Turk J Biochem 2018; 43(6): 651–661 Research Article Xichao Xia*, Yang Liu, Jianxin Huang, Xiaozhu Yu, Zhiguo Chen, Xinhua Zheng, Fuan Wang, Junfeng Zhang, Shipeng Xue and Zhaofei Cheng Molecular cloning and in silico characterization of two alpha-like neurotoxins and one metalloproteinase from the maxilllipeds of the centipede Scolopendra subspinipes mutilans İki alfa benzeri nörotoksinlerin ve bir adet metalloproteinazın silico karakterizasyonunda kırkayak klonlanması ve kırkayak ekstraktlarının maksilet spp. https://doi.org/10.1515/tjb-2018-0009 divergence and independent evolution of SsuTA1 and Received November 27, 2017; accepted February 13, 2018; previously SsuTA2 from other α-neurotoxins. published online March 28, 2018 Conclusion: The results suggested that centipede S. sub- Abstract spinipes mutilans is an ancient member of venomous arthropods, but its venom exhibits novel scenario. Aims: In order to shed light of characterizations of cen- Keywords: Deduced protein sequences; Alpha-like-neuro- tipede Scolopendra subspinipes mutilans venom, a two toxin; Metalloproteinase; Scolopendra subspinipes muti- novel full-lengths of alpha-like-neurotoxin and one met- lans; Neglect group. alloproteinase cDNAs derived from the maxilllipeds RNA of centipede S. subspinipes mutilans were isolated, and, respectively, named as SsuTA1, SsuTA2 and SsuMPs. Özet Materials and methods: The SsuTA1, SsuTA2 and SsuMPs were cloned from the S. subspinipes mutilans using the Amaçlar: Kırkayak çağı scolopendra subspinipes muti- rapid amplification of cDNA ends methods. lans venomunun karakterizasyonlarının ışığında, iki adet Results: In the current study, SsuTA1 and SsuTA2 were, tam uzunlukta alfa-benzeri-nörotoksin ve santrifüj S. respectively, composed of 82 amino acid residues and subspinipes mutilansının maksilllipre RNA’sından türetil- 106 amino acid residues. Deduced protein sequence of miş bir metalloproteinaz cDNA’sı izole edildi ve sırasıyla SsuTA1 shared high homology with that of SsuTA2, one SsuTA1, SsuTA2 ve SsuMPs. major difference was the C-terminal 24-residue exten- Gereç ve Yöntemler: SsuTA1, SsuTA2 ve SsuMP’ler, S. sion in SsuTA2. An abundance of cysteine residues and subspinipes mutilanslarından cDNA uçlarının hızlı amp- several adjacent beta-sheets were observed in SsuTA1 lifikasyonu kullanılarak klonlanmıştır. and SsuTA2. SsuMPs had 594 amino acid residues con- Bulgular: Mevcut çalışmada SsuTA1 ve SsuTA2 sırasıyla 82 taining with a molecular mass of 68.29 kDa. The primary amino asit artığı ve 106 amino asit kalıntısından oluşmak- sequence analysis indicated that the SsuMPs contains a tadır. SsuTA1’in indirgenmiş protein sekansı, SsuTA2’ninki zinc- binding motif (HEIGHSLGLAHS) and methionine- ile yüksek benzerlik paylaştı, önemli bir fark SsuTA2’deki turn motif (YIM). Phylogenetic analysis revealed early C-terminali 24-artık uzantısıydı. SsuTA1 ve SsuTA2’de çok sayıda sistein kalıntısı ve birkaç bitişik p-tabaka gözlen- miştir. SsuMPs, 68.29 kDa’lık bir moleküler kütle içeren 594 *Corresponding author: Xichao Xia, Medical College of Pingdingshan University, Pingdingshan 467000, Henan Province, China; and Basic amino asit tortusuna sahipti. Birincil dizi analizi SsuMP’le- Medicine College of Nanyang Medical University, Nanyang 473041, rin bir çinko bağlayıcı motif (HEIGHSLGLAHS) ve metiyo- Henan Province, China, e-mail: [email protected]. nin dönüş motifi (YIM) içerdiğini göstermiştir. Filogenetik http://orcid.org/0000-0001-7836-8110 analizler SsuTA1 ve SsuTA2’nin diğer α-nörotoksinlerden Yang Liu, Jianxin Huang, Xiaozhu Yu, Zhiguo Chen, Xinhua Zheng, erken ayrışmasını ve bağımsız evrimini ortaya çıkardı. Fuan Wang and Zhaofei Cheng: Medical College of Pingdingshan University, Pingdingshan 467000, Henan Province, China Sonuç: Sonuçlar sentipede S. subspinipes mutilans’ın Junfeng Zhang and Shipeng Xue: Basic Medicine College of Nanyang eski bir zehirli artropod üyesi olduğunu, ancak zehirinin Medical University, Nanyang 473041, Henan Province, China yeni bir senaryo sergilediğini ortaya koymuştur. 652 Xichao Xia et al.: Characterization of two alpha-like neurotoxins and one metalloproteinase Anahtar Kelimeler: Ortaya çıkan protein dizileri; Alfa characterize these proteins and small polypeptides from benzeri nörotoksin; Metalloproteinaz; Scolopendra subs- different organisms [18, 19]. In the previous study, we have pinipes mutilans; İhmal grubu. isolated metalloprotease and hyaluronidase from venom of scorpion Buthus martensi [20, 21]. Centipede Scolopen- dra subspinipes mutilans is a traditional Chinese medicine and has been successfully used to treat immune-related Introduction diseases, especially rheumatoid arthritis [22–24]. In the current study, two novel sequences of alpha-like-neuro- Venomous animals are an important group of animal toxin and one metalloprotease sequence were cloned from kingdom. Their venomous glands can generate a variety the centipede S. subspinipes mutilans venom for the first of toxins composed of small polypeptides which can act time, and molecular structures of these sequences were on multiple sites of preys and/or predators [1, 2]. In addi- elucidated by bioinformatic methods. tion, these glands produce few water-soluble enzymes which are contribute to digested of food and facilitate the action of other toxic components of the venom [3]. Inter- estingly, these small polypeptides and enzymes also func- Materials and methods tion as important role on the neuromuscular system, the vascular system, the blood coagulation cascade and mem- Venom brane integrity and so on [4, 5]. Therefore, some enzymes and polypeptides have also been attained great concern Centipedes were brought from special animal farm of and their functions are gradually been shed light [6, 7]. Nanyang and identified as S. subspinipes mutilans which Centipedes, one important group of arthropods, is also named as S. subspinipes subspinipes by current are belong to the chilopod class. The body is composed taxonomy. The fresh centipede maxillipeds were dis- of head and thorax. Each thorax segment has one pair sected, snap frozen in liquid nitrogen and stored at −80°C of ambulatory legs besides of the one in the hindmost until use. segment where these structures are involved into mechan- ical defense and/or sensory purposes [8]. Another pair of modified legs is named the forcipules and sited at the Total RNA isolation and reverse transcription post-cephalic segment. A venom gland is located at the femoral part of the forcipule. The venom is used to sub- Total RNA was isolated from maxillipeds using TRIzol jugate prey and defense against predators [9]. Unlike (Takara, Dalian, China) according to the manufacturer’s scorpions, spider and insect, venom systems of them are protocol. The integrity of RNA was monitored by 1.2% extensively studied, a few studies are reported about the agarose gel electrophoresis. The concentration of RNA ancient venom system of centipedes. was accurately calculated by the ratio of the OD260/ Alpha-neurotoxins are classified into different groups OD280. The reverse transcription was carried out based on based on the preferential toxicity to mammals or insects M-MLV First-Strand cDNA synthesis Kit (Takara, Dalian, as well as their differential binding properties (classi- China) instructions using the DNase I (Takara, Dalian, cal alpha-mammal, alpha-like neurotoxins and alpha- China)-treated total RNA as template and Oligo (dT18)- insect neurotoxins) [10]. A number of alpha-neurotoxin adaptor as primer (Takara, Dalian, China). The reaction sequences had been cloned and characterized from snake, mixtures were treated at 72°C for15 min, next incubated scorpion and spider [11–13]. Venom metalloprotease is an at 42°C for 1 h, and last terminated by heating at 72°C for important part of venom and generally regarded as a hem- 10 min. The reverse transcription product was diluted to orrhagic factor that is associated with degrading extracel- 1:50 and stored at −80°C for following use. lular matrix and preventing blood clot formation [14, 15]. Now, metalloproteases have been reported on various venomous animals, these enzymes seems to act primarily Cloning of S. subspinipes mutilans as haemorrhagins [16, 17]. As to out known, the full alpha- alpha-like-neurotoxin and metalloproteinase neurotoxin and metalloprotease sequences from centi- pede venom are not reported [8]. Degenerate primers of Ssu1 and Ssu2, Sp1 and Sp2 An important way in understanding the increased (Table 1) were designed according to alpha-neurotoxin functional diversity of secretions is to identify and gene sequences and used to amplify alpha-like-neurotoxin Xichao Xia et al.: Characterization of two alpha-like neurotoxins and one metalloproteinase 653 Table 1: Sequences of PCR primers. Sequence and phylogenetic analysis Primer Sequence (5′–3′) The alpha-like-neurotoxin and metalloproteinase gene Ssu1 CTTCNBCTNATGANAGGTNTGG sequences from S. subspinipes mutilans were analyzed Ssu2 GCACCANCAGGCNTTNCNGTAT and compared using the BLASTX and BLASTP programs SP1 GANGAAGACGGTCCTCTAAC with a GenBank database search (www. ncbi.nlm.nih. SP2 ATGNGCCGNTTCGTGAGC 5′ Race Innerprimer CATGGCTACATGCTGACAGCCTA gov/blast). The signal peptide was predicted by SignalP 5′ Race Outerprimer CGCGGATCCACAGCCTACTGATGATCAGTCGATG program (http://www.cbs.dtu.dk/services/SignalP). The Ssu5-1 GTAACCTTCGTCCATCGTCTGC multiple sequence alignment was performed using the Ssu5-2 CAAACCGAACCGAGCGAGA DANMEN analysis program. The theoretical amino acid MP5-1 G CAAACCGAACCGAGCGAGA composition,