ANTICANCER RESEARCH 29: 1089-1094 (2009) Indirect Antitumor Effects of Bisphosphonates on Prostatic LNCaP Cells Co-cultured with Bone Cells TOMOAKI TANAKA, HIDENORI KAWASHIMA, KEIKO OHNISHI, KENTARO MATSUMURA, RIKIO YOSHIMURA, MASAHIDE MATSUYAMA, KATSUYUKI KURATSUKURI and TATSUYA NAKATANI Department of Urology, Osaka City University Graduate School of Medicine, Osaka 545-8585, Japan Abstract. Bisphosphonates are strong inhibitors of effectively inhibit bone absorption are available for osteoclastic bone resorption in both benign and malignant reducing the risk of skeletal complications in bone bone diseases. The nitrogen-containing bisphosphonates metastases of prostate cancer as well as those of other solid (N-BPs) have strong cytotoxicity via inhibition of protein tumors characterized by osteoclastic lesions. prenylation in the mevalonate pathway, and also demonstrate Bisphosphonates are potent inhibitors of osteoclast activity direct cytostatic and proapoptotic effects on prostate cancer and survival, thereby reducing osteoclast-mediated bone cells. We confirmed the usefulness of a co-culture system absorption (1, 4-6). The chemical structure of bisphosphonates comprised of prostatic LNCaP cells, ST2 cells (mouse- contributes to their mechanism of action: Non-nitrogen- derived osteoblasts) and MLC-6 cells (mouse-derived containing compounds (e.g. etidronate, clodronate) are osteoclasts) in vitro. N-BPs (pamidronate and zoledronic metabolized to cytotoxic analogues of ATP (7), while newer acid) inhibited both androgen receptor transactivation and nitrogen-containing bisphosphonates (N-BPs; pamidronate, tumor cell proliferation by suppressing the activities of both ibandronate, zoledronic acid) have strong cytotoxic effects on osteoclasts and osteoblasts with low-dose exposure. This cells via inhibition of protein prenylation in the mevalonate indirect inhibition of prostate cancer cells via bone cells pathway (8, 9). The more potent N-BPs have also been could be beneficial in treating prostate cancer patients with demonstrated to exert direct cytostatic and proapoptotic effects bone metastases. on prostate cancer cell lines in vitro (10), the prevention of cancer cell adhesion and invasion via reduction of matrix Approximately 70% of patients with advanced prostate metalloproteinase (MMP) expressions (11-13), and the cancer have bone metastases (1-3). These bone metastases inhibition of testosterone-induced angiogenesis in a castrated are associated with considerable skeletal morbidity, animal model (14). Thus, treatment with N-BPs could exert a including severe bone pain requiring narcotics or palliative strong inhibitory effect on osteoclastic bone resorption and radiation therapy, pathological fractures, spinal cord also have antitumor potential against bone metastases, directly, compression and hypercalcemia of malignancy (HCM), or indirectly, via alterations in the bone microenvironment (5, which significantly decrease quality-of-life. These 8). In this study, we investigated the biological effects of bone complications result from excessive bone turnover, mainly cells on LNCaP cells and the antitumor effects of low doses bone formation which represents malignant bone lesions. of two N-BPs (pamidronate and zoledronic acid) on LNCaP While the principal characteristic of bone metastases in cells via both osteoblasts and osteoclasts in vitro. prostate cancer is osteoblastic lesions, bone absorption is initially needed to create the space for metastatic sites and Materials and Methods to enhance bone formation. Therefore, therapies that Materials. Pamidronate and zoledronic acid were provided by Novartis Pharma AG (Basel, Switzerland) and 5α-dihydrotesto- sterone (DHT) was purchased from Sigma-Aldrich (St. Louis, MO, Correspondence to: Dr. Tomoaki Tanaka, Department of Urology, USA). The dual-luciferase reporter assay was purchased from Osaka City University, Graduate School of Medicine, 1-4-3 Promega (Madison, WI, USA) and the WST-1 cell proliferation Asahimachi, Abeno-ku, Osaka 545-8585, Japan. Tel:+81 6 6645 assay was obtained from Takara Biochemicals (Tokyo, Japan). The 3857, Fax: +81 6 6647 4426, e-mail: [email protected] prostate cancer cell line, LNCaP, was purchased from the American cu.ac.jp Type Culture Collection (Rockville, MD, USA) and the mouse- derived osteoblast cell line, ST2, and the mouse-derived osteoclast Key Words: Bisphosphonate, pamidronate, zoledronic acid, LNCaP, cell line, MLC-6, were obtained from Riken cell bank (Ibaragi, osteoblast, osteoclast. Japan). The reporter gene plasmid, a mouse mammary tumor virus 0250-7005/2009 $2.00+.40 1089 ANTICANCER RESEARCH 29: 1089-1094 (2009) Table I. Nucleotide sequence of primers used for reverse transcription- polymerase chain reaction. Gene Nucleotide sequence (5’¡3’) TRAP TTCCTCCAGGATGGATTCATGG CTGAAGATACTGCAGGTTGTGG COL1A1 CATGGGTCCTTCTGGTCCTCGT CTTGCCAGCTTCCCCATCATCT GAPDH ACCACAGTCCATGCCATCAC TCCACCACCCTGTTGCTGTA TRAP, tartrate-resistant acid phosphatase; COL1A1, type Ι collagen; GAPDH, glyceraldehydes-3-phosphate dehydrogenase. Figure 1. Schematic representation of in vitro co-culture system with (10 μM) or zoledronic acid (10 μM) was added, and the cells were LNCaP cells,osteoclasts (ML-6) and osteoblasts (ST2), followed by incubated for an additional 48 h. Premix WST-1 was added to the additional experiments. medium and the cells were incubated for 3 h. Absorbance was measured at 450 nm. All assays were carried out in triplicate. RNA extraction and RT-PCR. Total RNA was extracted from the (MMTV)-luciferase reporter plasmid (pMMTV-luc) was kindly mixture of ST2 and MLC-6 with ISOGEN (NipponGene, Japan). provided by N.V. Organon (Oss, Netherland). Complementary DNA was synthesized from each total RNA (500 ng), subjected to PCR amplification with gene-specific PCR primers Cell culture. The prostate cancer cell line, LNCaP, and mouse and Taq DNA polymerase using a Takara RNA PCR kit according to osteoblast cell line, ST2, were maintained in RPMI-1640 with 10% the manufacturer’s instructions. The primers designed for fetal calf serum (FCS). The mouse osteoclast cell line, MLC-6, was glyceraldehyde-3-phosphate dehydrogenase (GAPDH), tartrate- maintained in McCoy’s 5A medium with 20% FCS. resistant acid phosphatase (TRAP) and type 1 collagen (COL1A1) are listed in Table I. The PCR consisted of 27 cycles for RANK and Co-culture of LNCaP cells with bone cells and transient transfection. RANKL and 25 cycles for GAPDH. An in vitro bicompartment culture system was used (0.4 μm pore; Becton Dickinson Labware, Franklin Lakes, NJ, USA) (Figure 1). Statistical analysis. Data analysis was performed using Student’s t- In brief, LNCaP cells were seeded onto the six-well outer tissue test. P<0.05 was considered to denote a statistically significant 4 3 culture plate (1.0×10 cells/ well), and ST2 (5.0×10 cells/ well) and difference. MLC-6 (5.0×103 cells/ well) cells were plated on the inner culture insert. Co-culture was performed in RPMI-1640 with 10% FCS. Results After 120 h, LNCaP cells were transiently transfected using the FuGENE 6 transfection reagent (Roche) with 2 μg of a DNA Effects of bone cells on the transcriptional activity of AR in mixture containing the pMMTV-luc reporter plasmid (1 μg) and LNCaP cells. To examine whether a prostate cancer cell line, pRL-TK (40 ng), in accordance with the manufacturer’s instructions LNCaP, is affected by bone cells, we investigated the effects and grown for an additional 24 h in RPMI-1640 with 10% fetal bovine dialyzed serum (10,000 MW cut-off; Sigma). DHT (5 nM) of two bone cell lines (ST2 and MLC-6) on endogenous AR with or without either pamidronate (10 μM) or zoledronic acid (10 transcriptional activity in LNCaP cells. As shown in Figure μM) was then added and the cells were cultured for another 48 h. 2, the DHT-induced transcriptional activity of AR was not influenced by co-culture of LNCaP with either ST2 or MLC- Dual luciferase assay. Endogenous androgen receptor (AR) 6. In contrast, co-culture of both ST2 and MLC-6 in the transcriptional activities were monitored by a reporter gene assay same insert significantly enhanced DHT-induced AR activity using a pMMTV-luc. LNCaP cells were harvested, lysed in passive in the coexisting LNCaP cells. Accordingly, we examined the lysis buffer, subjected to two cycles of freeze/thaw and analyzed for luciferase activities using a dual luciferase reporter assay system effects of bisphosphonates on LNCaP cells via two bone cell (Promega) according to the methods recommended by the lines using this co-culture system with three different cell manufacturer. lines (LNCaP, ST2 and MLC-6). Cell proliferation assay. To evaluate the effect of bisphosphonates Inhibition of bone cell-induced AR activity in LNCaP cells by against tumor cell proliferation, we conducted a WST-1 assay (Premix N-BPs (pamidronate, zoledronic acid). The transcriptional WST-1 Cell Proliferation System; Takara Bio, Japan). In brief, LNCaP activities of AR in LNCaP cells co-cultured with or without cells were seeded onto the six-well outer tissue culture plate (1.0×104 cells/ well), and ST2 (5.0×103 cells/ well) and MLC-6 (5.0×103 cells/ ST2 and MLC-6 cells were evaluated by a dual luciferase well) cells were plated onto the inner culture insert. Co-culture was reporter assay after incubation with pamidronate or performed in RPMI-1640 with 10% FCS. After 120 h, pamidronate zoledronic acid for 2 days. As shown in Figure 3A, the DHT- 1090 Tanaka et al: Effects of Bisphosphonates on Prostate Cancer Cells