Microbes Environ. Vol. 30, No. 2, 164-171, 2015 https://www.jstage.jst.go.jp/browse/jsme2 doi:10.1264/jsme2.ME14127 The Impact of Injections of Different Nutrients on the Bacterial Community and Its Dechlorination Activity in Chloroethene-Contaminated Groundwater TAKAMASA MIURA1*, ATSUSHI YAMAZOE1, MASAKO ITO2, SHOKO OHJI1, AKIRA HOSOYAMA1, YOH TAKAHATA2, and NOBUYUKI FUJITA1 1Biological Resource Center, National Institute of Technology and Evaluation, 2–10–49 Nishihara, Tokyo 151–0066, Japan; and 2Taisei Corporation, 344–1 Nase, Kanagawa 245–0051, Japan (Received September 1, 2014—Accepted February 10, 2015—Published online April 15, 2015) Dehalococcoides spp. are currently the only organisms known to completely reduce cis-1,2-dichloroethene (cis-DCE) and vinyl chloride (VC) to non-toxic ethene. However, the activation of fermenting bacteria that generate acetate, hydrogen, and CO2 is considered necessary to enhance the dechlorination activity of Dehalococcoides and enable the complete dechlorination of chloroethenes. In the present study, we stimulated chloroethene-contaminated groundwater by injecting different nutrients prepared from yeast extract or polylactate ester using a semicontinuous culture system. We then evaluated changes in the bacterial community structure and their relationship with dechlorination activity during the biostimulation. The populations of Dehalococcoides and the phyla Bacteroidetes, Firmicutes, and Spirochaetes increased in the yeast extract-amended cultures and chloroethenes were completely dechlorinated. However, the phylum Proteobacteria was dominant in polylactate ester- amended cultures, in which almost no cis-DCE and VC were dechlorinated. These results provide fundamental information regarding possible interactions among bacterial community members involved in the dechlorination process and support the design of successful biostimulation strategies. Key words: bioremediation, dechlorination, chloroethene, Dehalococcoides, bacterial community Chloroethenes such as tetrachloroethene (PCE), trichloro- well as Dehalococcoides as the key dechlorinating bacteria. ethene (TCE), cis-1,2-dichloroethene (cis-DCE), and vinyl Syntrophs such as Desulfovibrio and Acetobacterium have been chloride (VC) are frequently detected as contaminants in shown to facilitate the growth and dechlorination activity of groundwater, and are specified as environmentally regulated Dehalococcoides mccartyi 195T through the fermentation of substances in Japan. Under anaerobic conditions, the biologi- lactate to acetate and hydrogen and biosynthesis of vitamin cal reductive dechlorination of these chloroethenes to non- B12 (14, 22). These finding suggest that the stimulation of toxic ethene is catalyzed by dehalorespiring bacteria (26). syntrophs cohabiting with Dehalococcoides play a key role in While many bacteria transform PCE and TCE to cis-DCE, efficient bioremediation. Dehalococcoides is the only organism known to be capable Although Tang et al. reported that D. mccartyi 195T con- of dechlorinating cis-DCE and VC to ethene (19, 25). tained complete amino acid biosynthesis pathways with ace- Accordingly, it is important that Dehalococcoides inhabits tate and CO2 as carbon sources (29), this strain has been shown aquifers being remediated in order to enable the complete to actively incorporate exogenous amino acids in order to dechlorination of chloroethenes to ethene. Hendrickson et al. facilitate growth and dechlorination (21), suggesting that an reported that a close relationship existed between the pres- injection of amino acids direct enhances the dechlorination ence of the Dehalococcoides 16S rRNA gene and complete activity of Dehalococcoides inhabiting bioremediation sites. dechlorination in 24 samples with geographic origins scat- In the present study, we demonstrated the biostimulation tered throughout North America and Europe (15). of anaerobic semicontinuous cultures using chloroethene- Chloroethenes serve as the electron acceptor during anaer- contaminated groundwater. Specifically, we investigated obic dechlorination, and electrons are derived from the oxida- alterations in dechlorination activities, bacterial community tion of hydrogen and organic compounds such as acetate, structures, and Dehalococcoides densities in semicontinuous lactate, pyruvate, butyrate, propionate, glucose, and alcohol cultures injected with different nutrients that had been devel- (4, 6, 8, 9). Specifically, Dehalococcoides isolates exhibit oped for groundwater remediation. Alternations in each of the low growth rates and specific essential nutrient requirements, above parameters were found to be closely related to the including hydrogen as the electron donor, acetate as the car- components of the nutrients. Our results provide useful infor- bon source, chlorinated or brominated compounds as respira- mation that will aid in the selection of proper nutrients for the tory electron acceptors, and vitamin B12 as a co-factor (20). biostimulation of chloroethenes degradation. Dechlorinating bacterial communities generally contain other microbes that are able to ferment organic substrates into Materials and Methods acetate and hydrogen such as Acetobacterium, Citrobacter, Clostridium, Desulfovibrio, Eubacterium, and Spirochaetes, as Construction of semicontinuous cultures Groundwater (unconfined aquifer, GL− 2.5 m to −11 m) and medium * Corresponding author. E-mail: [email protected]; sand (GL −5.2 m to −5.4 m) were collected from a chloroethene- Tel: +81–3–3481–1972; Fax: +81–3–3481–8424. contaminated aquifer in Japan. The base semicontinuous culture was Bacterial Community during Dechlorination 165 constructed by mixing 550 mL of groundwater, 20 g of medium extracted DNA. PCR was conducted by subjecting the samples to sand, and 3 mL of TCE solution (70 mg L−1; Kanto Chemicals, 95°C for 30 s, followed by 40 cycles of 95°C for 5 s, 54°C for 30 s, Tokyo, Japan) in a 500-mL culture bottle. The nutrients, HRC and 72°C for 45 s. (Regenesis, San Clemente, CA, USA), TM-B (Taisei, Kanagawa, Japan), and EDC (Ecocycle, Tokyo, Japan) were diluted 10-fold in 16S rRNA gene amplicon sequencing and data analysis deionized water, after which 2.8-mL aliquots were added to the base The 16S rRNA genes were amplified by PCR using the primers semicontinuous cultures. To achieve pH control, 1.7 mL of NaHCO3 338F_PA_V3F (5'-CGTATCGCCTCCCTCGCGCCATCAGACT −1 −1 (75 g L ) and NaCO3 (25 g L ) were added to the culture injected CCTACGGGAGGCAGCAG-3') (17) and 1046R_PB_V6R (5'-CT with EDC. These cultures were then grown in a continuously stirred ATGCGCCTTGCCAGCCCGCTCAGCGACAGCCATGCAGCA chamber at 20°C for a total of 115 d. CCT-3') (27) containing adaptor and key sequences (underlines) for 454 GS FLX Titanium pyrosequencing (Roche, Basel, Switzerland). Analytical procedures Each 25-µL reaction mixture contained 2.5 µL 10×buffer, 2.5 µL Chlorinated compounds were analyzed by gas chromatography/ dNTPs (2 mM each), 1 µL DMSO, 1 µL 0.1% bovine serum albu- mass spectrometry (Network GC System; Agilent Technologies, min, 1 µL of each primer (10 µM), 0.25 µL Blend Taq (2.5 U µL−1) Palo Alto, CA, USA) through a headspace sampler (200°C upon (Toyobo, Osaka, Japan), and 1 µL template DNA (approximately injection, Network Headspace Sampler; Agilent Technologies) and 3 ng). The cycling conditions were as follows: 95°C for 5 min a GC column (HP-1, 60 m×0.32 mm×1.0 µm; Agilent Technologies). followed by 23 cycles of 94°C for 1 min, 50°C for 30 s, and 68°C for The column was held at 35°C for 2 min, after which the temperature 1 min, and then a final extension at 70°C for 10 min. PCR products was increased to 170°C at 15°C min−1. Helium was applied as the were purified using the Wizard SV Gel and PCR Clean-Up System carrier gas at a flow rate of 1.5 mL min−1. Ions were analyzed using (Promega, Madison, WI, USA). The concentration of PCR products a HPLC system (Alliance 2695XC Separation Module; Waters, was estimated using PicoGreen dsDNA quantitation reagent Milford, MA, USA). Cations were analyzed using a Shodex IC (Molecular Probes, Karlsruhe, Germany), and the quality of PCR YS-50 column (Showa Denko, Tokyo, Japan) with CH3SO3H (4 mM) products was checked using an Agilent 2100 Bioanalyzer (Agilent applied at a flow rate of 1.0 mL min−1 and a temperature of 40°C. Technologies). The amplicon samples were sequenced using a Anions were analyzed using a Shodex IC SI-50 4E column (Showa GS FLX Titanium system (Roche). Bacterial community analyses Denko) with Na2CO3 (3.2 mM) and NaHCO3 (1.0 mM) at a flow rate based on the 16S rRNA gene and a principal coordinate analysis of 0.8 mL min−1 and a temperature of 40°C. Dissolved organic (PCoA) were performed using the MacQIIME software package carbon (DOC) was analyzed using a total organic carbon analyzer (2) and Greengenes 13_5 dataset (5). A phylogenetic tree of (TOC-5000A; Shimadzu, Kyoto, Japan) after filtering samples Dehalococcoides was constructed by the maximum likelihood esti- through 0.45-µm pore size poly-ethersulfone membranes (Millipore, mation method using MEGA software version 5.2 (28). Denoised Tokyo, Japan). Oxidation-reduction potential (ORP) and pH were and trimmed sequences were deposited in the DDBJ Sequence Read measured using a Horiba pH meter D-24 and D-52 (Horiba, Kyoto, Archive under accession numbers DRA002417 (control_day115, Japan), respectively. The total number of bacteria was determined day13, day40, day73 and day88; DRR021760 to DRR021764, by the acridine orange direct count method (16). HRC_day115,