
jfk_2020-09_michl_et_al.fm Seite 479 Dienstag, 18. August 2020 8:11 20 Journal für Kulturpflanzen, 72 (9). S. 479–482, 2020, ISSN 1867-0911, DOI: 10.5073/JfK.2020.09.04 Verlag Eugen Ulmer KG, Stuttgart Originalarbeit-Kurzmitteilung Gertraud Michl, Michael Fischer, Christoph Hoffmann Solanum mealybug Phenacoccus solani Ferris, 1918: New in Germany! Solanum mealybug Phenacoccus solani Ferris, 1918: Neu in Deutschland! 479 Abstract Zusammenfassung Scale insects (Insecta, Homoptera, Ord. Sternorrhyncha, Schildläuse (Insecta, Homoptera, Ord. Sternorrhyncha, Subord. Coccina) are often thermophilic species that, as Uord. Coccina) sind häufig wärmeliebende Arten, die a result of global warming, are currently expanding their aktuell ihre Verbreitung im Rahmen einer Klimaerwär- geographic distribution towards the poles. Within the mung polwärts ausdehnen. Innerhalb der Schmierläuse mealybugs (Superfam. Coccoidea, Fam. Pseudococcidae), (Üfam. Coccoidea, Fam. Pseudococcidae) treten in Mit- several species, which are of great importance as virus teleuropa mehrere Arten an Zierpflanzen in Gewächs- vectors in viticulture in Southern Europe, attack orna- häusern auf, die in Südeuropa als Virusvektoren im mental plants in greenhouses in Central Europe. It can be Weinbau von großer Bedeutung sind. Von diesen Arten expected that these species will also colonise Central ist zu erwarten, dass sie bei fortschreitender Klimaerwär- European vineyards as global warming progresses. mung auch mitteleuropäische Weinberge besiedeln. In this context our newly described finding is remark- Vor diesem Hintergrund bemerkenswert ist der hier able in that the mealybug Phenacoccus solani, which is neu beschriebene Befund, dass die aus Nordamerika und known from grapevines in North America and Asia, has Asien von Weinreben bekannte Pseudococcide Phenacoccus overwintered (2019–2020) outdoors on ornamental solani an Zierpflanzen im Weinbaugebiet Pfalz im Frei- plants in the Palatinate wine growing region. land überwintert hat. The species cannot be determined with the Central Die Art ist mit der mitteleuropäischen Bestimmungs- European identification literature and was therefore literatur nicht bestimmbar und wurde hier molekularbio- identified by molecular techniques using bio barcode logisch bestimmt. Die Befunde ergaben sich im Rahmen primers. The diagnosis was generated within the context der Etablierung eines nationalen Referenzlabors für Insek- of the establishment of a national reference laboratory ten am Julius Kühn-Institut. for insects at the Julius Kühn-Institut. Stichwörter: Solanum mealybug, Key words: Solanum mealybug, potential virus vector, potentieller Virus-Vektor, Klimawandel, climatic change, ornamental plants Zierpflanzen Affiliation Julius Kühn Institute (JKI) – Federal Research Centre for Cultivated Plants, Institute for Plant Protection in Fruit Crops and Viticulture, Geilweilerhof, Siebeldingen, Germany Correspondence Julius Kühn Institute (JKI) – Federal Research Centre for Cultivated Plants, Institute for Plant Protection in Fruit Crops and Viticulture, Geilweilerhof, 76833 Siebeldingen, Germany, e-mail: [email protected] Accepted 14 July 2020 jfk_2020-09_michl_et_al.fm Seite 480 Dienstag, 18. August 2020 8:11 20 Journal für Kulturpflanzen, 72 (9). S. 479–482, 2020, ISSN 1867-0911, DOI: 10.5073/JfK.2020.09.04 Verlag Eugen Ulmer KG, Stuttgart Introduction primers s3360 and 28b, the COI gene was amplified by Originalarbeit-Kurzmitteilung primers PcoF and LepR1. Climate change and increased plant trade promote the In the PCR assay, 1 μl of genomic DNA (2–20ng/μL) in spread of new pests. Greenhouses, apartments and balco- a mix of 0,2mM dNTPs, 0,2 μM of primers each and 2 u nies can serve as stepping stones for species previously of Taq-Polymerase (DreamTaq, ThermoScientific) was only found in protected indoor spaces. filled up with H2O to a final volume of 15μL. Cycling con- Mealybugs (Pseudococcidae) are of particular impor- ditions were according to SETHUSA et al. (2014) with the tance for horticultural crops (e.g. viticulture) because following adaption to the specific properties of the they are vectors of virus related diseases. Due to virus Taq-Polymerase: for both primer pairs a touch down PCR transmission by the native Phenacoccus aceris for exam- was performed, starting with an initial annealing tem- ple, it is becoming increasingly difficult to produce perature of 56°C for 1 min, and decreasing to 42°C with- healthy, virus-free vine planting material in Germany. In in 20 cycles. For the remaining 18 cycles, 42°C were kept Southern Europe, this role is taken on by different mealy- for 30 sec. After the initial denaturation step of 94°C for bug species, which in Germany so far have only been 3 min, further amplification cycles included 30 sec at found in greenhouses and apartments and which, with 94°C for denaturation, the appropriate annealing tem- advancing global warming, can also colonise the open peratures and times according to the touch down sched- field, as was recently established for the species Pseudo- ule, 30 sec at 72°C for extension and a final extension coccus viburni (SCHMUTTERER & SCHRAMEYER, 2013). The step of 72°C for 5 min. Cleaned PCR products (SLG, Hi- 480 introduction of new “greenhouse species” of mealybugs Yield Clean up) were sent to Mycrosynth SeqLab for into Germany is therefore not only a challenge for orna- bi-directional sequence analyses using the respective mental plant cultivation, but with increasing global PCR primers. warming can also become a threat to outdoor perennial crops such as grapevine or stone fruits. Morphological and microscopical identification Members of the genus Phenacoccus cannot be identified using palaearctic identification literature (KOSZTARAB & Material und Methods KOZAR, 1988, DANZIG & GAVRILOV-ZIMIN, 2014), because the insect is not yet mentioned there or it is mentioned under Origin of the mealybugs a synonym, with a differing morphospecies, i.e. P. defectus. The previously unknown mealybugs were introduced As a further obstacle, macroscopic morphological charac- into the home of the first two authors in Landau/Pfalz ters are largely absent in the group of the Pseudococcidae (Germany) in 2015 with a ponytail palm plant (Beaucarnea and innerspecific microscopic characters can be variable sp., Asparagaceae) acquired from the ornamental plant due to environmental influences (CHATZIDIMITRIOU et al., trade. Both on the palm plant and on the unprotected 2016). balcony of the apartment the species spread further and overwintered outside, especially on succulent plants (Sempervivum tectorum, Echeveria sp., both members of Results and Discussion the Crassulaceae family). Throughout our experiments, a 693 bp and 568 bp bi- Molecular determination directional aligned sequence was amplified for the 28S DNA-extraction and amplification. DNA was extracted region and the CO1 gene respectively, which was used for from two specimens of Phenacoccus solani by using the DNA barcoding. Sequencing analyses showed 100% con- CTAB-extraction-method according to EPPO PM 7/24(4). sensus with deposited data for Phenacoccus solani in Gen- Reduced volumes however were applied for all steps of the Bank. protocol. DNA was eventually resuspended in 30 μl ddH2O. For the description of P. solani see DANZIG & GAVRILOV- ZIMIN (2014) and CHATZIDIMITRIOU et al. (2016). The spe- PCR reaction conditions. Used primers are given in cies has 18 short wax thread pairs and appears yellow Table 1. Amplification of the 28S region was obtained by under the wax layer. There are no egg sacs because the Table 1. Used primers cited in SETHUSA et al. (2014) Primer Primer sequence Length of aligned gene of interest Reference PCR product in bp s3660 GAGAGTTMAASAGTACGTGAAAC DOWTON & AUSTIN (1988) 693 28S 28b TCGGAAGGAACCAGCTACTA WHITING et al. (1997) LepR1 TAAACTTCTGGATGTCCAAAAAATCA PARK et al. (2010) PcoF CCTTCAACTAATCATAAAAATATYAG568 COI PARK et al. (2010) Journal für Kulturpflanzen 72. 2020 jfk_2020-09_michl_et_al.fm Seite 481 Dienstag, 18. August 2020 8:11 20 Journal für Kulturpflanzen, 72 (9). S. 479–482, 2020, ISSN 1867-0911, DOI: 10.5073/JfK.2020.09.04 Verlag Eugen Ulmer KG, Stuttgart species is ovoviviparous, i.e. the crawlers hatch more or found in the Mediterranean region. The species overwin- less immediately after laying eggs (see Fig. 1). No males tered on Sempervivum tectorum on an unprotected south- Originalarbeit-Kurzmitteilung are present as the species is parthenogenetic. facing balcony in Landau in the Palatinate (winter of Since the studied mealy bug colony originates from the 2019/2020). This makes the new record even more plant trade, the species is probably more widespread on remarkable for Germany. ornamental plants in Germany. It was already described from greenhouses under the synonym P. defectus in Great Britain (MALUMPHY, 1997). In the field, the species is Possible control strategies known in Europe from Southern France (GERMAIN & MATILE-FERRERO, 2006), Italy (CHATZIDIMITRIOU et al., Control strategies of mealybugs include biological con- 2016), greenhouses in England (MALUMPHY, 1997, as trol by predators and parasitoids as well as chemical con- P. defectus) and Spain (BELTRÀ & SOTO, 2011). From USA, trol by insecticides; both strategies are reviewed by MANI Iran (CHATZIDIMITRIOU et al., 2016) and South Africa et al. (2014) for the viticulture sector. Chemical control of (WALTON & PRINGLE, 2004) the species has been reported mealybugs is difficult since the highly effective active
Details
-
File Typepdf
-
Upload Time-
-
Content LanguagesEnglish
-
Upload UserAnonymous/Not logged-in
-
File Pages4 Page
-
File Size-