Proc. Natl. Acad. Sci. USA Vol. 95, pp. 12462–12467, October 1998 Genetics DsrA RNA regulates translation of RpoS message by an anti-antisense mechanism, independent of its action as an antisilencer of transcription NADIM MAJDALANI†,CHRISTOFER CUNNING‡,DARREN SLEDJESKI§,TOM ELLIOTT‡, AND SUSAN GOTTESMAN†¶ †Laboratory of Molecular Biology, National Cancer Institute, National Institutes of Health, Bethesda, MD 20892; §Department of Microbiology and Immunology, Medical College of Ohio, Toledo, OH 43614; and ‡Department of Microbiology and Immunology, West Virginia University Health Sciences Center, Morgantown, WV 26506 Contributed by Susan Gottesman, August 19, 1998 ABSTRACT DsrA RNA regulates both transcription, by MATERIALS AND METHODS overcoming transcriptional silencing by the nucleoid- Bacterial Strains. Unless otherwise noted, strains were associated H-NS protein, and translation, by promoting effi- 1 D cient translation of the stress s factor, RpoS. These two derivatives of either NM22180 (dsrA ) or NM22181 ( dsrA). activities of DsrA can be separated by mutation: the first of These isogenic strains, derived by P1 transduction from three stem-loops of the 85 nucleotide RNA is necessary for SG20250 (3), carry deletions of the lac operon and of the ara RpoS translation but not for anti-H-NS action, while the region, introduced from LMG194 (4). The dsrA deletion was introduced by P1 transduction from strain DDS719, selecting second stem-loop is essential for antisilencing and less critical R for RpoS translation. The third stem-loop, which behaves as for the linked Tet marker and screened by PCR as described a transcription terminator, can be substituted by the trp previously (2). The various rpoS-lac fusions were constructed transcription terminator without loss of either DsrA function. as described elsewhere and were transduced into the NM22180 The sequence of the first stem-loop of DsrA is complementary and NM22181 E. coli hosts in the trp operon, selecting for the with the upstream leader portion of rpoS messenger RNA, kanamycin resistance marker upstream from the fusion (5, 6). suggesting that pairing of DsrA with the rpoS message might Mutagenesis of the rpoS-lac fusions was done as described be important for translational regulation. Mutations in the in refs. 5 and 6, starting with plasmid pTE591. The wild-type Rpos leader and compensating mutations in DsrA confirm rpoS sequence between nucleotides 195 and 218 is CAAGG- that this predicted pairing is necessary for DsrA stimulation GATCACGGGTAGGAGCCAC. The mutagenic primers of RpoS translation. We propose that DsrA pairing stimulates used for constructing G208C and G208U are CAAGGGAT- RpoS translation by acting as an anti-antisense RNA, freeing CACGGCTAGGAGCCAC and CAAGGGATCACGGT- the translation initiation region from the cis-acting antisense TAGGAGCCAC, respectively. In the region of 108–133 of the RNA and allowing increased translation. rpoS gene, the sequence is TCGTTACAAGGGGAAATC- CGTAAACC. The mutagenic primers used to construct U124G and U124C are TCGTTACAAGGGGAAAGCCG- The small regulatory RNA, DsrA, has two rather different TAAACC and TCGTTACAAGGGGAAACCCGTAAACC, activities in Escherichia coli, one affecting transcription and the respectively. other affecting translation. The transcription activity, antisi- 9 lencing, is seen when DsrA is overproduced; DsrA overcomes The NcoI substitution was made using a PCR product H-NS-mediated transcriptional silencing of genes, including (Stratagene Pfu pol) of the ribosome-binding site region from rcsA, a positive regulator of capsule synthesis (1). In addition, pTE591, and cutting the product with EagI. This fragment was DsrA stimulates the translation of the stationary phase s cloned into pTE591, first cut with NcoI and filled in, and then factor, RpoS (2). Although both pathways of DsrA action are cut with EagI. dependent on Hfq (also called HF-1), an RNA-binding protein Plasmid Constructions and DNA Manipulations. For the originally identified as necessary for the replication of phage expression of dsrA and its mutant derivatives, the base plasmid Qb (D. Sledjeski, manuscript in preparation), the activities used was pNM12. This plasmid is a derivative of pBAD24 (4) that was mutagenized by the Kunkel method (7, 8) to introduce otherwise appear to be independent. The effect of DsrA on 2 2 1 antisilencing does not require RpoS (unpublished observa- an MscI site at the 7to 2 region upstream of the 1 tions) and the translational stimulation of RpoS occurs in the transcription start site. The PCR was used to generate a absence of H-NS (2). We have investigated the basis for these promoter-less dsrA DNA fragment with an MscI site upstream two activities of DsrA by mutational dissection of dsrA. and an EcoRI site downstream. This PCR product was then The dsrA gene product is an 85-nt RNA that is predicted to cloned into the same sites on pNM12, thus placing dsrA under form a structure with three stem-loops (S-Ls; Fig. 1) (1). In this the control of the arabinose promoter (Para), to create plasmid work, we show that DsrA regulation of transcription and pNM13. pNM14 and pNM15 were also created by the Kunkel translation require different regions in this small molecule. method in another vector and moved by PCR as for pNM13. Transcriptional regulation or anti-H-NS activity is indepen- Other mutant derivatives of dsrA were cloned in a similar dent of the first S-L (S-L1), while translational regulation is fashion. Plasmids pNM22, 29, and 30 were constructed by absolutely dependent on S-L1. Localization of translational introducing the mutagenic sequence into the forward primer regulation within S-L1 led to an anti-antisense model for for PCR; plasmid pNM32 had the mutagenic sequence in- translational regulation, which is supported by the behavior of cluded in the reverse primer. Introducing the XhoI site be- compensatory mutations within the RpoS leader and DsrA. tween stems 2 and 3 was also done by PCR but using pNM13 The publication costs of this article were defrayed in part by page charge Abbreviation: S-L, stem-loop. Data deposition: The sequence reported in this paper has been payment. This article must therefore be hereby marked ‘‘advertisement’’ in deposited in the GenBank database (accession no. AF090431). accordance with 18 U.S.C. §1734 solely to indicate this fact. ¶To whom reprint requests should be addressed at: Laboratory of © 1998 by The National Academy of Sciences 0027-8424y98y9512462-6$2.00y0 Molecular Biology, Building 37, Room 2E18, National Cancer Insti- PNAS is available online at www.pnas.org. tute, Bethesda, MD 20892-4255. e-mail: [email protected]. 12462 Downloaded by guest on September 29, 2021 Genetics: Majdalani et al. Proc. Natl. Acad. Sci. USA 95 (1998) 12463 washed for 2–3 min in 23 SSC buffer (GIBCO/BRL) and prehybridized in Hybrisol I (Oncor) for 3–4 h at 42°C in a hybridization chamber (Techne, Cambridge, UK). A noniso- topic probe (100 ng/ml) biotinylated at the 59 end (Bioserve Biotechnologies, Laurel, MD) was dissolved in 10 ml Hybrisol/ 100 cm2 of membrane. The mix was boiled for 10 min, allowed to cool to 42°C, and used to replace the prehybridization solution. Hybridization was carried out overnight at 42°C. The blots were then washed and developed using Ambion’s Bright- Star Biodetect nonisotopic kit (Ambion, Austin, TX) accord- ing to the manufacturer’s specifications. The blots were ex- posed either on Kodak X-Omat or BioMax MR film. In vitro transcription in a T7 MaxiScript kit (Ambion) of a PCR product containing dsrA was used to generate a DsrA-sized marker for the gels. FIG. 1. Predicted structure of DsrA RNA. Mutations used in this RNA Half-Life Determination. To determine the half-life of work are indicated. The D1 mutation deletes the S-L above the line and dsrA and dsrB message, DDS 92 cells were grown at 32°C to similarly for the D2 mutation. The NcoI mutant substitutes the mid-log phase in LB medium, and rifampicin (50 mg/ml final) underlined sequence for the bracketed sequence within DsrA and was added to stop transcription. Samples were taken at ap- similarly for the XhoI mutant. The NcoI* mutant (made by cutting, end propriate intervals, and RNA was isolated and detected as filling, and religating the NcoI mutant DNA) had a sequence at the novel joint with a partial duplication of the site: UGUCCAUGCAUG- described previously (1). Five micrograms of RNA was loaded GAA. The DNcoI-XhoI deletion derivative has the sequence UGGU- per lane. GUCCAUGUCGAGUCC at the novel joint (underlined sequence from NcoI site, bold from XhoI site). RESULTS (wild-type dsrA) and pNM33 (NcoI) to generate pNM35 Regulated Expression of dsrA. To allow regulated expression (XhoI) and pNM39 (NcoI-XhoI), respectively. Plasmid pNM40 of DsrA RNA, we constructed pNM13, a plasmid expressing (NcoI*) was derived from pNM33 by cutting with NcoI, end D DsrA under the control of the pBAD promoter. DsrA function filling, and religating the blunt ends. pNM42 ( NcoI-XhoI) was was assayed in strains carrying either of two reporter fusions. derived from pNM39 by cutting with both NcoI and XhoI, end RpoS translation was measured using a rpoS-lacZ translational filling, and religating. The QuickChange (Stratagene) mu- fusion; anti-H-NS silencing was measured using a cps-lacZ tagenesis kit was used to generate pNM33 according to the transcriptional fusion. Expression of the cps-lacZ fusion is manufacturer’s specifications. The structure of dsrA was con- dependent on RcsA; transcription of rcsA is in turn negatively firmed by sequencing for all plasmids. regulated by H-NS (1). We previously observed that the Other methods for DNA manipulations used were as de- scribed in Maniatis et al. (9) and Ausubel et al. (10). Sequenc- rpoS-lacZ fusion responded to single-copy levels of DsrA, ing was done on an Applied Biosystems 310 Genetic Analyzer while the cps-lacZ fusion required higher levels to be signifi- (PE/Applied Biosystems) using a dye terminator or a dRho- cantly stimulated.