This research was originally published in The Journal of Biological Chemistry. By Bradbury P, Bach CT, Paul A, O’Neill GM, Titled: Src Kinase Determines the Dynamic Exchange of the Docking Protein NEDD9 (Neural Precursor Cell Expressed Developmentally Down-regulated Gene 9) at Focal Adhesions. 2014 ;289(36): 24792-24800. doi:10.1074/jbc.M113.544106. Final publication is available at http://www.jbc.org/content/289/36/24792.long © 2016 The American Society for Biochemistry and Molecular Biology. Src and molecular exchange at adhesions Src Kinase Determines the Dynamic Exchange of the Docking Protein NEDD9 at Focal Adhesions* Peta Bradbury,1, 2 Cuc T Bach,1 Andre Paul,1 and Geraldine M O’Neill1, 2 1From the Children’s Cancer Research Unit, Kids Research Institute at The Children’s Hospital at Westmead, NSW, 2145 2Discipline of Paediatrics and Child Health, University of Sydney, NSW, 2006 * Running title: Src and molecular exchange at adhesions To whom correspondence should be addressed: Geraldine M. O’Neill, Children’s Cancer Research Unit, The Children’s Hospital at Westmead, Locked Bag 4001, Westmead, 2145, Australia Tel.: 61 2 98451206; Fax: 61 2 98453078; Email: [email protected] Key Words: NEDD9; focal adhesion; FRAP; Src kinase; FAK; migration Background: Dynamic exchange provides a focal adhesions is key in modulating rates of mechanism for rapidly reorganizing migration and invasion. Our study suggests that macromolecular structures. Src kinase activity determines NEDD9 Results: Exchange of the focal adhesion targeted exchange at focal adhesions and may similarly protein NEDD9 between the cytoplasm and focal modulate other focal adhesion-targeted Src adhesions is faster in the absence of Src kinase substrates to regulate cell migration. activity. Cell adhesion to the extra-cellular matrix Conclusion: Src kinase modulates the transit time is an essential component of cell migration and is of NEDD9 at focal adhesion sites. chiefly determined by integrin receptor binding to Significance: This is a new function for Src kinase extra-cellular matrix ligands. Ligand-bound and in cell migration. cross-linked integrins, together with the associated signalling molecules and polymerized actin ABSTRACT filaments in the cell interior, comprise specialized Dynamic exchange of molecules between the adhesion sites known as focal adhesions. These cytoplasm and integrin-based focal adhesions sites both tether the cells to the underlying matrix provides a rapid response system for and transmit signals bi-directionally between the modulating cell adhesion. Increased residency matrix and the cell cytoplasm (1). During cell time of molecules that regulate adhesion motility, focal adhesions must form and turnover, turnover contributes to adhesion stability, allowing grip and release of the underlying matrix ultimately determining migration speed across and translocation of the cell bodies. Rapid 2-dimensional surfaces. In the present study we exchange of proteins between focal adhesions and test the role of Src kinase in regulating dynamic the cytoplasm (measured in time scales of seconds) exchange of the focal adhesion protein facilitates the reorganization of the NEDD9/HEF1/Cas-L. Using either chemical macromolecular focal adhesions in response to inhibition or fibroblasts genetically null for Src conditions that favour migration (2,3). The time together with Fluorescence Recovery After with which focal adhesion stabilizing molecules Photobleaching (FRAP), we find that Src reside in the focal adhesion (residency time) significantly reduces NEDD9 exchange at focal therefore represents an important mechanism to adhesions. Analysis of NEDD9 mutant modulate adhesion to the extra-cellular matrix and constructs with the two major Src interacting consequently migratory behaviour. domains disabled revealed the greatest effects The balance of focal adhesion assembly were due to the NEDD9 SH2 binding domain. versus turnover determines migration speed across This correlated with a significant change in 2D 2-dimensional (2D) planar surfaces (4-7). This is a migratory speed. Given the emerging role of biphasic relationship, where either too little or too NEDD9 as a regulator of focal adhesion much adhesion slows 2D cell speed, and maximal stability, the time of NEDD9 association at the migration speeds are observed at intermediate 1 Src and molecular exchange at adhesions attachment strengths (8,9). Thus conditions which EXPERIMENTAL PROCEDURES alter the turnover rate of focal adhesions can Cells and cell culture - Src/Yes/Fyn (SYF-/-) null correspondingly tune cell migration speed. and FAK -/- mouse embryo fibroblasts (MEFs) Investigations of a number of focal adhesion were from American Type Culture Collection molecules have confirmed that many serve to (ATCC) and NEDD9 (NEDD9-/-) MEFs have regulate focal adhesion turnover rates (10). While been described (11). All lines were maintained in a number of molecules stimulate focal adhesion Dulbecco’s Modified Eagle’s Medium (DMEM) turnover, our recent data have revealed that the supplemented with either 10% foetal bovine serum focal adhesion associated molecule (FBS) (Life Technologies), 1% NEDD9/HEF1/Cas-L instead stabilizes focal penicillin/streptomycin (Invitrogen) and 2µg/ml adhesions and can thus tune 2D migration speed fungizone (Life Technologies) or 15% FBS and (11,12). 1% antibiotic/antimycotic (Life Technologies), at 0 NEDD9 is a docking protein at focal 37 C and 5% CO2. adhesions that is subject to extensive Antibodies - Monoclonal anti-NEDD9, phosphorylation modification by Src kinase (13). polyclonal anti-FAK (Cell Signalling Technology); NEDD9 encompasses multiple protein-protein monoclonal anti-paxillin and p130Cas (BD interaction domains that facilitate the docking of Transduction Laboratories); anti-Src (Clone interacting partner proteins, stimulating a variety GD11) (Millipore); monoclonal anti-GFP (Roche), of cellular processes, including a prominent pro- monoclonal anti-GFP, polyclonal anti-Paxillin migratory/pro-metastatic role (13,14). Recruitment pY118 (Life Technologies) anti-β-actin, anti- to focal adhesions is achieved through interaction HSP-70 (Sigma); horseradish peroxidase- with focal adhesion kinase (FAK) resident at the conjugated goat secondary antibodies for focal adhesions (15). FAK then phosphorylates a immunoblot analysis (Amersham Pharmacia tyrosine motif (DYDY) in the NEDD9 c-terminal Biotech) and; Cy3-conjugated donkey anti-rabbit domain that creates a binding site for Src (the Src and Cy5-conjugated donkey anti-mouse IgG binding domain SBD) (13). Once docked, Src secondary antibodies for immunofluorescence phosphorylates up to 13 consensus tyrosine (Jackson Immunoresearch). phosphorylation sites in the NEDD9 substrate Plasmids and protein expression - NEDD9 binding domain (SH2BD). This creates docking fused to GFP has been previously described (19). sites for SH2-domain containing partner proteins QuikChange kit (Stratagene) was used to mutate and is an important determinant of NEDD9 NEDD9 Y629 and Y631 to phenylalanines regulated cell migration (12,16-18). (NEDD9.DFDF). Primer pairs: forward 5' In addition to the well-established role for GCTGGATGGATGACTT3’, reverse Src phosphorylation in stimulating NEDD9- 5’TCGAAGTCATCCATCCAGC 3' and forward mediated signalling cascades, we hypothesized that 5’CGATTTCGTCCACCTACAGGG3' and reverse NEDD9 phosphorylation by Src may also regulate 5' CCCTGTAGGTGGACGAAA3’. SH2BD the residency time at focal adhesions. Increased domain deletion was achieved by synthesizing the opportunities for interactions between NEDD9 and sequence encoding the first 67 amino acids (M1- other focal adhesion molecules as a result of M67), flanked by EcoR1 and AvaI restriction sites, extensive phosphorylation by Src could increase then joined by restriction enzyme-mediated the time in which NEDD9 is tethered at the focal ligation with the NEDD9 beginning at S358 adhesions by stabilizing interactions with partner (deleting the intervening 290 residues). The mutant molecules. While there have been a handful of sequence was sub-cloned into the same GFP vector studies investigating the exchange rates of focal backbone as the wild-type sequence. All constructs adhesion molecules, at present there is little were confirmed by DNA sequencing. Transient understanding of how this is controlled. We have MEF cell transfection was achieved using a employed Src/Yes/Fyn (Src)-/- mouse embryo nucleofector (Amaxa) and MEF1 nucleofector kit fibroblasts (MEFs) and NEDD9 -/- MEFs to (Lonza). investigate the role of Src kinase in NEDD9 Immunoprecipitation, immunoblot and dynamic exchange at focal adhesions. Our data immunofluorescence - Immunoprecipitation was indicate that Src regulates the transit time of performed using 1 mg of protein lysate extracted in NEDD9 at focal adhesions. NP-40 lysis buffer (50 mM Tris (pH 7.5) 150 mM NaCl, 5 mM EDTA, 1% NP-40) freshly sup- plemented with protease inhibitors (1 mM 2 Src and molecular exchange at adhesions NA3VO4, 1 mM PMSF, 1 μg/mL aprotinin, 1 by incubation with 2µM PP2 overnight prior to μg/mL leupeptin). Protein G agarose was swollen analysis. Statistical analysis was performed using in 10 mM HEPES (pH 7.4) on ice for 30 min, then GraphPad Prism. washed in PBS and resuspended at a concentration Live cell imaging, migration and of 4 mg/ml in NP- lysis buffer supplemented with spreading analysis - Time-lapse images of protease inhibitors. Cell lysates were pre-cleared transfected cells at low confluence