Protein Kinase D Interaction with TLR5 Is Required for Inflammatory Signaling in Response to Bacterial Flagellin This information is current as Sabine M. Ivison, Nicholas R. Graham, Cecily Q. Bernales, of September 28, 2021. Arnawaz Kifayet, Natalie Ng, Leila A. Shobab and Theodore S. Steiner J Immunol 2007; 178:5735-5743; ; doi: 10.4049/jimmunol.178.9.5735 http://www.jimmunol.org/content/178/9/5735 Downloaded from References This article cites 39 articles, 19 of which you can access for free at: http://www.jimmunol.org/content/178/9/5735.full#ref-list-1 http://www.jimmunol.org/ Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication by guest on September 28, 2021 *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2007 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology Protein Kinase D Interaction with TLR5 Is Required for Inflammatory Signaling in Response to Bacterial Flagellin1 Sabine M. Ivison, Nicholas R. Graham, Cecily Q. Bernales, Arnawaz Kifayet, Natalie Ng, Leila A. Shobab, and Theodore S. Steiner2 Protein kinase D (PKD), also called protein kinase C (PKC)␮, is a serine-threonine kinase that is involved in diverse areas of cellular function such as lymphocyte signaling, oxidative stress, and protein secretion. After identifying a putative PKD phos- phorylation site in the Toll/IL-1R domain of TLR5, we explored the role of this kinase in the interaction between human TLR5 and enteroaggregative Escherichia coli flagellin in human epithelial cell lines. We report several lines of evidence that implicate PKD in TLR5 signaling. First, PKD phosphorylated the TLR5-derived target peptide in vitro, and phosphorylation of the putative target serine 805 in HEK 293T cell-derived TLR5 was identified by mass spectrometry. Furthermore, mutation of serine 805 to alanine abrogated responses of transfected HEK 293T cells to flagellin. Second, TLR5 interacted with PKD in coimmunoprecipi- Downloaded from tation experiments, and this association was rapidly enhanced by flagellin treatment. Third, pharmacologic inhibition of PKC or PKD with Go¨6976 resulted in reduced expression and secretion of IL-8 and prevented the flagellin-induced activation of p38 MAPK, but treatment with the PKC inhibitor Go¨6983 had no significant effects on these phenotypes. Finally, involvement of PKD in the p38-mediated IL-8 response to flagellin was confirmed by small hairpin RNA-mediated gene silencing. Together, these results suggest that phosphorylation of TLR5 by PKD may be one of the proximal elements in the cellular response to flagellin, and that this event contributes to p38 MAPK activation and production of inflammatory cytokines in epithelial cells. The Journal http://www.jimmunol.org/ of Immunology, 2007, 178: 5735–5743. ince the discovery that TLR4 initiates an inflammatory naling adaptors such as MyD88 or TIR domain-containing adap- response after recognition of bacterial LPS (1), the interest tor-inducing IFN-␤. In the MyD88-dependent pathway common to S in these pattern recognition receptors and their signaling most TLRs, receptor ligation results in phosphorylation and acti- pathways has been intense. In homodimeric or heterodimeric form, vation of IL-1R-associated kinase family members, allowing the TLRs respond to peptidoglycans, lipoproteins, LPS, dsRNA, un- recruitment of the adaptor TNFR-associated factor 6, which acti- methylated CpG-DNA, and bacterial flagellin. Ligation of these vates the TGF-␤-activated kinase 1. The latter then activates the by guest on September 28, 2021 innate immune receptors, which are poised on surface or organellar transcription factors NF-␬B (via I-␬B degradation) and AP-1 (via membranes of many cell types, including epithelial cells, macro- p38 MAPK and JNK), leading to cytokine and chemokine expres- phages and dendritic cells, initiates signaling cascades that trigger sion (reviewed in Ref. 2). secretion of inflammatory cytokines and chemokines as well as TLR5, which recognizes bacterial flagellin, is thought to trans- expression of costimulatory signals for adaptive immunity. duce signals via the MyD88-dependent pathway only (3, 4). Ac- TLRs are characterized by N-terminal leucine-rich repeats, a tivation of IL-1R-associated kinase (5), nuclear translocation of central transmembrane domain, and a cytosolic C-terminal Toll/ NF-␬B (6, 7), and activation of MEK (8), p38 MAPK, and ERK 3 IL-1R (TIR) domain, which links the receptor to proximal sig- (6) have all been demonstrated after flagellin treatment in many cell types, including professional APCs and epithelial cells. These pathways lead to the secretion of ␤-defensin (9), cytokines IL-6 Division of Infectious Diseases, University of British Columbia, Vancouver, British ␣ ␣ Columbia, Canada and TNF- (10), and/or chemokines MIP3 and IL-8 (3, 4), which Received for publication March 20, 2006. Accepted for publication February recruit and activate dendritic cells and neutrophils, respectively. 21, 2007. However, the characteristic features of TLR5 signaling that confer The costs of publication of this article were defrayed in part by the payment of page specific responses to flagellin as opposed to other TLR agonists charges. This article must therefore be hereby marked advertisement in accordance have yet to be identified. with 18 U.S.C. Section 1734 solely to indicate this fact. Using an in silico analysis to identify potential protein interac- 1 This work was supported by Grant 992840.01 from Burroughs-Wellcome Career Award in Biomedical Sciences, Operating Grant 64355 from the Canadian Institutes tion sites in the TIR domain of TLR5, we identified a putative for Health Research, by the Canada Foundation for Innovation New Opportunities protein kinase D (PKD) phosphorylation site (see Fig. 1A). PKD is Fund 4453, by New Investigator Awards from the Canadian Institutes for Health a serine-threonine kinase of the calmodulin-calcium-dependent ki- Research, and by the Vancouver Coastal Health Research Institute “In It for Life” Fund (to T.S.S.). nase family, and contains diacylglycerol-binding and pleckstrin 2 Address correspondence and reprint requests to Dr. Theodore S. Steiner, Division of homology domains within its regulatory N-terminal region. The Infectious Diseases, University of British Columbia, Room D452, Heather Pavilion three known PKD subtypes PKD1 (also called protein kinase East, 2733 Heather Street, Vancouver V5Z 3J5, British Columbia, Canada. E-mail ␮ ␯ address: [email protected] C (PKC) ), PKD2, and PKD3 (PKC ) are involved in diverse aspects of cellular function including membrane trafficking, dif- 3 Abbreviations used in this paper: TIR, Toll/IL-1R; PKD, protein kinase D; PKC, protein kinase C; FliC, flagellin; PDB, phorbol 12,13-dibutyrate; shRNA, small hair- ferentiation, proliferation, and apoptosis as well as the responses to pin RNA; siRNA, small interfering RNA; HEK, human embryonic kidney; HA, hem- BCR and TCR ligation, regulatory peptides, and oxidative stress agglutinin; shRNA, small hairpin RNA; Ct, cycle threshold. (see reviews Refs. 11, 12). Using the interaction between the en- Copyright © 2007 by The American Association of Immunologists, Inc. 0022-1767/07/$2.00 teroaggregative Escherichia coli H18 flagellin (FliC) and human www.jimmunol.org 5736 PKD IN TLR5 SIGNALING ␮ TLR5 in epithelial cell lines as a model, we report that PKD in- at a final concentration of 0.5–1 g/ml, while Pam3CysSK4 (EMC Micro- teracts with TLR5, and that this kinase is required for transducing collections) was used at 10 ␮g/ml. Cells were pretreated with inhibitors or flagellin-stimulated inflammatory responses. DMSO vehicle for 1 h, followed by stimulation for varied amounts of time, depending on cell type and readout. For detection of PKD, cells were lysed in 50 mM Tris-HCl (pH 7.4), 1% Materials and Methods Triton X-100, 150 mM NaCl, 5 mM EDTA (pH 7.4), and Protease Inhib- Abs and vectors itor Cocktail for mammalian cells (Sigma-Aldrich). For detection of phos- phorylated proteins, cells were lysed in 20 mM Tris (pH 7.5), 150 mM The following Abs were used: anti-PK (Serotec), anti-PKD1, anti- NaCl, 1 mM EDTA, 1 mM EGTA, 1% Nonidet P-40, 2.5 mM sodium phospho-PKD1 (S916), anti-phospho-p38 MAPK (T180/Y182), anti- ␤ pyrophosphate, 1 mM -glycerophosphate, 2 mM Na3VO4, and Protease total p38 (Cell Signaling Technology), and anti-GAPDH (Fitzgerald Inhibitor Cocktail. Equal amounts of proteins were separated by SDS- Industries International). PAGE and blotted for Western blot analysis. TLR5 cloned into pEF6-V5His-Topo (Invitrogen Life Technologies) For analysis of secreted IL-8, in the case of Caco-2 cells, culture me- was a gift from A. Aderem (Institute for Systems Biology, Seattle, WA). dium was removed after3hofstimulus. For HEK 293T cells, longer time pEGFP was from BD Clontech. Hemagglutinin (HA)-PKD1 and points (6 or 24 h) were used due to the slower kinetics of IL-8 production. pSPKD1-1 were provided by A. Toker (Harvard University, Boston, MA). The IL-8 contents of supernatants were determined by ELISA (OptEIA; The IL-8pLuc reporter vector (13) was provided by B. Salh (University of BD Biosciences). British Columbia, Vancouver, British Columbia, Canada). The TLR5 S805A mutant was produced by the quick-change circular In vitro kinase assays mutagenesis method (Stratagene), using the following primers: 5Ј-gtac cagttgatgaaacatcaagcccatcagaggctttgtacag and 5Ј-ctgtacaaagcctctgatgg The synthetic peptides purchased from GenScript and dissolved at 3 mM in cttgatgtttcatcaactggtac.