
ORIGINAL RESEARCH published: 13 April 2018 doi: 10.3389/fnins.2018.00243 Adar3 Is Involved in Learning and Memory in Mice Dessislava Mladenova 1,2, Guy Barry 1,2†, Lyndsey M. Konen 1,3,4, Sandy S. Pineda 1,2, Boris Guennewig 1,2†, Lotta Avesson 1, Raphael Zinn 1,3,4, Nicole Schonrock 1,2, Maina Bitar 1,2†, Nicky Jonkhout 1,2, Lauren Crumlish 5, Dominik C. Kaczorowski 1, Andrew Gong 1†, Mark Pinese 1,2, Gloria R. Franco 6, Carl R. Walkley 7, Bryce Vissel 1,3,4 and John S. Mattick 1,2* Edited by: Michael F. Miles, 1 Garvan Institute of Medical Research, Sydney, NSW, Australia, 2 St. Vincent’s Clinical School, University of New South Virginia Commonwealth University, Wales, Sydney, NSW, Australia, 3 Centre for Neuroscience and Regenerative Medicine, Faculty of Science, University of United States Technology Sydney, Sydney, NSW, Australia, 4 St. Vincent’s Centre for Applied Medical Research (AMR), Sydney, NSW, Reviewed by: Australia, 5 Institute for Molecular Bioscience, The University of Queensland, St. Lucia, QLD, Australia, 6 Departamento de Sulev Kõks, Bioquímica e Imunologia, Instituto de Ciências Biológicas, Universidade Federal de Minas Gerais, Belo Horizonte, Brazil, University of Tartu, Estonia 7 St. Vincent’s Institute of Medical Research, Department of Medicine, St. Vincent’s Hospital, The University of Melbourne, Karine Merienne, Fitzroy, VIC, Australia Centre National de la Recherche Scientifique (CNRS), France The amount of regulatory RNA encoded in the genome and the extent of RNA editing by *Correspondence: John S. Mattick the post-transcriptional deamination of adenosine to inosine (A-I) have increased with [email protected] developmental complexity and may be an important factor in the cognitive evolution †Present Address: of animals. The newest member of the A-I editing family of ADAR proteins, the Guy Barry and Maina Bitar, vertebrate-specific ADAR3, is highly expressed in the brain, but its functional significance QIMR Berghofer Medical Research In vitro Institute, Brisbane, QLD, Australia; The is unknown. studies have suggested that ADAR3 acts as a negative regulator School of Medicine, The University of of A-I RNA editing but the scope and underlying mechanisms are also unknown. Queensland, St Lucia, QLD, Australia Meta-analysis of published data indicates that mouse Adar3 expression is highest in the Boris Guennewig, Sydney Medical School, Brain and hippocampus, thalamus, amygdala, and olfactory region. Consistent with this, we show Mind Centre, The University of that mice lacking exon 3 of Adar3 (which encodes two double stranded RNA binding Sydney, Camperdown, NSW, Australia Andrew Gong, domains) have increased levels of anxiety and deficits in hippocampus-dependent School of Medical Sciences, short- and long-term memory formation. RNA sequencing revealed a dysregulation of University of New South Wales, genes involved in synaptic function in the hippocampi of Adar3-deficient mice. We also Sydney, NSW, Australia show that ADAR3 transiently translocates from the cytoplasm to the nucleus upon Specialty section: KCl-mediated activation in SH-SY5Y cells. These results indicate that ADAR3 contributes This article was submitted to to cognitive processes in mammals. Neurogenomics, a section of the journal Keywords: ADAR3, Adar3exon3 mouse model, RNA editing, learning and memory, Adarb2 Frontiers in Neuroscience Received: 22 January 2018 Accepted: 27 March 2018 INTRODUCTION Published: 13 April 2018 Citation: The human brain has evolved to enable unique cognitive capabilities and has tripled in Mladenova D, Barry G, Konen LM, size since the split from the chimpanzee lineage around 5 million years ago. Current Pineda SS, Guennewig B, Avesson L, hypotheses suggest that the advancement of human cognition most likely arose through Zinn R, Schonrock N, Bitar M, the combined effects of the expansion of brain size and complexity, protein evolution Jonkhout N, Crumlish L, (including new splice variants) and the emergence of RNA-based regulatory mechanisms Kaczorowski DC, Gong A, Pinese M, that facilitate the epigenetic reformation of neural circuitry in response to experience Franco GR, Walkley CR, Vissel B and Mattick JS (2018) Adar3 Is Involved in (Barry and Mattick, 2012). Learning and Memory in Mice. One of the RNA-diversification/regulatory mechanisms is RNA editing. Two main types of Front. Neurosci. 12:243. RNA editing are known, one involving the deamination of cytidine to create uridine (C-to-U),and doi: 10.3389/fnins.2018.00243 the other, the deamination of adenosine to inosine (A-to-I). RNA editing not only alters the Frontiers in Neuroscience | www.frontiersin.org 1 April 2018 | Volume 12 | Article 243 Mladenova et al. ADAR3 Involved in Learning-Memory nucleotide sequence of target RNAs, but presumably also their MATERIALS AND METHODS structure-function relationships and interactions (Bass, 2002; Adar3exon3 Jantsch and Öhman, 2008). Mouse Lines: Generation of The existence of RNA editing in mammals was first discovered Mice tm1a(KOMP)Mbp in mRNAs for important neuroreceptors, such as the glutamate ES cells containing the targeted Adarb2 allele and serotonin receptors, and was initially thought to be (IKMC project number 39714; hereafter referred to as tm1a an interesting but idiosyncratic mechanism to change their Adar3 ) were generated by the trans-NIH Knock-Out amino acid sequence (Maas et al., 2003), presumably to alter Mouse Project (KOMP) and obtained from the KOMP tm1a(KOMP)Mbp the electrophysiological properties of synapses in response to Repository (www.komp.org). The Adarb2 activity or other cues. Subsequently, transcriptome-wide analyses allele contains a splice acceptor-beta-geo-polyA (SA-βgeo- revealed that A-I editing is widespread in humans, occurring pA) flanked by FRT sites located in intron 2 and loxP in thousands of transcripts, mostly in Alu sequences within elements flanking exon 3 (KOMP designation: KO first allele intronic and intergenic sequences, varying in different tissues (reporter-tagged insertion with conditional potential). Correct (Athanasiadis et al., 2004; Blow et al., 2004; Kim et al., targeting was confirmed and transgenic mice were generated 2004; Levanon et al., 2004; Ramaswami et al., 2012; Huntley from embryonic stem cell clones DEPD0006_14_A03 & et al., 2016). Although operating via a conserved mechanism DEPD0006_14_A05. Animals were generated by the Australian (Jin et al., 2009), the rates of A-to-I editing have increased Phenomics Network ES to Mouse service at Monash University. dramatically throughout vertebrate, mammalian and especially Positive mice were backcrossed to C57BL/6N background ′ primate evolution, with RNA editing in humans being more and genotyped by PCR. Primers P1 (located at the 3 end ′ ′ than an order of magnitude higher than in mouse (Kim et al., of the 5 homology arm) and P2 (located at the 5 end of 2004; Levanon et al., 2004). Moreover, more editing occurs in the exon ENSMUSE00000465454) will amplify a product of 554 human brain than in other primates (Paz-Yaacov et al., 2010). bp from the wild type allele. Primers P1 and P3 (located in Adenosine Deaminase Acting on RNA (ADAR) proteins, are the en-2 intron) will amplify a product of 246 bp from the ′ responsible for the execution of the A-to-I RNA editing through targeted allele. P1 = 5 CAATATACCACAACGAACATCTTTG ′ ′ ′ ′ hydrolytic deamination (Bass, 2002). Three ADAR enzymes 3 ; P2 = 5 GTCCCCAGGTTGCTCACATTTCG 3 ; P3 = 5 ′ (ADAR1-3) are encoded in the vertebrate genome, with ADAR3 CAACGGGTTCTTCTGTTAGTCC 3 . PCR conditions were: ◦ being vertebrate-specific (Chen et al., 2000). Common to all an initial denaturation step at 94 C 3 min, followed by 35 cycles ◦ ◦ ◦ ◦ ADARs is a C-terminal catalytic domain and multiple double- of 94 C 30s, 57 C 30s, 72 C 45s and a final cycle of 72 C for stranded RNA binding domains (Nishikura, 2010). In particular, 5 min. tm1a ADAR3 shares 50% amino-acid sequence identity with ADAR2 Heterozygous Adar3 animals (identified in-house (Melcher et al., 1996a) and is almost exclusively expressed in the as ADAR2BlacZ line) were crossed with heterozygotes nervous system, but its role is unknown. Unlike the other ADAR of a ubiquitous expressing Cre-recombinase mouse line proteins, ADAR3 contains a novel arginine rich motif (herein, R- (C57BL/6NTac-Gt(ROSA)26Sortm16(cre)Arte; Taconic). The domain), which allows the binding of single stranded RNA (Chen Cre-recombinase gene was identified using the following ′ et al., 2000), activity that may result in novel functions. Based primers, which yielded a 408 bp fragment: forward 5 ′ on in vitro evidence, ADAR3 is suggested to act as a dominant- GCATTACCGGTCGATGCAACGAGTGATGAG 3 ; and ′ negative regulator of A-to-I RNA editing (Chen et al., 2000). The reverse 5 GAGTGAACGAACCTGGTCGAAATCAGTGCG ′ R-domain has also been proposed to serve as a functional nuclear 3 . Thus, in addition to expressing Cre-recombinase, double localization signal (NLS) as it mediates interactions between heterozygous mice from the resulting cross, possessed one WT ADAR3 and the Importin α protein complex enabling ADAR3 to allele and one allele in which Cre-mediated deletion of the loxP- locate to the nucleus (Maas and Gommans, 2009) where A-to-I flanked portion of the Adar3 gene had occurred. To maintain RNA editing is believed to occur (Jin et al., 2009). the strain background and breed out the Cre-recombinase allele, Due to the novelty and relatively unknown function of double heterozygous animals were then crossed back to WT mice ADAR3 and its high expression in the nervous system, we from the ADAR2BlacZ line. Resulting heterozygous mice for the investigated the role of this protein in cognition and behavior KO and also Cre-negative, were used to maintain the colony by in ADAR3 deficient mice. We also demonstrate that mice breeding heterozygous by heterozygous. Homozygotes possessa lacking exon 3 of Adarb2 (referred to herein as Adar3exon3), non-functional ADAR3 protein and were thus referred to here as exon3 containing the double stranded RNA binding domains, display Adar3 . increased anxiety levels and impaired short and long-term hippocampus-dependent memory formation.
Details
-
File Typepdf
-
Upload Time-
-
Content LanguagesEnglish
-
Upload UserAnonymous/Not logged-in
-
File Pages18 Page
-
File Size-