The Journal of Immunology Methylation Status of CpG Islands Flanking a cAMP Response Element Motif on the Protein Phosphatase 2Ac␣ Promoter Determines CREB Binding and Activity1 Katsue Sunahori, Yuang-Taung Juang,2 and George C. Tsokos2 Protein phosphatase 2A (PP2A) is a major serine/threonine protein phosphatase in eukaryotic cells and is involved in many essential aspects of cell function. The catalytic subunit of the enzyme (PP2Ac), a part of the core enzyme, has two isoforms, ␣ (PP2Ac␣) and ␤ (PP2Ac␤), of which PP2Ac␣ is the major form expressed in vivo. Deregulation of PP2A expression has been linked to several diseases, but the mechanisms that control the expression of this enzyme are still unclear. We conducted experiments to decipher molecular mechanisms involved in the regulation of the PP2Ac␣ promoter in human primary T cells. After preparing serially truncated PP2Ac␣ promoter luciferase constructs, we found that the region stretching around 240 bases upstream from the translation initiation site was of functional significance and included a cAMP response element motif flanked by three GC boxes. Shift assays revealed that CREB/phosphorylated CREB and stable protein 1 could bind to the region. Furthermore, we demonstrated that methylation of deoxycytosine in the CpG islands limited binding of phos- phorylated CREB and the activity of the PP2Ac␣ promoter. In contrast, the binding of stable protein 1 to a GC box within the core promoter region was not affected by DNA methylation. Primary T cells treated with 5-azacitidine, a DNA meth- yltransferase inhibitor, showed increased expression of PP2Ac␣ mRNA. We propose that conditions associated with hy- pomethylation of CpG islands, such as drug-induced lupus, permit increased PP2Ac expression. The Journal of Immunol- ogy, 2009, 182: 1500–1508. rotein phosphatase 2A (PP2A)3 is a major serine/threonine mosome 5q23–q31 for ␣ and in 8p12–p11.2 for ␤. The promoters phosphatase with complex composition and is involved in of both genes are GC rich and lack the TATA and CCAAT se- P many essential aspects of cell function (1–3). The het- quences typical of many housekeeping genes. However, the 5Ј erodimeric PP2A core enzyme consists of a well-conserved 36- upstream regions as well as the regions encoding the 5Ј and 3Ј kDa catalytic subunit (C subunit; PP2Ac) and a 65-kDa scaffold untranslated sequences of each mRNA are quite different. The ac- subunit (A subunit) (4). To gain full activity toward specific sub- tivity of the PP2Ac␣ gene promoter is 7(Ϯ10)-fold stronger than strates, the PP2A core enzyme associates with a variable regula- that of the PP2Ac␤ gene promoter, which may explain why mRNA tory subunit (B subunit) to form a heterotrimeric holoenzyme level of PP2Ac␣ is ϳ10 times higher than that of PP2Ac␤ (6). The (1–3). expression of PP2Ac is tightly controlled through autoregulation to Molecular cloning has revealed the existence of two mammalian ensure the presence of relatively constant levels of PP2A (7), but PP2Ac isoforms, ␣ (PP2Ac␣) and ␤ (PP2Ac␤), which share 97% many essential aspects of PP2Ac regulation remain poorly identity in their primary sequence (5). Both isoforms are ubiqui- understood. tously expressed and these genes are composed of seven exons and Abnormal expression of PP2A has been linked to many diseases six introns encoded by different genes, localized in human chro- such as cancer (8, 9), Alzheimer disease (10), and Opitz BBB/G syndrome (11). We have reported that the message, protein, and Division of Rheumatology in Department of Medicine, Beth Israel Deaconess Med- enzymatic activity of PP2Ac are increased in the peripheral T cells ical Center, Harvard Medical School, Boston, MA 02115 from the patients with systemic lupus erythematosus (SLE) com- Received for publication October 24, 2008. Accepted for publication November 20, pared with normal T cells (12). Phosphorylated CREB (pCREB), 2008. which is an important transcription factor in the regulation of the The costs of publication of this article were defrayed in part by the payment of page expression of IL-2 (13), is known to be one of the substrates of the charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. PP2Ac (14), and decreased production of IL-2 by SLE T cells is considered to be of pathogenic importance (15–20). Treatment of 1 This work was supported by Public Health Service National Institutes of Health Grant RO1 AI068787. SLE T cells with PP2Ac-small interfering RNA decreases the pro- 2 Address correspondence and reprint requests to Dr. George C. Tsokos or Dr. Yuang- tein levels and activity of PP2Ac in a specific manner and in- Taung Juang, Department of Medicine, Division of Rheumatology, Beth Israel Dea- creases the levels of pCREB and its binding to the IL-2 and c-fos coness Medical Center, Harvard Medical School, 330 Brookline Avenue, E/CLS 937, Boston, MA 02115. E-mail addresses: [email protected] or yjuang@bidmc. promoters, as well as increases AP-1 activity, causing normaliza- harvard.edu tion of IL-2 production. 3 Abbreviations used in this paper: PP2A, protein phosphatase 2A; PP2Ac, PP2A SLE is an autoimmune disease that affects multiple organs in- catalytic subunit; PP2Ac␣, PP2Ac ␣ isoform; PP2Ac␤, PP2Ac ␤ isoform; SLE, sys- cluding the joints, skin, kidneys, and brain. Several signaling ab- temic lupus erythematosus; pCREB, phosphorylated CREB; DNMT, DNA methyl- transferase; dC, deoxycytosine; CRE, cAMP response element; 5-azaC, 5-azacitidine; normalities of the immune system have been described in SLE and Sp1, stable protein 1; M. SssI, CpG methyltransferase; SAM, S-adenosyl methionine; are thought to be central in the pathophysiology of this disease. At CREM, cAMP response element modulator; ChIP, chromatin immunoprecipitation the cellular level, T lymphocytes orchestrate the altered immune assays; dmC, deoxymethylcytosine; Mt, mutant. responses in SLE (21, 22). One of the well-known abnormalities of Copyright © 2009 by The American Association of Immunologists, Inc. 0022-1767/09/$2.00 T cell signal transduction in SLE is the defective signaling via www.jimmunol.org The Journal of Immunology 1501 Table I. Sequence of oligonucleotides used in EMSA and mutant constructsa 2 Ϫ280 GC box GC box CRE GC box 2 Ϫ218 Sequence of core promoter 5Ј-TTTTCCCCTCCGCTCCCCGCCGCCTCCTGACGCCGGGCGTGAC GTCACCAC GCCC GGCGGCCGCC-3Ј EMSA probe Wild-type probe 1 (unmethylated, Ϫ250 to Ϫ226) CGCCGGGCGTGAC GTCACCAC GCCC Mutant probe 1 CGCCGGGCGTGCG TACACCAC GCCC Methylated probe 1 CGCCGGGCGTGACMeGTCACCAC GCCC Wild-type probe 2 (unmethylated, Ϫ240 to Ϫ216) GAC GTCACCAC GCCC GGCGGCCGCC Mutant probe 2 GAC GTCAATGT GCCC GGCGGCCGCC Mutant probe 3 GAC GTCACCAC ATGT GGCGGCCGCC Mutant probe 4 GAC GTCACCAC GCCC ATCTGCCGCC Methylated probe 2 GAC GTCACCACMeGCCCMeGGCGGCCGCC Mutant construct sequence ⌬-468-MtCREB ϳTTTTCCCCTCCGCTCCCCGCCGCCTCCTGACGCCGGGCGTGCG TACACCAC GCCC GGCGGCCGCCϳ ⌬-468-MtSp1 ϳTTTTCCCCTCCGCTCCCCGCCGCCTCCTGACGCCGGGCGTGAC GTCAATGT GCCC GGCGGCCGCCϳ a Three GC boxes and a CRE motif in PP2Ac␣ core promoter region (nt Ϫ280 to Ϫ218) are noted by underlining. Boldface characters indicate mutated bases. 5-methyl- cytosine is indicated as CMe. ERK-1 and ERK-2 (23), which contribute to the DNA hypomethy- CCGGGCGTGCGTACACCACGCCCGG-3Ј,R,5Ј-CCGGGCGTGGTG lation by the decreased expression of DNA methyltransferase TACGCACGCCCGGCGTCAGGAGG-3Ј; ⌬-468-MtSp1, F, 5Ј-GGGCGTG Ј Ј (DNMT-1) (21–26). Because methylation of deoxycytosine (dC) ACGTCAATGTGCCCGGCGGCC-3 ,R,5-GGCCGCCGGGCACATTG ACGTCACGCCC-3Ј (mutated bases are underlined). Plasmids were in regulatory sequences can suppress transcription of the associ- sequenced to detect any errors introduced by PCR. ated genes, abnormal hypomethylation may result in the overex- Twenty micrograms of ⌬-468 construct or empty vector was methylated pression of certain genes such as lymphocyte function-associated using 16 U of CpG methyltransferase (M. SssI) and S-adenosyl methionine Ag 1 (LFA-1; CD11a) and CD70 in SLE T cells (27, 28). (SAM; New England Biolabs) at 37°C for 16 h, with subsequent inacti- vation of enzyme at 65°C for 20 min. Mock-methylation reactions were Because PP2Ac mRNA was found to be increased in T cells also performed in the absence of M. SssI and SAM. The methylated or from patients with SLE and its stability was not compromised (12), mock-methylated constructs were purified using QIAquick PCR purifica- we have initiated studies to define the transcriptional control of the tion kit (Qiagen), and the methylation status of each construct was deter- PP2Ac gene. We report herein that the PP2Ac␣ promoter defines mined by methylation-senstive restriction enzyme Aat⌱⌱ (New England ⌬ ⌱ a cAMP response element (CRE) site flanked by CpG motifs and Biolabs) for -468 construct or Sal (New England Biolabs) for empty vector. that methylation controls the binding of pCREB and the activity of the promoter. Cell transfection Materials and Methods The transfection of plasmids into human primary T cells was done using an Cells and reagents Amaxa nucleoporator according to the manufacturer’s instructions. In Primary T cells were purified from peripheral venous blood obtained from some experiments, a plasmid encoding CREB (Clontech), Sp1 (Invivo- healthy volunteers. The blood was incubated for 30 min with a rosette T Gen), or corresponding empty vector (pCMV or pORF9) were cotrans- fected into primary T cells with PP2Ac␣-PGL3 basic construct. Then, 0.25 cell purification kit (StemCell Technologies) that contained a tetrameric Ab ␮ mixture against CD14, CD16, CD19, CD56, and glyA that attaches non-T g of pRL-TK (Promega) was cotransfected as an internal control for transfection efficiency in all cases. The total amount of plasmid used in cells to erythrocytes. Ficoll containing Lymphoprep gradient (Greiner Bio- ␮ One) was subsequently used to separate these complexes from T cells. each sample was up to 5 g. ϫ 6 Using flow cytometry, we established that the purified cells were Ͼ98% Following transfection, 3 10 T cells were cultured in 12-well plates positive for CD3.