Proc. Natl. Acad. Sci. USA Vol. 91, pp. 489-493, January 1994 Microbiology A cytolysin encoded by Salmonella is required for survival within macrophages (toxin/pathogenesis) STEPHEN J. LIBBY*tt, WERNER GOEBEL§, ALBRECHT LUDWIG§, NANCY BUCHMEIER1, FRANCES BOWEl', FERRIC C. FANGt, DONALD G. GUINEYt, J. GLENN SONGER**, AND FRED HEFFRON*II *Department of Molecular Biology, The Research Institute of Scripps Clinic, 10666 North Torrey Pines Road, La Jolla, CA 92037; §Theodor-Boveri-Institut fOir Biowissenschaften, (Biozentrum) der Universitat Warzburg, Leherstuhl fur Microbiologie, Am Hubland, W-8700 Wurzburg, Germany; tDepartment of Medicine, University of California, San Diego, 9500 Gilman Drive, La Jolla, CA 92093-0613; lDepartment of Pathology V151, University of California, San Diego, 3350 La Jolla Village Drive, La Jolla, CA 92161; IlDepartment of Microbiology and Immunology 3181, Oregon Health Science University, S.W. Sam Jackson Park Road, Portland, OR 97201; and "*Department of Veterinary Science, University of Arizona, Tucson, AZ 85721 Communicated by Stanley Falkow, August 16, 1993 ABSTRACT A SalmoneUla gene encoding a cytolysin has was used in all virulence studies (18). Clinical isolates of been identified by screening for hemolysis on blood agar. DNA Salmonella were obtained from the State ofCalifornia Health sequence analyses together with genetic mapping in Salmonella Laboratory or the County of San Diego Health Laboratory. suggest that it is unrelated to other toxins or hemolysins. The Bacteria were cultivated in Luria-Bertani medium. Blood gene (slyA) is present in every strain of Salmonella examined, agar plates were made in trypticase soy agar (Difco) contain- in Shigela, and in enteroinvasive Escherichia coli but not in ing 4% defibrinated sheep red blood cells (Colorado Serum, other Enterobacteriaceae. SlyA (salmolysin) purified from a Denver). Clinical isolates obtained for homology studies derivative of the original clone has hemolytic and cytolytic included Yersinia sp., Legionella, Chlamydia, Pasteurella, activity and has a molecular weight predicted by the DNA Acinetobacter, Haemophilus, Proteus, Klebsiella, Neisseria sequence. The median lethal dose and infection kinetics in mice sp., Citrobacter, Campylobacter, Franciscella, Brucella, suggest that the toxin is required for virulence and facilitates Listeria, Serupla sp., Serratia, Enterobacter sp., E. coli K-12 SalmoneUa survival within mouse peritoneal macrophages. LE392 and DH5a, and Aeromonas. Many Gram-negative and Gram-positive pathogenic micro- Molecular Techniques. A Sau3A1 partial-digest cosmid organisms produce toxins or hemolysins that lyse eukaryotic library of S. typhimurium 14028s was constructed in the cells and contribute to their pathogenicity (1). The most vector pLAFR2 (19, 20) and packaged into A phage particles intensively studied exotoxins produced by Gram-negative (Stratagene). The host for the cosmid library, E. coli LE392 pathogens are members of the RTX family (reviewed in refs. or DH5a (21), was grown on trypticase soy agar plates 2 and 3). The HlyA hemolysin, present in uropathogenic containing sheep red blood cells and tetracycline (20 ug/ml) Escherichia coli, is the best studied of these. HlyA increases and incubated for 36 hr at 37°C. A strongly hemolytic colony E. coli virulence in a rodent peritonitis model (4). Although was chosen for further characterization. Subcloning, se- the precise mechanism of action is unclear, it has been quencing, and Southern analysis were performed by standard suggested that these toxins attenuate host phagocytic cell techniques. Hemolytic activity was subcloned on a 1.4-kb function (4-8). Several facultative intracellular pathogens, EcoRV-Cla I fragment (pSL1117). This fragment was se- including rickettsiae, shigellae, Trypanosoma cruzi, and List- quenced and an open reading frame from the Cla I end was eria monocytogenes, escape from the phagocytic vesicle of identified. Oligonucleotide primers (Fig. 1, Oligo 1 and Oligo professional phagocytic cells, but Salmonella does not (9- 3) were used to amplify a 680-bp fragment. This fragment was 12). A defined role in virulence is difficult to assign to most cloned into the EcoRV site of pSK and transformed into toxins, in part because ofthe lack of animal models for many DH5a, and the bacteria were plated onto blood agar. Cells organisms. An exception is listeriolysin made by L. mono- harboring this clone (pSL2070) were as hemolytic as those cytogenes. The toxin dissolves the phagocytic membrane, harboring pSL1117. Sequence manipulation and data-base allowing the bacteria to escape into the cytoplasm, and the searches were done with IBI MACVECTOR and GenBank bacteria are protected from the immune defenses ofthe host. (update 71, August 1992). Listeriolysin-negative mutants are avirulent (13-17). To complement the sly mutation in SL2161 for macrophage We have occasionally observed hemolysis by certain Sal- survival studies, the 680-bp fragment from pSL2070 was monella strains, particularly low-passage clinical isolates. removed by HindIII/BamHI digestion, made blunt-ended The gene (slyA) encoding the Salmonella hemolysin (salmol- with Klenow DNA polymerase, and cloned into the blunt- ysin) has been determined by screening a Salmonella typhi- ended EcoRI site of pSC101 (22). Colonies containing the murium gene bank in E. coli for hemolytic activity. Several cloned salmolysin gene in pSC101 (pSL2185) were hemolytic. related clones were identified, one of which was studied in Plasmid constructs were electroporated into S. typhimurium detail.tt A mutation in slyA was constructed, and the mutant wild-type (14028s) and salmolysin mutant (SL2161) cells. was found to be attenuated for both virulence in mice and The slyA gene was mapped on the S. typhimurium chro- growth in murine macrophages. mosome by using the Mud-P22 phage of Benson and Gold- man (23). Phage were induced with mitomycin C and pelleted MATERIALS AND METHODS from the resulting lysates, and DNA was prepared for slot blots and hybridized with the PCR-amplified salmolysin Strains, Media, and Culture Conditions. Wild-type Amer- structural gene. Hybridizations were done at 65°C in 6x ican Type Culture Collection strain S. typhimurium 14028s SSPE (lx is 0.15 M NaCl/0.01 M phosphate/l mM EDTA, The publication costs of this article were defrayed in part by page charge tTo whom reprint requests should be sent at the t address. payment. This article must therefore be hereby marked "advertisement" ttThe sequence reported in this paper has been deposited in the in accordance with 18 U.S.C. §1734 solely to indicate this fact. GenBank data base (accession no. U03824). 489 Downloaded by guest on September 29, 2021 490 Microbiology: Libby et al. Proc. Natl. Acad. Sci. USA 91 (1994) - OLIGO 1 - AT'C 100 OLIGO 2 Po TGAGAATA CACTAGGITC 200 K K L E S P L G S D SspI CTGGCACGG9rGGTGCGCAT_GGCGTGCTCTGATTGACC T CA TACTrGCACAATATTCATC 300 L A R L V R I W R A L I D H R L K P L E L T Q TH W V T L H N I H AATTGCCGCCTGACCAGTC GTTGGATCAACTTAAGATAAGGGGCT 400 Q L P P D Q S Q I Q L A K A I G I E Q P S L V R T L D Q LE D K G L AATTTCGCGGCAAACCTGCGCCAGCGATCGTCGCGCTAAGCGTAAACGACCACGACC 500 I S R Q T C A S D R R A K R I K L T E K A E P L I A E M E E V I H SspI AAAAC GCGCAr CCAACTGAACACAATATTAT_GAATTGCACT 600 KT R G F I L A G I S S E E I F L L I K L I A K L E H N I X E L H CTCACGATGCAGGGGCATACGTGTGGCCATGTGACCACACGTAAAGCCTG TT¶rAGCGTQGAGAGACGGTAACCTGGCTGCCGTTGCTGGCCAG 700 S H D **' 4 OLIGO 3 CACGACACGCTGACCTGCCG 800 FIG. 1. Sequence of the slyA gene. The initiation codon is underlined and the termination codon is denoted by three stars. The Ssp I sites used to construct pSL2145 are shown. Oligonucleotide primers used for PCRs are shown (Oligos 1-3). The amino acid sequence (one-letter symbols) is shown below the nucleotide sequence. pH 7.4)/0.5% SDS/lOx Denhardt's solution containing de- mM Tris HCl (pH 7.5) and containing phenylmethanesulfonyl natured salmon testis DNA at 200 ,ug/ml. Blots were washed fluoride (2 ug/ml). Column fractions were assayed for he- in O.lx SSPE/0.1% SDS at 65°C for 1-2 hr and exposed to molytic activity by adding 50 Al of each fraction to 700 ,ul of x-ray fim. 10% defibrinated sheep erythrocytes and incubated at 37°C Disruption of the slyA Gene. A detailed description of the for 1 hr. The amount of released hemoglobin was determined suicide vector system used to mutate slyA will be reported by measuring A595 of the supernatant. Salmolysin was eluted separately. In brief, slyA was disrupted by homologous at 0.15 M NaCl and could be further purified by preparative recombination insertion of a suicide vector derived from the isoelectric focusing with a Rotofor (Bio-Rad). All hemolytic RK2 replicon, pRRlOAtrfA (24), containing an internal Ssp I activity focused at a pl of 5.5. A hemolytic unit of salmolysin fragment of slyA. The suicide vector-slyA fragment, was defined as the amount of partially purified salmolysin pSL2145, was maintained in E. coli S17-1 (25) and transferred required to lyse 50% of a suspension of 10% erythrocytes at to wild-type Salmonella by conjugation. Transconjugants 37°C in 1 hr. One hemolytic unit of salmolysin was heated to were selected on brilliant green agar containing sulfadiazine 65°C for 15 min and then assayed for activity. EDTA (50 mM) (80 ,g/ml) and penicillin (300 ug/ml). Chromosomal DNA was added to 1 hemolytic unit of salmolysin and treated as from a penicillin-resistant colony now called SL2161 was above. Phospholipase D and cholesterol oxidase activities digested with Pst I, transferred to a membrane, and probed were assayed as described (30). with the 32P-labeled PCR-amplified slyA gene to confirm the interruption of slyA.