Manuscript for in VITRO Cellular & Developmental Biology PLANT

Manuscript for in VITRO Cellular & Developmental Biology PLANT

Supplementary Figure 1. HPLC chromatograms of the authentic standards (A) and the methanol extracts from the dried latex of P. somniferum WT plant (B) and the representative transformants (C to F). 0.20 32.913 29.861 27.001 27.893 33.899 36.868 20.854 – – – – – – – 0.15 11.972 – Thebaine 0.10 Coptisine Palmatine Berberine Papaverine - 24.958 AU Morphine - 7.308 Columbamine Oripavine Sanguinarine Isothebaine - 18.134 [AU] Jateorrhizine Reticuline - 14.262 0.05 Noscapine - 26.093 Methylcodeine - 15.384 Magnoflorine - 13.756 Codeine - 9.847 0.00 0.00 2.00 4.00 6.00 8.00 10.00 12.00 14.00 16.00 18.00 20.00 22.00 24.00 26.00 28.00 30.00 32.00 34.00 36.00 38.00 40.00 [min][min]分 (A) Standards 0.08 0.06 0.04 AU [AU] 0.02 Noscapine - 26.016 Morphine - 7.294 Papaverine - 25.093 Codeine - 9.843 0.00 0.00 2.00 4.00 6.00 8.00 10.00 12.00 14.00 16.00 18.00 20.00 22.00 24.00 26.00 28.00 30.00 32.00 34.00 36.00 38.00 40.00 [min]分 (B) WT1 0.14 0.12 20.732 – 0.10 0.08 Thebaine AU [AU] 0.06 0.04 0.02 Papaverine - 25.051 Noscapine - 25.992 Codeine - 9.821 Morphine - 7.246 0.00 0.00 2.00 4.00 6.00 8.00 10.00 12.00 14.00 16.00 18.00 20.00 22.00 24.00 26.00 28.00 30.00 32.00 34.00 36.00 38.00 40.00 分 [min] (C) T1 #1-27(HT) 0.14 0.12 20.744 – 0.10 0.08 Thebaine AU [AU] 0.06 0.04 0.02 Noscapine - 26.009 Papaverine - 25.063 Morphine - 7.264 Codeine - 9.836 0.00 0.00 2.00 4.00 6.00 8.00 10.00 12.00 14.00 16.00 18.00 20.00 22.00 24.00 26.00 28.00 30.00 32.00 34.00 36.00 38.00 40.00 分 [min] (D) T1 #2-17(HT) 0.20 0.15 AU 0.10 [AU] Morphine - 7.295 0.05 Noscapine - 25.976 Papaverine - 25.076 Codeine - 9.854 Thebaine - 20.898 0.00 0.00 2.00 4.00 6.00 8.00 10.00 12.00 14.00 16.00 18.00 20.00 22.00 24.00 26.00 28.00 30.00 32.00 34.00 36.00 38.00 40.00 [min]分 (E) T1 #2-1(LT) 0.050 0.040 0.030 AU [AU] 0.020 Noscapine - 26.055 0.010 Morphine - 7.178 Papaverine - 25.112 Thebaine - 20.907 Codeine - 9.822 0.000 0.00 2.00 4.00 6.00 8.00 10.00 12.00 14.00 16.00 18.00 20.00 22.00 24.00 26.00 28.00 30.00 32.00 34.00 36.00 38.00 40.00 [min]分 (F) T1 #2-6(LT) Supplementary Table 1. Summary of the used PCR methods, DNA libraries, primer sets, and obtained amplified DNA fragments in the analyses of T-DNA insertion loci. PCR Primer Set Description of Amplified Region Library * Method 1st PCR 2nd PCR Product(s) LB HaeIII 490S 401A 510S 368A Tandem 1, 2, 5, 6; riorf13-1, 2 LB KpnI 75S 58A 80S 52A Tandem 2 LB KpnI 490S 401A 510S 368A LB1; Tandem 1 Inverse RB BamHI 14738S 12909A 14765S 12878A RB4 PCR RB EcoRV 14738S 14408A 14765S 14307A RB1, 2, 3; Tandem 1 RB EcoRV 14997S 14981A 15011S 14960A riorf13-3 RB KpnI 14997S 14981A 15011S 14960A Tandem 1 Supplementary Table 1. Cont. PCR Primer Set Description of Amplified Region Library * Method 1st PCR 2nd PCR Product(s) RB PvuII 14738S 12909A 14765S 12878A RB4 Inverse RB SspI 14738S 14408A 14765S 14307A RB4; Tandem 1, 4 PCR RB StuI 14738S 14408A 14765S 14307A RB4; Tandem 5 LB EcoRV AP1 401A AP2 368A Tandem 2; riorf13-1, 2 LB HaeIII AP1 401A AP2 368A LB2, 3, 4; Tandem 5 LB PvuII AP1 401A AP2 368A LB2; Tandem 1, 2; riorf13-1, 2 Adaptor- LB SspI AP1 237A AP2 226A LB2; Tandem 1, 2, 5; riorf13-1, 2 ligation LB StuI AP1 401A AP2 368A Tandem 4, 6; riorf13-1 PCR RB EcoRV 14738S AP1 14765S AP2 RB1, 2, 3; Tandem 1; riorf13-3 RB HaeIII 14963S AP1 14997S AP2 RB5, 6; Tandem 6; riorf13-4 RB PvuII 14738S AP1 14765S AP2 RB3, 4; riorf13-4 Genome RB, LB un cut 14738S 401A 14765S 368A Tandem 1 direct RB, LB un cut 14738S 401A ** Tandem 1, 3, 4 PCR * Restriction enzymes used for library construction are shown; ** 1st PCR only, anneal 62 °C . Supplementary Table 2. List of the sequences (from 5' to 3') of the primers and the oligo-DNAs used for IPCR, AL-PCR, and genome direct PCR. Left Border Primers Sense Primers Anti-Sense Primers 75S ATT ACC AGA TGG TGT CCG GG 52A TCG CTT CAA AGC TCT TGT AC 80S CAG ATG GTG TCC GGG TAT G 58A CGA AAA TCG CTT CAA AGC TC 490S GAG CAA CGA CGT TTC AGT GC 226A TTG TTG CAC GGC GAC GAT TGG 510S ATT CCT GTA CTC GCT TTC CG 237A AGG CTC ACG TAT TGT TGC ACG 368A AAC TCG TAC GGC ATA GTC GG 401A TCA ACT TGT GGC GAG TCT CC Right Border Primers Sense Primers Anti-Sense Primers 14738S TAA CCT CGC ACG TAT GGT GC 12878A CAT GCT CAT GCT TTA GCA GG 14765S GAC GTC GAT TTC GAT GTG G 12909A TGC CTT CCA ATT GAC GCT C 14963S AGC CGA CAA CGT GCA ATT TGC 14307A CAA TTT TCT TGA CCG AAG CC 14997S GAG CCA CCT GCC TTC AGA CC 14408A AGG TGC CAC AGT CCG ACT G 15011S CAG ACC TAC TGT TTG CTG CG 14960A ATA ATT TAG AGC ATT GCG GG 14981A AAA TTG CAC GTT GTC GGC TG Adaptor Oligo DNAs AP-LS CGTTGAGAGGCATTATCTTCGGGCTAAGGCGTCGTCGCGACGTCACGC AP-SS * (PO4)-GCGTGACGTC-(NH2) Adaptor Specific Primers AP1 CGT TGA GAG GCA TTA TCT TCG G AP2 TTA TCT TCG GGC TAA GGC G * AP-SS: 5'-end phosphorylated, 3'-end amino-linked. Supplementary Table 3. List of the primers used for the analysis of inheritance manner of T-DNA integration loci by PCR. Target Region Primer Name Orientation Sequence (from 5' to 3') Left border genomic region primers LB1g LB1gex-S1 sense TAA TCA CGA TGT ACC CGT AGC LB2g LB2g-1072S sense CGT CGT TGT ATG ATG AAT CGC LB3g HaeLB3g-S1 sense CAA CAG TTC GCA GGC AAG TC LB4g HaeLB4g-S1 sense TGA CTA ATC CTG ACT CCA ACC Right border genomic region priers RB1g RB1g-460A anti-sense AGA ACC TTC GTA TGG CAG ATG RB2g RB2g-393A anti-sense CAA TCC TGC CTC CTA CAA TTC RB3g RB3g-588A anti-sense GGT CCA TTG ATA TGG CTA CTC RB4g RB4g-261A anti-sense TCG AAT CGA CGT AAA CTC TCC RB5g HaeRB5g-A1 anti-sense CCT GCA ACA ACT AAC AAC GAG RB6g HaeRB6g-A1 anti-sense GGG TGG TAT TGT AAC TTC ACT C T-DNA border primers T-DNA RB MAFF-226A anti-sense TTG TTG CAC GGC GAC GAT TGG T-DNA LB MAFF-14963S sense AGC CGA CAA CGT GCA ATT TGC Supplementary Table 4. List of the primers used for the estimation of T-DNA copy number by real-time PCR. Target Region Primer Name Orientation Sequence (from 5' to 3') LB1-genome DNA LBm-S sense GCAGTAGTATCACTGACAAATCGCAC (LB1g) LBm-A anti-sense CCAGTAACACCCTGGGAATCC LB1-junction LBjm-S sense GGGGTAAACTCATCCAAACACAC (LB1j) LBjm-A anti-sense AAAACGTGCTCGAAAATCGC orf2m-S sense TCCGATGGAGCATTTCTATGG orf2 orf2m-A anti-sense ATGATCTACACGCGGAAGAAGC Supplementary Table 5. List of the primers used for the RT-PCR analysis of selected morphine biosynthetic genes. Target Gene Accession No. Primer Name Orientation Sequence (from 5' to 3') PsCYP80B3-878S sense CAATAGAATGGGCGTTGTCTG CYP80B3 AF134590 PsCYP80B3-1377A anti-sense ATGATCAGTTGGCTAGGATCC Ps4'OMT-552S sense AGATTGTAGAGATACTTTTCAAGG 4'OMT1 AY217333 Ps4'OMT-1021A anti-sense TGATCTTATGAGACCGAAAGC PsSalAT-832S sense TCTCTAATATGGAAGTCCGTG SalAT AF339913 PsSalAT-1389A anti-sense GAACTTAGCCATATCATCCTC PsCor1-467S sense TTGGCTTCACTAGGGCAATCG Cor1-1 AF108432 PsCor1-958A anti-sense CTCATCCCAGAACTCTTCTTC PsCor2-463S sense ATGCTTGGATTAACCAAGTCG Cor2-1 AF108438 PsCor2-887A anti-sense AAGGATCACCGGTTGACACTC T6ODM-S2 sense CTCTACAAGTACAAGCAGCC T6ODM GQ500139 T6ODM-RTa anti-sense TCTGACATGCAATCACGTCG CODM-RTs sense GACTTATTTGAAGATGGGTTG CODM GQ500141 CODM-A2 anti-sense CTTCAAAATATCCTCATACCTACC PsACT1-145S sense CACACTGTGCCAATCTATGAG PsACT1 AB574417 PsACT1-488A anti-sense TGGATACCAGCAGCTTCCATC .

View Full Text

Details

  • File Type
    pdf
  • Upload Time
    -
  • Content Languages
    English
  • Upload User
    Anonymous/Not logged-in
  • File Pages
    4 Page
  • File Size
    -

Download

Channel Download Status
Express Download Enable

Copyright

We respect the copyrights and intellectual property rights of all users. All uploaded documents are either original works of the uploader or authorized works of the rightful owners.

  • Not to be reproduced or distributed without explicit permission.
  • Not used for commercial purposes outside of approved use cases.
  • Not used to infringe on the rights of the original creators.
  • If you believe any content infringes your copyright, please contact us immediately.

Support

For help with questions, suggestions, or problems, please contact us