![Circ-AFF2/Mir-650/CNP Axis Promotes Proliferation, Inflammatory](https://data.docslib.org/img/3a60ab92a6e30910dab9bd827208bcff-1.webp)
Qu et al. Journal of Orthopaedic Surgery and Research (2021) 16:165 https://doi.org/10.1186/s13018-021-02306-8 RESEARCH ARTICLE Open Access Circ-AFF2/miR-650/CNP axis promotes proliferation, inflammatory response, migration, and invasion of rheumatoid arthritis synovial fibroblasts Wei Qu1, Ling Jiang2 and Guanhua Hou3* Abstract Background: Circular RNAs (circRNAs) are associated with rheumatoid arthritis (RA) development. The purpose of this study is to explore the function and mechanism of circRNA fragile mental retardation 2 (circ-AFF2) in the processes of rheumatoid arthritis fibroblast-like synoviocytes (RAFLSs). Methods: Circ-AFF2, microRNA (miR)-650, and 2′,3′-cyclic nucleotide 3′-phosphodiesterase (CNP) levels were determined in synovial tissues of RA and RAFLSs by quantitative reverse transcription polymerase chain reaction or Western blotting. Cell proliferation, inflammatory response, apoptosis, caspase3 activity, migration, invasion, and epithelial-mesenchymal transition (EMT) were investigated using Cell Counting Kit-8 (CCK-8), enzyme-linked immunosorbent assay (ELISA), flow cytometry, Transwell, and Western blotting analyses. Dual-luciferase reporter, RNA immunoprecipitation (RIP), and pull-down assays were performed to assess the binding relationship. Results: Circ-AFF2 expression level was enhanced in synovial tissues of RA and RAFLSs. Circ-AFF2 overexpression facilitated cell proliferation, inflammatory response, migration, invasion, and EMT and repressed apoptosis in RAFLSs. Circ-AFF2 downregulation played an opposite role. Circ-AFF2 targeted miR-650, and miR-650 downregulation reversed the effect of circ-AFF2 interference on RAFLS processes. CNP was targeted by miR-650, and circ-AFF2 increased CNP expression by regulating miR-650. MiR-650 overexpression constrained cell proliferation, inflammatory response, migration, invasion, and EMT and contributed to apoptosis by decreasing CNP in RAFLSs. Conclusion: Circ-AFF2 promoted proliferation, inflammatory response, migration, and invasion of RAFLSs by modulating the miR-650/CNP axis. Keywords: Rheumatoid arthritis, Rheumatoid arthritis fibroblast-like synoviocytes, Circ-AFF2, MiR-650, CNP * Correspondence: [email protected] 3Department of Orthopedics, Peking University Medical Zibo Hospital, No.2, 5Th Street, Shanlv Xishan, Nanding Town, Zhangdian District, Zibo, Shandong, China Full list of author information is available at the end of the article © The Author(s). 2021 Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data. Qu et al. Journal of Orthopaedic Surgery and Research (2021) 16:165 Page 2 of 12 Introduction Materials and methods Rheumatoid arthritis (RA) is an autoimmune disease Bioinformatic analysis with common symptoms like musculoskeletal pain, The circular structure of circ-AFF2 (hsa_circ_0001947) swelling, and stiffness, which can impair physical func- was analyzed using CircView (http://gb.whu.edu.cn/ tion and life quality of patients [1]. The synovial tissue is CircView/)[19]. The targets of circ-AFF2 were searched a membranous organ lining joint cavities, which func- by starBase (http://starbase.sysu.edu.cn/)[20]. The tar- tions in joint destruction in RA [2]. Fibroblast-like syno- gets of miR-650 were analyzed utilizing miRDB (http:// viocytes are the dominant cells of synovial tissues, which mirdb.org/)[21], miRwalk (http://mirwalk.umm.uni- contribute to cartilage destruction and RA development heidelberg.de/)[22], starBase, and Tarbase (http:// by interacting with immune cells and taking part in the carolina.imis.athena-innovation.gr/diana_tools/web/ inflammatory response of synovial joints [2, 3]. More- index.php?r=tarbasev8/index)[23]. over, fibroblast-like synoviocytes have important roles in the onset of RA [4]. Identification of fibroblast-like syno- Patients and tissues viocyte function in the present study fits into the frame- The synovial tissues of RA were obtained from RA pa- work of translational orthopedics by filling the gap tients (n = 34) who were diagnosed as RA and suffered between basic sciences and clinical sciences [5, 6]. from joint surgery at Weihai Municipal Hospital. All RA Therefore, illustrating the mechanism of fibroblast-like patients fulfilled the American College of Rheumatology synoviocyte processes might help to understand RA criteria. The age- and gender-matched patients with pathogenesis. joint trauma were regarded as the normal group, and the Noncoding RNAs are involved in the autoimmunity synovial tissues from the normal group (n = 23) were and inflammation that play important roles in RA devel- collected during the joint surgery. The patients with opment [7]. Circular RNAs (circRNAs) are a type of autoimmune or infectious disease were excluded from closed noncoding RNAs which bind with microRNA the normal group. All participants signed the written in- (miRNA) to reduce miRNA activity, subsequently in- formed consent. This study complied with the guidelines creasing mRNA stability, which have key roles in aging- of the Declaration of Helsinki and was authorized by the related diseases, including RA [8]. Moreover, the dysreg- ethics committee of Weihai Municipal Hospital. ulated circRNAs are associated with the function of fibroblast-like synoviocytes in RA [9]. For example, hsa_ circ_0088036 increases fibroblast-like synoviocyte prolif- RAFLS isolation and culture eration and migration by modulating miR-140-3p and The fibroblast-like synoviocytes were isolated from syn- Sirtuin (SIRT)-1 [10]. CircRNA fragile mental retard- ovial tissues of RA (RAFLSs) or normal subjects (normal ation 2 (circ-AFF2; hsa_circ_0001947) is an upregulated cells). Briefly, the synovial tissues were cut into pieces circRNA in the peripheral blood of RA patients [11]. and subjected to 0.1% type-I collagenase (Solarbio, However, the function of this circRNA and how it par- Beijing, China) digestion at 37 °C for 4 h. After that, cells ticipates in fibroblast-like synoviocyte processes in RA were collected after centrifugation at 1000g for 5 min ’ ’ are mostly uncertain. and cultured in Dulbecco s modified Eagle s medium MiRNAs are another type of noncoding RNAs that have (DMEM) (Gibco, Grand Island, NY, USA) plus 10% fetal important functions in musculoskeletal conditions, such as bovine serum (FBS) (Gibco) and 1% penicillin/strepto- RA, osteoarthritis, and tendon injuries [12–14]. Furthermore, mycin (Gibco) at 37 °C with 5% CO2. miRNAs are related to the function of fibroblast-like syno- viocytes in RA [15]. A previous study suggests miR-650 re- Quantitative reverse transcription polymerase chain presses proliferation, migration, and invasion of rheumatoid reaction (qRT-PCR) arthritis synovial fibroblasts [16]. However, whether miR-650 RNA was extracted using Trizol (Vazyme, Nanjing, is relevant to the function of circ-AFF2 in fibroblast-like China) according to the instruction. The RNA from the synoviocytes remains uncertain. 2′,3′-Cyclic nucleotide 3′- nucleus or cytoplasm of RAFLSs was extracted using a phosphodiesterase (CNP) can prevent cartilage damage in in- cytoplasmic and nuclear RNA purification kit (Norgen flammatory arthritis [17]. Moreover, CNP level is enhanced Biotek, Thorold, Canada) according to the manufac- in RA patients [18]. Yet no study has been done to analyze turer’s instruction. RNA (800 ng) was applied for cDNA the function of CNP in fibroblast-like synoviocytes. synthesis using a miRNA or M-MLV reverse transcript- In this study, we analyzed the function of circ-AFF2 ase kit or (Thermo Fisher Scientific, Waltham, MA, on fibroblast-like synoviocyte processes in RA and ex- USA). The cDNA was mixed with SYBR (Vazyme) and plored the network of circ-AFF2/miR-650/CNP. This primer pairs (Sangon, Shanghai, China) and utilized for study might provide a novel insight into the pathology qRT-PCR. The specific primer sequences are shown in of RA. Table 1. Relative RNA expression was calculated using Qu et al. Journal of Orthopaedic Surgery and Research (2021) 16:165 Page 3 of 12 Table 1 The primer sequences for qRT-PCR in this study Name Sequence (5′-3′) Forward Reverse miR-3612 GCCGAGAGGAGGCATCTTGAG AGTGCAGGGTCCGAGGTATT miR-650 GCCGAGAGGAGGCAGCGCTC AGTGCAGGGTCCGAGGTATT U6 CAGGTCTCGGGAGAGAGATCG TGTCGTCTTGGAGATCGGGAG circ-AFF2 TCTTGGATGGAAAACCCAGT AGTTTCCAAGCGTGTTCTGG CNP GGAAAGCGCACGCTTAGGAG GGCAGGAATGTGTGGCTTTT ANKRD52 TGGCGAGACCGGAATCCT CCTTTTTCCAGGAGGGGTGG AXL CACGCGTAAACAACACGCA GTTATGGGCTTCGCAGGAGA HNRNPUL1 CTGCTTTCTGGAGCCGAAGA GGGTGCTCCTTGCTTCATCT APBB2 CTCCTTTGTTTGCAGGGATTTTGC TGGCATTCTTCCGTTCAGCC RAC1 TGATGCAGGCCATCAAGTGT
Details
-
File Typepdf
-
Upload Time-
-
Content LanguagesEnglish
-
Upload UserAnonymous/Not logged-in
-
File Pages12 Page
-
File Size-