Fottea, Olomouc, 18(2): 243–255, 2018 243 DOI: 10.5507/fot.2018.009 Morphology and phylogeny of three planktonic Radiococcaceae sensu lato species (Sphaeropleales, Chlorophyceae) from China, including the description of a new species Planktosphaeria hubeiensis sp. nov. Qi Zhang1, Lingling Zheng1, Tianli Li2, Guoxiang Liu2 & Lirong Song1* 1 State Key Laboratory of Freshwater Ecology and Biotechnology, Institute of Hydrobiology, Chinese Academy of Sciences, 430072 Wuhan, China; *Corresponding author e–mail: [email protected] 2 Key Laboratory of Algal Biology, Institute of Hydrobiology, Chinese Academy of Sciences, 430072 Wuhan, China Abstract: The family Radiococcaceae sensu lato, defined as colonial autospore–producing mucilaginous coccoid green algae, is widespread in terrestrial and freshwater habitats. Three species of Radiococcaceae sensu lato, including two Radiococcus species and one Planktosphaeria species, were described from China by light and electron microscopy. A new species of Planktosphaeria, Planktosphaeria hubeiensis sp. nov. was erected based on morphological comparisons and genetic analyses. Our phylogenetic analyses indicated that Radiococcaceae sensu lato is polyphyletic, and separated into three lineages. The Radiococcus species did not cluster into a monophyletic group in phylogenetic analyses; therefore the taxonomy of the genus Radiococcus should be revised in the future. Key words: morphology, Planktosphaeria, phylogeny, Radiococcaceae, Radiococcus, taxonomy Introduction 1959). The Radiococcaceae was erected by Fott (1959), validated by Komárek (1979) and revised by Kostikov Coccoid green algae are found commonly in aquatic et al. (2002). The family comprised autospore–produc- and terrestrial habitats worldwide, including extreme ing and zoospore–producing species in early definition environments such as postmining dumps, polar arid (Fott 1959), then was restricted to autospore–producing soils, and deserts (e.g. Broady 1986; Flechtner et al. species only in later revision (Komárek 1979). Now 1998; Patova & Dorokhova 2008; Fučíková et al. 2014). the family Radiococcaceae sensu lato can be defined as Conventionally, many coccoid taxa were assigned to the colonial autospore–producing green algae with spherical, order Chlorococcales sensu lato in the publication of the regularly or irregularly ellipsoid cells with a smooth cell famous handbook on ‘‘Chlorococcales’’ by Komárek & wall, lacking vegetative cell division, lying in more or Fott (1983). However, the majority of coccoid green less thick and more or less strong mucilage (Kostikov et algae are now understood as a polyphyletic assemblage of al. 2002). The Radiococcaceae sensu lato is distributed taxa distributed into Chlorophyceae, Trebouxiophyceae, in freshwater as well as terrestrial habitats worldwide, and Prasinophyceae within the division Chlorophyta and it is one of the most taxonomically difficult groups (Krienitz et al. 2003; Lewis & McCourt 2004; Krienitz in green algae (Pažoutová 2008). Radiococcacean & Bock 2012). They are important primary producers systematics is not clearly delimited, and there is still in freshwater communities, but very little is known much discussion about the taxonomic systems used to about their diversity due to their extremely small size classify species (Alves et al. 2014). The scope of this and simple morphology, which makes identification family has been changed according to the view of the by light microscopy essentially impossible (Soylu & different authors. All these considerations are based Gönülol 2012). on morphological characteristics (Wolf et al. 2003). Within the chlorophycean order Sphaeropleales, Ultrastructural data and molecular phylogenetic analyses several taxa are coccoid green algae in mucilaginous of this family are still scarce (Kostikov et al. 2002). The colonies. Many coccoid mucilaginous green algae were phylogenetic analyses based on 18S rRNA gene sequences placed in the families Palmellaceae or Chlorellaceae in early of three strains of Radiococcus polycoccus (Korshikov) generic system (Lemmermann 1915; Korshikov 1953), I. Kostikov, T. Darienko, A. Lukesová et L. Hoffmann, and then transferred to the family Radiococcaceae (Fott one strain of Planktosphaeria gelatinosa G.M. Smith 244 Zhang et al.: Three Radiococcaceae sensu lato species and one strain of Schizochlamydella capsulata (West) Total genomic DNA was extracted using the Universal DNA Korshikov (Radiococcaceae, Chlorophyta) indicated that Isolation Kit (AxyPrep, Hangzhou, China). PCR amplifica- the Radiococcaceae could be a polyphyletic assemblage tion was performed using 3 μL template DNA, 0.4 μmol/L of coccoid mucilage forming chlorophytes (Wolf et al. each primer, and 25 μL 2× Taq Master Mix (ExTaq; Takara, Dalian, China) in a 50 μL reaction volume. Two sets of PCR 2003). Phylogenetic analyses of a multigene dataset from primers were used for PCR amplification of SSU rDNA all sphaeroplealean families were used to examine the (18S–F, 5’–AACCTGGTTGATCCTGCCAGT–3’; 18S–R, monophyly of these morphologically similar taxa, which 5’–TGATCCTTCTGCAGGTTCACCTACG–3’) (Katana et were shown instead to be phylogenetically distinct and al. 2001), and ITS region, including ITS1, 5.8S rDNA, and very divergent (Fučíková et al. 2014). ITS2 (ITS–F, 5’–CAAGGTTTCCGTAGGTGA–3’; ITS–R, In this study, we investigated four planktonic 5’– GGCATCCTGGTTAGTTTCT–3’) (Luo et al. 2006). strains of Radiococcaceae sensu lato in different inland The SSU and ITS PCR began with 2 min at 94 °C, followed waters from China. We characterized the morphology, by 35 cycles of 40 s at 94 °C, 40 s at 55 °C, 1 min at 72 °C, and terminating with a final hold of 4 min at 72 °C. All PCR ultrastructure and phylogenetic position of these strains. amplicons were cleaned using AxyPrep DNA Gel Extraction Three strains belonged to the genus Radiococcus Schmidle, Kit (Axygen Biotechnology, Hangzhou, China). All amplicons and the other one was described as a new species of were sequenced from both sides using PCR primers. The Planktosphaeria G.M. Smith. PCR products were run on an ABI 3700 sequencer (Applied Biosystems, CA, USA). The newly determined SSU rDNA and ITS sequences were aligned with other sequences from GenBank database. After Material and Methods the elimination of apparently erroneous sequences and ambigu- ously aligned regions, two sets of alignments were produced by The algal strains were isolated from three different freshwater using Clustal X (v1.8) (Thompson et al. 1997) and MUSCLE environments in China, and deposited at the Freshwater Algae (Edgar 2004), and then modified manually by using MEGA7 Culture Collection at the Institute of Hydrobiology (FACHB, (Kumar et al. 2016). For SSU and ITS analyses, 44 taxa with China) (Table 1). The strains were cultivated on agar–solidi- 1569 characters and 48 taxa with 519 characters were aligned, fied and liquid BG11 medium (Stanier et al. 1971) at 22 °C respectively. Chlamydomonas reinhardtii P.A. Dangeard was under a 12 h:12 h light–dark regime, with illumination of 20 selected as outgroup. Phylogenies were estimated using maximum –2 –1 μmol.m .s . likelihood (ML) and Bayesian inference (BI) as implemented For morphological observations and microphotography in RAxML (v7.2.6) (Stamatakis 2006) and MrBayes (v3.1.2) an Olympus BX 53 light microscope (Olympus, Tokyo, Japan) (Huelsenbeck & Ronquist 2001). The program jModelTest with differential interference contrast were used. Micrographs (v2.1.5) was used to explore the model of sequence evolution were taken with an Olympus DP80 digital camera (Olympus, that best fits the data set by the Akaike information criterion Tokyo, Japan) and Olympus software cellSens Standard (v. 1.14). (Darriba et al. 2012). The evolutionary models used in ML For transmission electron microscopy, samples of each and BI analyses for SSU and ITS phylogenies were TIM2+I+G strain were fixed for 2 h in 2% glutaraldehyde in 0.05 M phos- and GTR+I+G, respectively. In ML analyses, nodal support phate buffer, and postfixed for 2 h in 1% osmium tetroxide in was assessed using 1,000 nonparametric bootstrap replicates. 0.05 M phosphate buffer, subsequently for 12 h in 1% uranyl All Bayesian Markov Chain Monte Carlo (MCMC) analyses acetate solution. Then the samples were dehydrated through were run with seven Markov chains (six heated chains, one an ethanol series and embedded in Spurr’s medium via propyl- cold) for 1,000,000 generations. Trees were sampled every 100 ene oxide (Spurr 1969). Ultrathin sections were cut using a generations. We obtained posterior probability (PP) values for diamond knife on Leica UC–7 (Leica, Wetzlar, Germany) and the branching patterns in BI trees as well as bootstrap (bootstrap poststained with lead citrate. Observations were carried out support value, BP) values in ML trees. using a Hitachi HT–7700 transmission electron microscope (Hitachi, Tokyo, Japan). Table 1. List of strains obtained from this work. Strain Species Locality Coordinates Collection data Accession Accession designation number number SSU ITS FACHB–2251 Planktosphaeria Bailian River, Huanggang, 30°35'53"N, 10 May 2015 MG712828 MG712833 hubeiensis Hubei Province, China 115°27'11"E FACHB–2248 Radiococcus sp. Hongsi Lake, Hanzhong, 32°54'12"N, 17 Aug. 2013 MG712830 MG712834 Shaanxi Province, China 106°52'45"E FACHB–2249 Radiococcus sp. Shimen Reservoir, 33°12'31"N, 17 Aug. 2013 MG712832 MG712829 Hanzhong, Shaanxi Prov- 106°57'43"E ince, China FACHB–2250 Radiococcus sp. Pond in Wuhan Zoo, Wu- 30°32'28"N, 10 Jun. 2013