Erysiphe trifolii Causing Powdery Mildew of Lentil (Lens culinaris) Renuka N. Attanayake, Department of Plant Pathology, Washington State University, Pullman; Dean A. Glawe, Department of Plant Pathology, Washington State University and College of Forest Resources, University of Wash- ington, Seattle; and Frank M. Dugan and Weidong Chen, USDA-ARS, Washington State University, Pullman times die (1). Infection by L. taurica re- ABSTRACT sults in lesions of varying size on leaves Attanayake, R. N., Glawe, D. A., Dugan, F. M., and Chen, W. 2009. Erysiphe trifolii causing and stems, with areas of infection display- powdery mildew of lentil (Lens culinaris). Plant Dis. 93:797-803. ing dense, felt-like mycelium. The taxonomy of the species of powdery The taxonomy of the powdery mildew fungus infecting lentil in the Pacific Northwest (PNW) of mildew infecting lentil in the United States the United States was investigated on the basis of morphology and rDNA internal transcribed has not been critically examined. This spacer (ITS) sequences. Anamorphic characters were in close agreement with descriptions of study was initiated to clarify which species Erysiphe trifolii . However, teleomorphs formed chasmothecial appendages with highly branched of powdery mildew infects lentil in the apices, whereas E. trifolii has been described as producing flexuous or sometimes loosely branched appendages. Branched appendages have been described in Erysiphe diffusa, a fungus PNW. Because lentil plants used in genet- reported from species of Lens, Glycine, and Sophora, raising the possibility that the PNW fungus ics and breeding research frequently are could be E. diffusa. Examination of morphological characters of an authentic specimen of E. grown in greenhouses as well as in fields, trifolii from Austria determined that it included chasmothecial appendages resembling those this study included comparison of strains seen in PNW specimens. Furthermore, ITS sequences from five powdery mildew samples col- in the greenhouse with the lentil powdery lected from lentils in PNW greenhouses and fields from 2006 to 2008 were identical to one an- mildew occurring in the field. other, and exhibited higher similarity to sequences of E. trifolii (99%) than to those of any other Erysiphe spp. available in GenBank. Parsimony analysis grouped the lentil powdery mildew into MATERIALS AND METHODS a clade with Erysiphe baeumleri, E. trifolii, and E. trifolii–like Oidium sp., but indicated a more Fungal samples. Seven samples of distant relationship to E. diffusa. In greenhouse inoculation studies, the lentil powdery mildew powdery mildews were used in this study fungus did not infect soybean genotypes known to be susceptible to E. diffusa. The pathogenicity (Table 1). Four samples (LGH06, LGH07, of E. trifolii on lentil was confirmed using modified Koch’s postulates. This is the first report of LGH07-119, and LGH N07) were col- E. trifolii infecting lentil. E. diffusa and E. trifolii have different host ranges, so the discovery of lected from three separate greenhouses E. trifolii on lentil has implications both for determining species of powdery mildews on cool- during 3 years (2006 to 2008). The green- season grain legumes, and in disease management. houses are separated by a minimum of 500 m. One sample (LSP07) was collected from a lentil field near Pullman, Whitman Lentil (Lens culinaris Medik.) is a staple in India during January and February (1). Co., WA. One sample (Soy08) of powdery food crop in many developing countries. In Powdery mildew has been a persistent mildew from wild soybean (Glycine sp.) the United States, lentil is an important disease problem of lentil breeding materi- was obtained from the USDA Soybean rotational crop in cereal-based production als in the greenhouse (6), and poses a Germplasm Collection at the University of systems in the Pacific Northwest (PNW) threat to precious lentil breeding materials Illinois, Urbana. These samples were used and in the Northern Great Plains. The crop such as F1 plants. for morphological and molecular studies. faces several major biotic stresses which Erysiphe pisi DC. is the powdery mil- An authentic specimen of E. trifolii, WSP limit yield, including Ascochyta blight dew pathogen that has been reported (often 70928, determined by U. Braun and origi- (caused by Ascochyta rabiei (Pass) Labr.), as E. communis auct. or E. polygoni auct.) nating from GZU Dupla Fungorum (27), Botrytis gray mold (caused by Botrytis on lentil from various parts of the world was also used for morphological compari- cinerea Pers. ex. Fr.), Fusarium root rot including Argentina, Chile, India, Italy, sons. (caused by several Fusarium spp.), and Jordan, Mexico, Romania, Sudan, Tanza- Morphological characterization. Symp- Rhizoctonia root rot (caused by Rhizocto- nia, and the former USSR (3,12,15). tomatic leaves of all the powdery mildew nia solani Kühn) (5,24). Leveillula taurica (Lév.) Arnaud has been samples were examined under ×100 to Powdery mildew of lentil has been re- reported from the former USSR (15). The ×1,000 using bright field microscopy (Carl ported from various parts of the world species of Erysiphe attacking lentil often Zeiss Model Axioskop 40, Oberkochen, including South Asia, the Middle East, the has been unclear, and some reports refer Germany). Morphological characters Mediterranean, East Africa, Eastern only to Erysiphe sp. or Oidium sp. (3,15). evaluated included diameter of chasmothe- Europe, the former USSR, South America, Recently, Erysiphe diffusa (Cook & Peck) cia, chasmothecial appendages, number of and more sporadically, from North Amer- U. Braun & S. Takam. was reported (as ascospores per ascus, and lengths and ica (1). Although usually a minor disease, Microsphaera diffusa Cook & Peck) in- widths of asci, ascospores, conidia, and it can be severe on certain lentil cultivars fecting lentils in Canada (4). The species conidiophore foot cells. At least 50 meas- and in some parts of the world, particularly name was assigned on the basis of di- urements for each character were taken per chotomously branched chasmothecial ap- sample for comparison with descriptions pendages (4). of powdery mildew species recorded on Corresponding author: Weidong Chen Infections by Erysiphe species typically lentil (8,9). E-mail: [email protected] result in small white colonies on leaf sur- ITS sequencing and phylogenetic Accepted for publication 14 April 2009. faces. Lesions expand to cover entire leaf analysis. Total DNA was extracted from surfaces and pods. Mycelial growth and conidia and/or mycelia from infected lentil conidial production can be especially ex- plants using the FastDNA kit (MP Bio- doi:10.1094/ PDIS-93-8-0797 tensive at flowering. In the case of severe medicals, LLC, Solon, OH) as described This article is in the public domain and not copy- infections, leaves become chlorotic, then by Chen et al. (11). Polymerase chain reac- rightable. It may be freely reprinted with custom- ary crediting of the source. The American Phyto- curled and necrotic prior to abscission. tion (PCR) amplification of the ITS region pathological Society, 2009. Yield decline may occur and plants some- from each isolate was performed using the Plant Disease / August 2009 797 primers ITS1 and ITS4 (34) or Erysiphe- 15 g of Bacto agar per liter of distilled using the DNA Parsimony program of the specific primers designed based on con- water (pH 7.0). Positive colonies detected PHYLIP package (16) available at http:// served sequences of the ITS region of Ery- by PCR were grown overnight in LB broth bioweb2.pasteur.fr/phylogeny/intro-en.html. siphe spp. available from GenBank. The containing 50 µg/ml kanamycin at 37°C. Each nucleotide was weighted equally and Erysiphe-specific primers were EryF (5′ Plasmids were isolated using the Montage each deletion is treated as one step change. TACAGAGTGCGAGGCTCAGTCG 3′) life science kit (Millipore Corporation, Greenhouse inoculation and patho- and EryR (5′ GGTCAACCTGTGATC Bedford, MA) following the manufac- genicity assay. Lentil cv. Crimson and two CATGTGACTGG 3′). The specific prim- turer’s instructions. Plasmids containing soybean genotypes, L84-2237 (Plant In- ers were helpful in avoiding the amplifica- inserts were further verified by restriction troduction 547870) and cv. Harosoy (PI tion of ITS regions of the host plant or digestion with EcoRI restriction enzyme 548573), from the USDA Soybean Germ- other contaminating organisms. PCR reac- and separated on 1% agarose gel. Sequenc- plasm Collection at Urbana, IL were tions in 20-µl volume consisted of 2 units ing reactions were carried out directly with planted in the greenhouse. The soybean of Taq DNA polymerase (Promega, Madi- purified PCR product or with isolated genotypes L84-2237 and Harosoy are son, WI), 1× PCR buffer, 1.5 mM MgCl2, plasmids using one of the six primers: known to be susceptible to E. diffusa 0.2 mM dNTPs, 40 ng of the template, and EryF, EryR, ITS1, ITS4, M13F, and (14,21). Twenty total lentil plants in five 10 to 20 pmol of each primer, and were M13R. Nucleotide sequences were deter- pots (four plants per 15-cm pot) and 16 subjected to the following temperature mined from both strands using an ABI total soybean plants of each genotype in parameters: initial denaturation at 92°C for PRISM 377 automatic sequencer (Applied four pots (four plants per 15-cm pot) were 10 min, followed by 35 cycles of denatura- Biosystems, Foster City, CA) at the Se- used in the experiment. Three-week-old tion at 94°C for 1 min, annealing at 52°C quencing Core Facility of Washington plants were dusted copiously with conidia for 30 s, extension at 72°C for 2 min, and State University. Sequences were used in collected from infected lentil plants until final extension at 72°C for 10 min (Bio- BLAST searches against the GenBank the young leaves had a white powdery Rad iCycler thermocycler, Bio-Rad Labo- database (http://www.ncbi.nlm.nih.gov/ appearance. Plants were maintained in a ratories, Hercules, CA).