DNA Replication & Cell Cycle [email protected] medpathwaymcat Med-pathway The Cell Cycle G0 M G1 G2 (START) S Growth Factors Cyclin Dependent Kinases Phosphorylation of Targets D B Cdk Cdk M G1 G2 S E Cdk Cyclin Dependent Kinases Cyclin E Cdk 1 Cyclin D Concentration of Cyclin of Concentration G1 S G2 Mitosis MITOSIS 1 2 4 3 Centrosome 5 6 ORIGINS OF REPLICATION DnaA ORIGIN oriC DnaA DnaA 5’ 3’ 3’ 5’ The Replicator Hypothesis The Hayflick Limit Finite Replicative Capacity of Cells Senescence GROWTH TIME Cellular Transformation Crisis (Transformation) Senescence GROWTH TIME TELOMERES The End Replication Problem 5’ GGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTA3’ 3’ CCCAAT CCCAAT CCCAAT 5’ TELOMERES The End Replication Problem 5’ GGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTA 3’ CCCAAT CCCAAT CCCAAT 5’ AAUCCCAAU 3’ 5’ Telomerase Cellular Transformation Crisis (Transformation) Reactivation of Telomerase Senescence GROWTH TIME Meselson Stahl Experiment 1. Grow Cells in 15N media 2. Transfer to 14N media and Monitor cell divisions Time Semi Conservative Replication 14N 15N 15N/14N DNA Replication Fork Kornberg’s Purification of DNA Polymerase Semi-conservative DNA Replication DNA Polymerization DNA Chain Terminators Sanger DNA Sequencing 1. 2. Dideoxy H Nested X H DNA Structure & Mutation 3’ 5’ 5’ to 3’ 5’ G C 5’ to 3’ 3’ T A T G DNA Mismatch DNA Structure & Mutation: Tautomers (LACTAM) (LACTIM) 1.0 % Tautomers & Mutations DNA Replication & DNA breaks Primer “NICK” Fixing The DNA Breaks (S/G2) DSB Repair HR (S/G2) 5′ 3′ 5′ 3′ 3′ 5′ 3′ 5′ 5’ to 3’ exonuclease 5′ 3′ 5′ 3′ 3′ 5′ 3′ 5′ HO D loop formation HO Branch migration, Resolution Fixing The Break In G1 NHEJ D Cdk p53 is a tumor suppressor Fixing The DNA Breaks DSB Repair NHEJ (G1) HR (S/G2) 5′ 3′ 5′ 3′ 3′ 5′ 3′ 5′ 5’ to 3’ exonuclease 5′ 3′ 5′ 3′ 3′ 5′ 3′ 5′ HO + D loop formation Rad51 BRCA HO Branch migration, Resolution Translocations Drive Oncogenesis Burkitt Lymphoma BCR-ABL 9 Philadelphia 22 Chromosome + + BCR BCR-ABL (Tyrosine Kinase) ABL Chronic Myeloid Leukemia (CML) .
Details
-
File Typepdf
-
Upload Time-
-
Content LanguagesEnglish
-
Upload UserAnonymous/Not logged-in
-
File Pages26 Page
-
File Size-