Cukurova Medical Journal Cukurova Med J 2016;41(2):248-252 ÇUKUROVA ÜNİVERSİTESİ TIP FAKÜLTESİ DERGİSİ DOI: 10.17826/cutf.202020 ARAŞTIRMA/RESEARCH Gene expression analysis of FABP4 in gastric cancer Gastrik kanserde FABP4 gen ekspresyon analizi Abdulkarim Yasin Karim University of Salahaddin, College of Science, Department of Biology, Iraq Cukurova Medical Journal 2016;41(2):248-252. Abstract Öz Purpose: Gastric cancer has high incidence and mortality Amaç: Gastrik kanser birçok ülkede yüksek oran ve rate in several countries and is still one of the most mortalite oranına sahiptir ve günümüzde halen en sık frequent and lethal disease. In this study, we aimed to görülen ölümcül hastalıklarından biridir. Bu çalışmada, determine diagnostic markers in gastric cancer by gastrik kanseri teşhisini için moleküler tekniklerle FABP4 molecular techniques; include mRNA expression analysis geninin mRNA ekspresyon analizini içeren yeni markırlar of FABP4 gene. Fatty acid binding protein 4 (FABP4) belirlemeyi amaçladık. Yağ asidi bağlayıcı protein 4 gene encodes the fatty acid binding protein found in (FABP4) geni adipositlerde bulunan yağ asidi bağlayıcı adipocytes. The protein encoded by FABP4 are a family of proteini kodlar. FABP4 tarafından kodlanan protein, uzun small, highly conserved, cytoplasmic proteins that bind zincirli yağ asitleri ve diğer hidrofobik ligandlara bağlanan long-chain fatty acids and other hydrophobic ligands. It is küçük, yüksek düzeyde korunmuş, sitoplazmik bir protein thought that FABPs roles include fatty acid uptake, ailesidir. FABP’ün yağ asidi alımı, taşınması ve transport, and metabolism. metabolizmayı içeren görevleri olduğu düşünülmektedir. Material and Methods: Total RNA were extracted from Gereç ve Yöntem: Total RNA, 47 gastrik kanserinin paired tumor and normal tissues of 47 gastric cancer. The normal dokularından ve eşleştirilmiş tümörden mRNA expression level of FABP4 was measured çıkarılmıştır. FABP4 mRNA ekspresyon seviyesi yarı- employing semi- quantitative reverse transcription- kantitatif reverse transkripsiyon polimeraz zincir polymerase chain reaction (RT- PCR). reaksiyonu (RT-PCR) kullanılarak ölçülmüştür. Results: The mRNA expression level of FABP4 was Bulgular: FABP4’ün mRNA ekspresyon seviyesi önemli significantly decreased (down- regulated). ölçüde azalmıştır (down regüle olmuştur). Conclusion: Down-regulation of FABP4 gene seems to Sonuç: FABP4 geninin down-regülasyonunun, gastrik occur at the initial steps of gastric cancer development. In kanserinin başlangıç aşamalarında meydana geldiği order to confirm the relationship between the gastric görünmektedir. İmmünohistokimya ve epigenetik teknikler tumor and FABP4 gene, further analysis like gibi ileri analizler, FABP4 geni ve gastrik kanser arasındaki immunohistochemistry and epigenetc techniques are ilişkiyi doğrulamak için gereklidir. necessary. Key words: Gastric cancer, FABP4, expression analysis, Anahtar kelimeler: Gastrik kanser, FABP4, ekspresyon semi- quantitative RT- PCR. analizi, yarı-kantitatif RT-PCR. INTRODUCTION gastric cancer3. Most cases are recorded in Japan, China, South America, and significantly less in Gastric cancer is the second leading cause of cancer Western Europe and in the United States3. Gastric death and the fourth most prevalent malignancy cancer consists of two pathological variants. The worldwide, affecting about one million people per development of intestinal tumours is characterized year1. In the United States, an estimated 21.320 by progression of several sequential steps that start cases of gastric cancer diagnosed and 10.540 with gastritis and then progresses to mucosal patients die from this disease in 20122. There is a atrophy, intestinal metaplasia, dysplasia and geographic diversification in the occurrence of carcinoma with subsequent metastatic Yazışma Adresi/Address for Correspondence: Dr. Abdulkarim Yasin Karim, Salahaddin University, Science College, Department of Biology, Iraq, E-mail: [email protected]. Geliş tarihi/Received: 16.09.2015 Kabul tarihi/Accepted: 28.10.2015 Karim Cukurova Medical Journal dissemination4. Adenocarcinomas arising from an important role in regulating hallmarks of cancer gastric epithelium are the most common includes gastric cancer, breast cancer and ovarian malignancies of the stomach (90% of cases)4. cancer9. Malignancies arising from connective tissue In this study, for the first time we aimed to (sarcoma) and from lymphatics (lymphoma) are less determine and measure exon 2 for FABP4 gene common5. Environmental and genetic factors are among gastric cancer patients in Erbil province both important in gastric carcinogenesis6. Many using semi-quantitative reverse transcription- studies have reflected that gastric cancer is polymerase chain reaction and image software. associated with a number of risk factors; such as Helicobacter pylori infection, age, family history, smoking, alcohol consumption, obesity and diet5. MATERIALS AND METHODS Fatty acid binding protein 4 (FABP4) gene encodes Sample collection the fatty acid binding protein found in adipocytes, it has been localized in a region of chromosome 8q21 The samples were collected from the Tumor unit at and consists of 4 exons7. The protein encoded by Rizgary hospital in Erbil, Iraq. A total of 94 samples FABP4 are a family of small, highly conserved, were analyzed. The study included 47 paired normal cytoplasmic proteins that bind long-chain fatty acids and tumor samples of patients that were grouped and other hydrophobic ligands. It is thought that according to the types of gastric cancer and the FABPs roles include fatty acid uptake, transport, clinical characteristics of the patients, including and metabolism7. Expression biomarkers can be gender and average of age (Table 1). The tissue used clinically to predict the effectiveness and samples of the gastric stored at -80˚C until further toxicity of anticancer drugs and thus help to achieve analysis. The study was approved by the local Ethics individualized treatment8. Glenn et al. suggested Committee and was conducted in accordance with fatty acid binding proteins, such as FABP4, that play the guidelines of the Declaration of Helsinki. Table 1. Number of patient samples according to type of stomach cancer and gender Cancer types Male/pair Female/pair Total Ages Gastric Adenocarcinoma 24 8 32 57 - 68 Gastric diffuse cancer 7 3 10 44 - 58 Lymphoma gastric cancer 2 3 5 53 - 63 Total 33 14 47 subsequent analysis. Complementary DNA (cDNA) RNA extraction and cDNA converted is synthesized from a messenger RNA (mRNA) RNA extraction was carried out upon confirmation template in a reaction catalyzed by the enzymes by histopathological analysis. RNA from gastric reverse transcriptase and DNA polymerase. In this tissue was extracted with RNeasy Total RNA Kit study, ProtoScript First Strand cDNA Synthesis Kit (Qiagen, Hilden, Germany). The tissue was (BioLabs, England) was utilized. A control reaction homogenized in 700 μl lysis buffer RLT using a without reverse transcriptase is recommended to Polytron rotor-stator followed by aspiration 10 examine the DNA contamination in the samples. times through a 21 gauge syringe needle to shear Variable amount of total RNA were employed for chromosomal DNA. each sample since quality and quantity of total RNA are not equal. Cell pellets were resuspended in 700 μl lysis buffer RLT by aspiration 10 times through a 21 gauge RT-PCR amplification and gel syringe needle. RNA was eluted from spin columns discrimination with 40 μl diethylpyrocarbonate treated water. Quantification and qualification of total RNA Semi-quantitative reverse transcriptase-PCR concentration was performed using NanoDrop technique was used in this research to amplify the (ND- 1000, USA). Samples with (A260 – A320 ) / mRNA sequence of exon 2 in FABP4. A pairs of (A280 – A320 ) ratios less than 1.7 and/or yields primer were designed by SDSC workbench online less than 0,5 µg total RNA were excluded from primer design program (Table 2) and a pair primer 249 Cilt/Volume 41 Yıl/Year 2016 Gene expression of FABP4 in gastric cancer of housekeeping gene; glyceraldehyde-3-phosphate temperatures in Table 2 for 30 sec and extension at dehydrogenase (GAPDH) was used for 72˚C for 30 sec, and final extension at 72˚C for 3 normalization10. PCR reaction and condition was min. performed by using MJ Research, AB Applied Expression alterations were discriminated using Biosystem thermal cycler (Eppendorf, Germany). 50 agarose gel electrophoresis (2%) in the presence of μL reaction mixture was prepared in PCR tubes ethidum bromid. The image of agarose gel was containing 1.5 μL cDNA template, 25 μL captured and quantitated mRNA expression level by OnePCRTM master mix (GeneDirex, Korea), 1 μL image J software program ((version 1.46r, forward primer, 1 μL reverse primer and 21.5 μL downloaded from http://imagej.nih.gov/ij)11 The ddH2O. The cycling conditions comprised of initial statistical analysis of mRNA expression was carried denaturation at 95˚C for 5 min, 35 cycles of out using Wilcoxon signed rank test. Significance denaturation at 95˚C for 30 sec, annealing was assumed for values p ≤ 0.05. Table 2. Primer sequences, PCR product size of FABP4 and GAPDH genes and optimal annealing temperature Primer Sequence Site PCR product Annealing (bp) temperature (˚C) FABP4 gene 5'- TGGCATGGCCAAACCTAACA -3' 173- 192 Forward 5'- CTTCGTCAAATTCCTGGCCC -3' 291- 272 119 54.1 Reverse GAPDH gene 5'-GGTCCACCACCCTGTTGCTGT-3' Random 456 59.4 Forward 5'-AGACCACAGTCGATGCCATCAC-3' region