somatic recombination frequency predisposing Figure 1 Sequence analysis of the normal and mutant alleles. Both normal and mutant to 11p loss of heterozygosity. However, the alleles were PCR amplified with EX2 A and EX2 B, cloned with TA cloning kit observation of both normal birth weight and (Invitrogen), and sequenced with EX2 A. The comparison of the sequences from the patient (A) with normal (B) shows a 13 bp deletion in exon 2. growth in the non-SGBS girl with Wilms tumour suggests that, if there is SGBS maternal nature of SGBS have raised the possibility of carrier mediated increase in malignant potential, mutations in contiguous genes contributing to the mechanism probably involves more than the disease phenotype. The identification of simply increased mitotic activity. Irrespective of this discrete deletion in a SGBS family strongly the precise mechanism, the data in our report suggests that mutations in GPC3 alone are suf- show that a discrete disabling mutation of GPC3 ficient to cause the disorder. is suYcient to cause SGBS and that such a In our original SGBS mapping paper, a mutation in a carrier mother may impart young girl with multiple thoracic hemiverte- features of SGBS including Wilms tumour in http://jmg.bmj.com/ brae, a Sprengel’s deformity of her right shoul- oVspring with a normal GPC3 gene. der, and Wilms tumour unexpectedly appeared not to carry the SGBS mutation (V.1, fig 1 in We thank the members of the Dutch-Canadian SGBS family for both their DNA and their continuing collaboration in this study reference 2) although her genotype could not and the service laboratory in CHEO for helping with the DNA be ascertained with certainty. Notwithstanding extraction. This work was supported by grants from the National Cancer Institute of Canada (NCIC) and the the phenotype and in contrast to her brother Children’s Hospital of Eastern Ontario (CHEO). with Wilms tumour, neither leucocyte nor on September 23, 2021 by guest. Protected copyright. Wilms tumour genomic DNA carry the GPC3 1 Hughes-Benzie RM, Hunter AGW,Allanson JE, MacKenzie AE. Simpson-Golabi-Behmel syndrome associated with exon 2 deletion in this young girl (see 011 in fig renal dysplasia and embryonal tumour: linkage to 2). The non-segregation of the GPC3 mutation Xq21>qcent. Am J Med Genet 1992;43:428-35. 2 Xuan JY, Besner A, Ireland M, Hughes-Benzie RM, and Wilms tumour suggests that the somatic MacKenzie AE. Mapping of Simpson-Golabi-Behmel syn- overgrowth and the tumorigenesis may be drome to Xq25-27. Hum Mol Genet 1994;3:133-7. 3 Pilia G, Hughes-Benzie RM, MacKenzie A, et al. Mutations involved in diVerent pathological pathways. It in GPC3, a glypican gene, cause the Simpson-Golabi- is possible that the risk factors derived from the Behmel overgrowth syndrome. Nat Genet 1996;12:241-7. 4 David G. Integral membrane heparan sulfate proteoglycans. maternal SGBS carrier contribute to embryo- FASEB J 1993;7:1023-30. nal tumorigenesis during intrauterine life with 5 Song HH, Shi W, Filmus J. OCI-5/rat glypican-3 binds to fibroblast growth factor-2 but not to insulin-like growth raised levels of substrates in the maternal factor-2. J Biol Chem 1997;272:7574-7. circulation normally suppressed by GPC3 6 Hughes-Benzie RM, Pilia G, Xuan JY, et al. Simpson- Golabi-Behmel syndrome: genotype/phenotype analysis of crossing the placenta and influencing embryo- 18 aVected males from 7 unrelated families. Am J Med nal development. Consistent with a maternal Genet 1996;66:227-34. 7 Lindsay S, Ireland M, O’Brien O, et al. Large scale deletions tumorigenic eVect is the observation of an in the GPC3 gene may account for a minority of cases of equal incidence of Wilms tumour concordance Simpson-Golabi-Behmel syndrome.
Details
-
File Typepdf
-
Upload Time-
-
Content LanguagesEnglish
-
Upload UserAnonymous/Not logged-in
-
File Pages2 Page
-
File Size-