13: 17-26, 2004 1 2,3 1 2 3 [email protected] +886-4-22851676 93 1 3 . 2004. 13: 17-26. 10 3-4 GR-12 GR-28 20 GR-12 GR-28 10 Verticillium Penicillium 4.0-6.8 3.0-4.5 m 20-32 (Internal transcribed spacer, ITS) 28S rDNA Gliocladium roseum Bainier Gliocladium roseum 28S DNA Pleurotus eryngii (Dc. : Fr.) Que l. (Pleurotaceae) (Pleurotus) (21) 1993 (3) (1) (5) Cladobotryum varium Nees: Fr. Pseudomonas tolassii Paine (10) (0.5 0.5 cm) 1% (v/v) P. tolassii Vertcillium fungicola var. fungicola Ware 20 (9) 2% (w/v) (water agar, WA) 24 Gliocladium GR-06 GR- Gliocladium virens Miller (7) 07 GR-12 GR-13 GR-16 GR-18 GR-23 GR-28 G. deliquescens Sopp (18) GR-31 GR-37 10 28 (potato dextrose agar, PDA Difco) 18 13 1 2004 14 10 ( 0.5 ) (1.3 106 (JSM-6330F, Field Emission Scanning spores/ml) Electron Microscope) GR-12 GR-28 PDA 14 PE-B011 GR-12 GR-28 (13) PDA 24 (104 spores/ml) 50 l 4 PDA 12 16 20 24 (2,4) 40 28 32 36 24 %(v/v) 65 % pH 6.5 900 ml 100 700 (121 15 1b/cm2) 4 PDA 24 35 GR-12 GR-28 PE-B011 ( 2% WA 14 0.7 PDA 8 12 16 20 24 28 32 36 ) 7 15.5 - 17.5 85 - 95% 1000 ppm 8-11 250 300 lux 8 10 12 (DNA) 10 PDA 28 14 250 28 PDA 14 GR-12 (potato dextrose broth, PDB, Difico) 500 GR-28 10 28 125 rpm 10 6 10 DNA DNeasy spores/ml (Taiwan SC-202 Plant mini kit (QIAGEN, Hilden, Germary) ) 13 ( 3-5 cm) 100 mg 2 ml 16 400 l AP1 4 l 100 mg/ml RNase A 65 10 130 l AP2 5 GR-12 GR-28 15 k rpm 5 DNA (malt extract peptone agar, MEA) (8) QIAshredder spin column 20 10 675 l AP3/E PDA 650 l DNeasy mini spin column 10 k rpm 1 28 8 14 DNA column 500 l AW column 100 l 65 50 AE 5 10 k rpm DNA WA 28 8 -20 10 ( 0.7 cm) WA 19 10 ITS 28S rDNA PCR 100 ng/ l 10 ng 1 l 1 l (ligase) pCRII- DNA PCR (template) PCR TOPO TA (Invitrogen, Co., Carlsbad, CA) 5 Collopy (6) 2001 l 5 (ligation) (internal transcribed spacer, ITS) (competent cell) ITS1 (5'- TCCGTAGGTGAACCTGCGG -3') 20 42 1 ALRO (5'- CATATGCTTAAGTTCAGCGGG -3') PCR 37 1 10 ng DNA 5 l 10x PCR buffer 4 100 l 50 l 100 mM IPTG 50 l 2% X-gal l 2.5 mM dNTP 25 pmol 0.5U ExTaq (50 ppm kanamycin) 37 polymerase (Takara Shuzo Co., Shiga, Japan) 16 50 l (GeneAmp PCR System 50 ppm kanamycin (LB) 2400, Perkin-Elmer, Co., Norwalk, CT) 35 PCR (GeneMark, Technology Co., Ltd., Taiwan) ITS 94 (denature) 1 ml 13 k rpm 1 2 94 15 57 (annealing) 30 200 l Solution I 72 (extension) 45 35 72 200 l Solution II 200 l Solution III 4 28S rDNA PCR DNA (15 k rpm) 5 (20) Vilgalys Hester 1990 miniprep spin column Gliocladium spp. 28S rDNA 13 k rpm 1 700 l washing solution LROR (5'- GTACCCGCTGAACTTAAGC-3') column 3 LR7 (5'- TACTACCACCAAGAT CT-3') 28S rDNA 60 5 50 l 94 2 94 1 1 13 k rpm DNA 3 l 50 1 72 2 35 DNA 2 l 10x buffer 1 U EcoRI 37 72 4 2 PCR ITS 28S rDNA DNA DNA PCR PCR 10 l 2 l (Mission-Biotech Co., Ltd., Taiwan) ABI PRISM 377-96 blue dye (0.01% xylene cyanol, 0.01% bromophenol blue, DNA (Perkin-Elmer, CA, USA) 50% glycerol) 1.2% (Seakem LE DNAstar (DNASTAR, USA) agarose, FMC) 0.5x TAE [20 mM Tris-acetate, 0.5 mM (NCBI) (GenBank) EDTA(pH8.0)] 100V blue dye 3/4 (ethidium bromide, EtBr, 0.5 g/ml) 10 UV (IS-2000, Alpha Innotech Co.) PCR PCR (QIAGEN, Hilden, Germary) 200 l PCR [Agaricus bisporus (Lange) Imbach] 1000 l PB buffer [Lentinus edodes (Berk.) Sing.] [Flammulina QIAquick spin column 13 k rpm (HITACHI, himac velutipes (Curt.: Fr.) Sing.] [Pleurotus sajor (Fr.) CF15DZ RT15A3) 1 2 ml Sing.] [Pleurotus cystidosus Miller] 750 l PE buffer QIAquick [Auricularia mesenterica (Dick. : Fr.) Pers.] spin column 13 k rpm 1 column [Hypsizigus marmoreus Bunashimeji] [Coprinus column 30 l 1 1 comatus (Mull.: Fr. ) Pers.] [Lepista nuda DNA -20 (transformation) (Bull. :Fr.) Cooke] [Griffola frondosa (Dicks. Fr.) S.F. Gray.] 2 ml GR-12 GR-28 (1.3 106 spores/ml) ITS 28S rDNA 16 20 13 1 2004 3 ( ) 2-3 ( ) 4.0-6.8 x 3.0-4.5 m (Verticillium- like) 110-170 m 2-6 12-20 m Penicillium 40-70 m 5-8 12-16 m 2.0-3.5 m Domsch (7) (16) (17) ( ) 10 Schroers Smalley Hansen 3-4 Gliocladium roseum Bainier. GR- GR-12 GR-28 MEA 12 GR-28 12 20 10 3.5-4.2 24 16 (1) (2) (3) (4) H D Fig. 1. Brown spot disease of king oyster mushroom Pleurotus eryngii, caused by Gliocladium roseum. Symptoms consisted of brown spots, curling of the tissues, and shrinking and cracking of fruit bodies. (1) healthy mushrooms, (2 3) diseased mushrooms, and (4) diseased mushrooms (D) with brownish discoloration. 21 GR-12 GR-28 (24 ) GR-12 GR-28 Fig. 3. Effect of temperature on conidial germination of (1) 10 (2) Gliocladium roseum isolates GR-12 and GR-28 on potato Gliocladium roseum Verticillium (Cp) ( dextrose agar plates for 24 hrs. ) (P) (3) G. roseum Bar = Standard error. (Cp) ( ) (4) G. roseum (Ca) 10 m Fig. 2. Morphologies of Gliocladium roseum including (1) colonies of G. roseum isolates GR-12 and GR28 grown on malt extract peptone agar for 10 days at 20 , (2) Verticillium-like conidiophores (Cp) (arrowhead), phiales (P) (arrowhead) and conidia (Ca) (arrowhead) under light microscope; (3) Penicillium-like conidiophores (Cp) (arrowhead) and (4) conidia (Ca) (arrowhead) under scanning electron microscope. Bar 10 m 20% 28 80% 36 20% 28 ( ) GR-12 GR-28 PE-B011 ( ) Fig. 4. Effect of temperature on mycelial growth of Gliocladium roseum isolates GR-12 GR-28 and Pleurotus GR-12 GR-28 PE- eryngii PE-B011 on potato dextrose agar plates for 7 days. B011 8-36 7 Bar = Standard error. 8 12 28 GR-12 GR-28 32 8 36 ( ) 16 ITS1 ALRO ( ) DNA 20 32 10 24-28 556 bp ( ) 10 PCR 22 13 1 2004 10 ITS1 ITS2 5.8S rDNA Fig. 5. Agarose gel electrophoresis showing amplification product of PCR in the ITS1 ITS2 regions and 5.8S rDNA of ten isolates of Gliocladium roseum, the causal agent of brown spot disease of king oyster mushroom Pleurotus eryngii. Lane M: 100 bp marker (GeneMark). PCR DNA pCRII-TOPO TA ( DNA ) 10 ITS ITS DNA 556 bp ( ) ITS DNAstar (NCBI) ITS 13 Gliocladium sp.(Acc. No. AF139858 AF048733 ) 98.2-99.6% Verticillium 50.6 - 55.10% (Acc. No. AF048740 AF048741 AF048742) Gliocladium LROR LR7 28S rDNA 10 DNA LROR LR7 PCR 10 1355 bp ( ) PCR ITS (internal transcribed spacer, ITS) NCBI GenBank Fig. 6. Nucleotide sequence of internal transcribed spacer regions (ITS1 ITS2 regions and 5.8S rDNA) of Gliocladium 28S rDNA G. roseum (Acc. No. U00736) roseum, the causal agent of brown spot of king oyster Nectria ochroleuca (Acc. No. U00746 U00751 U00752 mushroom Pleurotus eryngii. U00750) 97.3-98.6% ( ) G. roseum Bainer 23 10 28S rDNA Fig. 7. Agarose gel electrophoresis showing amplification product of PCR in the 28S rDNA of ten isolates of Gliocladium roseum, the causal agent of brown spot of king oyster mushroom Pleurotus eryngii. Lane M: 100 bp marker (GeneMark). GR-12 GR-28 12 16 ( ) Gliocladium Corda Hyphomyces Domsch (7) G. roseum Verticillium Penicillium Verticillium G. roseum Sphaerostilbella lutea (15) Verticillium G. roseum G. roseum GR-12 28S rDNA (Internal transcribed spacer, ITS) (NCBI) (GenBank) Fig. 8. Phylogenetic tree illustrating the pairwise genetic distance of the sequence of 28S rDNA of Gliocladium roseum isolate GR-12 compared with sequences deposited in the (16) (11) Mckay ITS GenBank database of National Center for Biotechnology Cladobotryum dendroides Rehner Information (NCBI). 24 13 1 2004 Gliocladium roseum Table 1. Pathogenicity tests of Gliocladium roseum obtained from diseased king oyster mushroom Pleurotus eryngii on fruiting bodies of various mushroom-producing fungi Symptom appearance Mushroom-producing Pathogenicity test2 (days after inoculation) fungus1 GR-12 GR-28 GR-12 GR-28 Agaricus bisporus 22 Auricularia polytrica -- Coprinus comatus 33 Flammulina velutipes 22 Grifola frondosa -- Hypsizigus marmoreus 22 Lentinus edodes 22 Lepista nuda -- Pleurotus cystidosus 22 Pleurotus eryngii 33 Pleurotus sajor 22 1. Each fungus was inoculated with 2 ml spore suspension (1.5 106 spores/ml) of Gliocladium roseum isolates GR-12 and GR-28 on its sporophores cultivated at 16 . 2. , with symptoms; , without symptom. Samuels (15) 1994 28S r DNA . 46: 51-59 Gliocladium spp. PCR 3. 1998. ITS 28S rDNA . p.44-46. NCBI GenBank ITS 4. 2000. NCBI GenBank 13 Gliocladium sp. (Acc. 49: No.AF139858 AF048733 AF358244 AF358243 56-64 AF358241 AF358234 AF358233 AF358231 5. 2000 Cladobotryium varium. c c c c c c c c c c c c c c c c c c c c c c c c c c c c c c c c cyAhc c cGc c dc c cyPdgyPdddAhc cyPdcGuyFceyAchc cxIc c ctdv c yPd@wccdddddHwhfc cddHwccxd@cddddAchc cducfdcfcyAhc FGuchgc ddHdrfcs9ec8chc cdgdcfcdrchc cddddddddddddddddAhc cFcRTuchfc dcecGcxIecUSchc cdgddfcdhec cdecde@c9chfc y8 cecdTuchec dcyAxIccdet@chc cdddddgddddhec cdetSeUcAuyAchc yPHRddddHwsRTuchc ddddddddAcdcfFhec cdgddfcdhec cdeUreddddddddAchc yPdhecsRddcgc dcgcddchfc cdddddedceddddhec cdctdcctdccdhgc cdHdddddddddddddchec ctdcecduccdccyAhc cddgdAucecdhec cd8dc8dccdeyAchc dcfdcfdchec cUddTcddddddddddAhc tddddddddddddddddddd@cgc cd@dcFddddddddIchc dcdTcdcPdcdchec tddcsGcdecdfdrhc U` @cgc cdrcdcedddddddddchc dccAd8edchec Udcecddddddddddchc dceddddddddddddeFhc cdedcedccdhgc dddddddddddddchec ctScdcecdecdfdchc cddhfc cdedcedccdecyAhc c Fcdcecdecdfdchc dddHwchfc tSedcedddddddddAhc cdddddddddddhfc Fedccddddddddddddddcgc dcfcyAhc Uredcedc c cdhcdhfc dcecdhdchc cddddddddddddddddddAhc dcfAda c cdhcdhfc dcecdhdchc dc c ctSccded@RdccdcGuchc cdddddddddddhfc dc c dcecdhdchc cUrctdedrfcdv9Tcgc cdhcdhfc dcecdhdchc dc c tSc8SeQafcdDcRAcgc cdhcdhfc dcecdfddddSchc cddddc c Fc8HeRdddddHchec cdddddddddddhfc dcecdgs@chc csdc c c cdwcgsdhfc c c c c c c c ( ) c 8: c c c c c c c AF132803 AF358228 AF358225 AJ309346 c c c c c c c c c c c c c c c c c c c c c AJ309334) 98.2-99.6% 28S rDNA 1-20.