MRPL28 (NM 006428) Human 3' UTR Clone – SC204018 | Origene

MRPL28 (NM 006428) Human 3' UTR Clone – SC204018 | Origene

OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC204018 MRPL28 (NM_006428) Human 3' UTR Clone Product data: Product Type: 3' UTR Clones Product Name: MRPL28 (NM_006428) Human 3' UTR Clone Vector: pMirTarget (PS100062) Symbol: MRPL28 Synonyms: MAAT1; p15 ACCN: NM_006428 Insert Size: 736 bp Insert Sequence: >SC204018 3’UTR clone of NM_006428 The sequence shown below is from the reference sequence of NM_006428. The complete sequence of this clone may contain minor differences, such as SNPs. Blue=Stop Codon Red=Cloning site GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC GTGGTGCAGAAGAGAGCCAGTGGCCAGTGACCACACAGCTCCTCCATGCCTGACCAACAGGCCCAGCTT TCCCTGCCAGGCCCTTTGCACTGAGGACACAGATCCCGGGGAGCTGTGAGGGCCACCGGTGGGCAGTGG GTGGATCCTGGTTTCGTGTGCTGCCCATGCACCTTCCAGCCCGGGGCCAGCTTGGCAGGGATCCCCAGG AGGCCTGGGCCGCCCAGAGGCTCCTCTCAGGCTGGGCCCCGACGTTTGCGGCAGTGTTCCTTGTGCCCG TGGGGCCGGGAGCGAGTAAAGTCTGGGCCAGGCTGTGTGTGTGTATCTTTGCTTTGAGGACTGGTGTTC TCTTTGGGGATCCTGATCCTGTCACCCCTGCCCTTGCTGCCCCTGAGACCTCGGATGAGCCGTGGGCAT TGACTCTGGCTGTGCCCGTCCCCCGGTGAGCTGCAGAGAGCGAGGTTCAATTCTGTGTTTTGTGTTTTT TTTTCTTTTCTTTTTTTGAGACGGAGTCTTGCTCAGTCACCCAGGCTGGAGTGCAGTGGCACGATCTGG ACTCACTACAACCTCCACCTCCAGAGTTCAAGTGATTGTCCTGTCTCAGCCTCCTGAGTAGCTGGGATT ACAGGCACCCCGCTATCATGTATGGCTAATTGTATTTTAGTAGAGAAGGGGTTTCACCATGTTGGCCAG GCTGGGCTTGAACTCCTGACCTCAGGTGACCCACCTGCCTCAACCT ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG Restriction Sites: SgfI-MluI OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs). RefSeq: NM_006428.5 This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 2 MRPL28 (NM_006428) Human 3' UTR Clone – SC204018 Summary: Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein, a part of which was originally isolated by its ability to recognize tyrosinase in an HLA-A24-restricted fashion. [provided by RefSeq, Jul 2008] Locus ID: 10573 MW: 26.2 This product is to be used for laboratory only. Not for diagnostic or therapeutic use. ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 2 / 2.

View Full Text

Details

  • File Type
    pdf
  • Upload Time
    -
  • Content Languages
    English
  • Upload User
    Anonymous/Not logged-in
  • File Pages
    2 Page
  • File Size
    -

Download

Channel Download Status
Express Download Enable

Copyright

We respect the copyrights and intellectual property rights of all users. All uploaded documents are either original works of the uploader or authorized works of the rightful owners.

  • Not to be reproduced or distributed without explicit permission.
  • Not used for commercial purposes outside of approved use cases.
  • Not used to infringe on the rights of the original creators.
  • If you believe any content infringes your copyright, please contact us immediately.

Support

For help with questions, suggestions, or problems, please contact us