Mouse CSNK1D Gene cDNA clone plasmid Catalog Number: MG51028-G General Information Plasmid Resuspension protocol Gene : casein kinase 1, delta 1.Centrifuge at 5,000×g for 5 min. Official Symbol : CSNK1D 2.Carefully open the tube and add 100 l of sterile water to dissolve the DNA. Synonym : AA409348, 1200006A05Rik, 3.Close the tube and incubate for 10 minutes at room temperature. D930010H05Rik, Csnk1d 4.Briefly vortex the tube and then do a quick spin to concentrate the liquid at the bottom. Speed is less than 5000×g. Source : Mouse 5.Store the plasmid at -20 ℃. cDNA Size: 1248bp The plasmid is ready for: • Restriction enzyme digestion RefSeq : NM_139059.2 • PCR amplification • E. coli transformation Plasmid: pGEM-mCSNK1D • DNA sequencing Description E.coli strains for transformation (recommended Lot : Please refer to the label on the tube but not limited) Sequence Description : Most commercially available competent cells are appropriate for the plasmid, e.g. TOP10, DH5α and TOP10F´. Identical with the Gene Bank Ref. ID sequence. Vector : pGEM-T Shipping carrier : Each tube contains approximately 10 μg of lyophilized plasmid. Storage : The lyophilized plasmid can be stored at ambient temperature for three months. Quality control : The plasmid is confirmed by full-length sequencing with primers in the sequencing primer list. Sequencing primer list : M13-47 ： 5’ GCCAGGGTTTTCCCAGTCACGAC 3’ RV-M ： 5’ GAGCGGATAACAATTTCACACAGG 3’ Other M13 primers can also be used as sequencing primers. Manufactured By Sino Biological Inc., FOR RESEARCH USE ONLY. NOT FOR USE IN HUMANS. Fax :+86-10-51029969 Tel:+86- 400-890-9989 http://www.sinobiological.com Mouse CSNK1D Gene cDNA clone plasmid Catalog Number: MG51028-G Vector Information The pGEM-T vector is a high-efficiency TA cloning vector which contains multiple cloning sites as shown below. The pGEM-T vector is 3.0kb in size and contains the amplicin resistance gene for selection. The coding sequence was inserted by TA cloning. Physical Map of pGEM-T : Manufactured By Sino Biological Inc., FOR RESEARCH USE ONLY. NOT FOR USE IN HUMANS. Fax :+86-10-51029969 Tel:+86- 400-890-9989 http://www.sinobiological.com.