SUPPLEMENTARY DATA L/L Tm Supplementary Figure 1. Minor glucose homeostasis defects in 4-week-old Isl-1 ; Pdx1-CreER (no L/+ Tm Tm) animals but not 8-week-old Isl-1 ; Pdx1-CreER IP(Tm) animals. A: Plasma insulin levels from 4- week-old females without Tm pulse-chase responding to acute intraperitoneal (IP) glucose bolus after L/L L/L Tm L/L 16-hour fast ± SEM (Isl-1 (no Tm) n=5 and Isl-1 ; Pdx1-CreER (no Tm) n=6). Black bars = Isl-1 (no Tm) L/L Tm and white bars = Isl-1 ; Pdx1-CreER (no Tm). B: i) Intraperitoneal (IP) glucose tolerance test performed L/L L/L Tm after 16-hour fast on 4-week-old females ± SEM (Isl-1 (no Tm) n=5 and Isl-1 ; Pdx1-CreER (no Tm) L/L L/L Tm n=6). Solid line = Isl-1 (no Tm) and dashed line = Isl-1 ; Pdx1-CreER (no Tm). ii) Integrated area under L/L intraperitoneal glucose tolerance test curves as percent of Isl-1 (no Tm) animals ± SEM, p = 0.0278. L/L L/L Tm Black bars = Isl-1 (no Tm) and white bars = Isl-1 ; Pdx1-CreER (no Tm). C: Intraperitoneal (IP) glucose tolerance test performed after 16-hour fast on 8-week-old females that had received Tm pulse-chase. L/L L/+ Tm Values are presented as ± SEM (Isl-1 IP(Tm) n=7 and Isl-1 ; Pdx1-CreER IP(Tm) n=8. Solid line = Isl- L/L L/+ Tm 1 IP(Tm) and dashed line = Isl-1 ; Pdx1-CreER IP(Tm). Analysis with two-way Students’s t-test: * p < 0.05. Analysis with repeated measures, two-way ANOVA with Bonferroni post-test: † = P <0.05, †† = P < 0.01, and ††† = P < 0.001. ©2014 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db14-0096/-/DC1 SUPPLEMENTARY DATA Supplementary Figure 2. Isl-1L/L; Pdx1-CreERTm animals are grossly normal birth and do not display Tm-independent recombination of Isl-1. A-B: Insulin (), Isl-1(‘), and DAPI (‘‘), and merged (‘‘‘) visualized by coimmunofluorescence in P0.5 pancreata (40x). White arrowheads indicate insulin+, Isl-1- cells. C: Isl-1 mRNA expression relative to Actin using whole RNA extracts from P0.5 whole pancreata. L/L L/L L/L Values presented as percent of Isl-1 (no Tm) animals ± SEM (Isl-1 (no Tm) n=3 and Isl-1 ; Pdx1- Tm L/L L/L CreER (no Tm) n=3). D: Random-fed plasma glucose at P5.0 ± SEM (Isl-1 (no Tm) n=3 and Isl-1 ; Tm Pdx1-CreER (no Tm) n=4). E-F: Insulin (Ins) and glucagon (Gcg) visualized by coimmunofluorescence in P5 female pancreata (20x). G-H: Pancreatic islet coimmunofluorescence for Isl-1, glucagon (Gcg), and DAPI at 20x of from female animals after completing tamoxifen induction protocol. C and D: Black L/L L/+ Tm L/L bars = Isl-1 (no Tm), black and white bars = Isl-1 ; Pdx1-CreER (no Tm), and white bars = Isl-1 ; Tm Pdx1-CreER (no Tm). D: Cohorts contained both male and females. ©2014 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db14-0096/-/DC1 SUPPLEMENTARY DATA Supplementary Figure 3. Heatmap of isolated islet microarray replicates indicating putative Isl-1 regulatory targets identified in the βTC3 ChIP-Seq. A: Microarray heatmap representing the fold-change L/L Tm value of gene expression comparing isolated islets from Isl-1 ; Pdx1-CreER IP(Tm) animals to islets L/L from Isl-1 IP(Tm) islets. Each column corresponds to biological replicates of purity matched total RNA extractions. Red and green correspond to increased and decreased expression respectively. On the Y- axis are the gene names of potential Isl-1 regulatory targets that were identified by consensus regions between two ChIP-Seq replicates. ©2014 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db14-0096/-/DC1 SUPPLEMENTARY DATA Supplementary Table 1. Primary Antisera Antigen Raised In Dilution Embedding Antigen Retrival Source Guinea Citrate Buffer pH Glucagon Pig (IgG) 1 to 3000 OCT/Paraffin 6.0; microwave Millipore (4031-01F) Citrate Buffer pH Glucagon Rabbit 1 to 3000 OCT/Paraffin 6.0; microwave Biodesign (D10221R) Citrate Buffer pH Glut2 Rabbit 1 to 500 OCT/Paraffin 6.0; microwave Chemicon (AB1342) Guinea Citrate Buffer pH Insulin Pig 1 to 1000 OCT/Paraffin 6.0; microwave Abcam (AB7842) Citrate Buffer pH ThermoScientific (MS- Insulin Mouse 1 to 1000 OCT/Paraffin 6.0; microwave 1378) Mouse Citrate Buffer pH Hybridoma Bank UI Isl-1/2 HD (IgG) 3-5µg/ml OCT/Paraffin 6.0; pressure cooker (39.4D5-S) Mouse Citrate Buffer pH Hybridoma Bank UI Isl-1 HD (IgG) 3-5µg/ml OCT/Paraffin 6.0; pressure cooker (40.2D6-S) Mouse Citrate Buffer pH MafA (IgG) 1 to 1000 OCT/Paraffin 6.0; microwave Bethyl (A300-611A) Mouse Citrate Buffer pH Hybridoma Bank UI Nkx6.1 (IgG) 1 to 50 OCT/Paraffin 6.0; microwave (F55A12-C) Somatostatin Goat Citrate Buffer pH (D20) (IgG) 1:250 Paraffin 6.0; microwave Santa Cruz (SC-7819) Supplementary Table 2: Secondary Antisera Raised against Raised in Conjugate Dilution Source Vector Laboratories (BA- Mouse IgG Horse Biotin 1 to 100 2001) Vector Laboratories (BA- Guinea Pig IgG Goat Biotin 1 to 200 7000) Jackson ImmunoResearch Guinea Pig IgG Donkey Cy3 1 to 500 (706 165 148) Jackson ImmunoResearch Guinea Pig IgG Donkey Cy2 1 to 500 (706 485 148) Jackson ImmunoResearch Rabbit IgG Donkey Cy3 1 to 500 (711 165 152) Rabbit IgG Goat Alexa Fluor 488 1 to 100 Life Technologies (A11008) ©2014 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db14-0096/-/DC1 SUPPLEMENTARY DATA Supplementary Table 3. qPCR Primers Name Forward Primer (5' to 3') Reverse Primer (5' to 3') Use AAG AAA GGG TGT AAA ACG Actin GCA AGT GCT TCT AGG CGG AC CAG C qPCR GGC CAG ACT TTG TTG GAT TGC GCT CAT CTT AGG CTT Hprt TTG TGT qPCR CTT GTG GCA ATG ACT GGG GCT GAC CAT TGA CCA CAT Amylase TCT TCC qPCR Pc2 AGG CAG CTG GCG TGT TTG GAA GCT GGT TCC GCT TGG A qPCR AGG ACC CAC AAG TGG AAC GTG CAG CAC TGA TCC ACA Insulin1 AAC ATG qPCR GCG CTC ATG AAG GAG CAA Islet-1 (Exon4) CTA TGA TGC TGC GTT TCT TGT CC qPCR GAG GAG GTC ATC CGA CTG GCA CTT CTC GCT CTC CAG MafA AAA AAT qPCR CTT AAC CTA GGC GTC GCA GAA GCT CAG GGC TGT TTT Pdx1 CAA TCC qPCR CCA GCG AAG AGG AAG AAC Slc2a2 GCA ACT GGG TCT GCA ATT TT AC qPCR CAA CAG GCA GGG TCA AAG PEPCK TTT AG AGG CCT CAG GCC CCT CTA T ChIP-qPCR Pdx1 Area I TGC CTG CAA AAC CAC TAA GA GAG GTA CCC TGC CTC CTC TC ChIP-qPCR ATG AAG CGT CGA GAT GGA Pdx1 Area II AG CAC CCC AGG ATG TTT GCT TA ChIP-qPCR CCG AGG AGA TAG CAT CGA Pdx1 Area III GT ATC TCT ACA GGC CTG CCT CA ChIP-qPCR CTA AGA GTG CTC TGG GCT Pdx1 Area IV TGC CTC AGT GCC CTT TAC TC CTG ChIP-qPCR Supplementary Table 4. EMSA dsDNA Oligonucleotides Pdx1 Enhancer HBE Enumeration dsDNA Oligonucleotide* Area I 1 TATCAGGACGTCCTGCTAATAAAAGACT Area I 2 ACTGTCCACAGTATAATTGGTTTACAG Area I 3 TCTTGCCTAATGGCTGGGTATCTCAGA Area I 4 GTATCACCCATAATGGATTTAGCCACCT Area I 5 TATGTAACCATTAGCCAAATCAAAAG Area II 1 GTGAGAATTTATTTATTTGTTTCCTGTGAAAA Area II 2 GCAAAAATATTAAATGGGAATAAAT Area II 3 AATGCATGCAATTAGACCAGAAGTGCTAA Area II 4 TAGGTAGATTATCTGTGAGGGTCAACA Area IV 1 CGTTTTTTTCTATTAAGAATGATTTTTTG Area IV 2 GAATTAAGTGGAATTAGCTAACAAATTATATA Area IV 3 GCATTAAGGTCCTCGTTAATGGTCC Area IV 4 TTATTGCCTGCCTTTAATTGTACTTAT *Red nucleotides indicate putative HBE. ©2014 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db14-0096/-/DC1 SUPPLEMENTARY DATA Supplementary Table 5. Microarray data comparing expression profile of islets isolated from Isl-1L/L; Tm L/L Pdx1-CreER IP(Tm) and Isl-1 IP(Tm) animals. This table lists the differentially-expressed genes (1.5 fold change and 10% FDR) in isolated islets from Isl-1L/L; Tm L/L Pdx1-CreER IP(Tm) animals compared to isolated islets from Isl-1 IP(Tm) animals. The fold change was averaged over all spots on the array for the transcripts of genes. The BestFDR is the lowest false discovery rate (%) for all spots included in the average. Gene FC BestFdr Aldh1a3:NM_053080 11.71 1.64 Reg3g:NM_011260 9.83 0.00 Chgb:NM_007694 8.93 0.00 Gc:NM_008096 8.90 2.15 Gast:NM_010257 8.65 0.00 Cck:NM_031161 7.91 0.00 Txnip:NM_001009935 6.95 0.00 Reg3b:NM_011036 6.87 0.00 Rgs2:NM_009061 6.09 0.00 Reg3a:NM_011259 4.98 8.41 Aldh1a3:AK086764 4.95 3.59 Fxyd6:NM_022004 4.95 0.00 Cartpt:NM_013732 4.94 0.00 Ace2:NM_027286 4.88 1.02 NAP033669-1:NAP033669-1 4.75 7.86 Tspan1:NM_133681 4.73 0.00 Arrdc4:NM_001042592 4.58 0.00 Rgs16:NM_011267 4.33 0.00 Malat1:NR_002847 4.24 3.74 Ddit4:NM_029083 3.95 0.00 Reg2:NM_009043 3.59 9.79 Hap1:NM_010404 3.59 0.00 Chga:NM_007693 3.49 2.57 Tle1:NM_011599 3.27 1.25 Reg1:NM_009042 3.13 9.20 Pif1:NM_172453 3.08 1.64 Sepp1:NM_001042614 3.04 1.64 Gatm:NM_025961 2.95 9.20 Arc:NM_018790 2.92 1.64 Ghrl:NM_021488 2.86 5.00 Akr1c19:NM_001013785 2.86 9.20 Cpb2:NM_019775 2.84 0.58 Bambi:NM_026505 2.80 2.57 Pamr1:NM_173749 2.79 1.02 Enpp2:NM_015744 2.78 0.00 Egr1:NM_007913 2.76 9.20 Nr1h4:NM_009108 2.76 2.15 Cldn5:NM_013805 2.76 0.00 Ocrl:NM_177215 2.74 0.00 Prss23:NM_029614 2.73 2.57 Lpin2:NM_001164885 2.72 0.00 Arl4d:NM_025404 2.72 7.86 Dmbt1:NM_007769 2.71 1.64 ©2014 American Diabetes Association.