[CANCER RESEARCH 63, 214–221, January 1, 2003] Acetylcholine Is Synthesized by and Acts as an Autocrine Growth Factor for Small Cell Lung Carcinoma1 Pingfang Song, Harmanjatinder S. Sekhon, Yibing Jia, Jennifer A. Keller, Jan Krzysztof Blusztajn, Gregory P. Mark, and Eliot R. Spindel2 Departments of Pathology [H. S. S.] and Behavioral Neuroscience [G. P. M.], Oregon Health and Science University, Portland, Oregon 97239; Department of Pathology and Laboratory Medicine, Boston University School of Medicine, Boston, Massachusetts 02118 [J. K. B.]; and Division of Neuroscience, Oregon National Primate Research Center, Beaverton, Oregon 97006 [H. S. S., P. S., Y. J., J. A. K., E. R. S.] ABSTRACT need for further understanding of the biology of SCLC and develop- ment of new therapeutic approaches for SCLC treatment. It is well established that small cell lung carcinomas (SCLCs) express The neuroendocrine nature of SCLC is well established, as is the receptors for acetylcholine (ACh) and that stimulation of these receptors concept of growth regulation of SCLC by autocrine growth factors by nicotine or other cholinergic agonists stimulates cell growth via acti- vation of nicotinic cholinergic receptors (nAChRs) and/or muscarinic such as gastrin-releasing peptide (4, 5). SCLC and some non-SCLCs cholinergic receptors (mAChRs). The aim of this study was to determine secrete a variety of neuropeptides, and many of these act as growth whether SCLC cells synthesize and secrete ACh and respond to endoge- factors (6, 7). The concept of autocrine growth factors has been nous ACh to create a functioning cholinergic autocrine loop. Reverse extended to the secretion of ligands for tyrosine- and threonine- transcription-PCR was used to screen a panel of SCLC cell lines for kinase-linked receptors such as basic fibroblast growth factor (bFGF, components of cholinergic signaling. Choline acetyltransferase (ChAT) FGF-2; Refs. 8), epidermal growth factor (EGF; Ref. 9) and trans- and the vesicular ACh transporter (VAChT), as well as ␣3, ␣5, ␣7, ␤2, forming growth factor ␤-1 (10). Therapeutic approaches derived from ␤ and 4, nAChR subunits and M3 and M5 mAChRs, were found to be this have included monoclonal antibodies against the epidermal present in most of the SCLC cell lines tested. Real-time PCR showed that growth factor receptors (11), broad spectrum neuropeptide antagonists mRNA levels for ChAT, VAChT, and ␣7 and ␤2 nAChR subunits varied significantly among different SCLC cell lines tested. The H82 cell line was (12), and inhibitors of tyrosine kinases and phosphatases (13). Thus, found to express the highest levels of ChAT, and that cell line was chosen autocrine growth factors can regulate SCLC growth and are potential for additional studies of ACh release and cell proliferation. ACh was easily therapeutic targets. detectable in H82 cell culture media, and levels of ACh were increased by Multiple reports have established that SCLC cells express nAChRs the acetylcholinesterase inhibitor neostigmine. Vesamicol, an inhibitor of and mAChRs (14–17) and that the activation of nAChR and/or VAChT, and hemicholinium-3, an inhibitor of choline transport, both mAChR with nicotine (18–20), ACh (19), and muscarine (19, 20) reduced H82 cell ACh basal release in a dose-dependent manner. In stimulates the growth of SCLC cells. Recent reports that a variety of parallel with the reductions of ACh release, vesamicol and hemicho- cell types in normal lung synthesize ACh (21–23) have led us to linium-3 also decreased H82 cell proliferation. H82 cell proliferation was hypothesize that lung cancers, similarly, may make ACh and that, also inhibited by the muscarinic and nicotinic antagonists atropine and mecamylamine, respectively, in dose- and time-dependent manners. Fi- therefore, SCLC growth may be regulated by a cholinergic autocrine nally, archival cases of SCLC were screened by immunohistochemistry for loop. expression of ChAT. Thirteen of 26 tumors screened were positive for In cholinergic neurons, the neurotransmitter ACh is synthesized ChAT. These findings demonstrate that SCLC can synthesize, secrete, and from choline and acetyl-CoA by ChAT (24) and is then translocated degrade ACh and that released ACh stimulates SCLC cell growth. Iden- into synaptic vesicles by the VAChT (25). In neurons, choline for tification of this new autocrine loop provides a potential new target for synthesis of ACh is transported by a specific high-affinity choline therapeutic intervention. transporter: CHT1 (26, 27). If SCLCs synthesize ACh, then ChAT must be present and the other components of neuronal cholinergic signaling may be present. If a cholinergic autocrine loop is present in INTRODUCTION SCLC, then interruption of ACh synthesis and signaling should mod- Global lung cancer deaths were over 1,000,000 for the year 2000 ify growth of SCLC. In this article, we show that SCLC tumors and and are projected to increase to 2,000,000 per annum by 2020–2030 cell lines express ChAT and that SCLC cell lines synthesize VAChT, (1). SCLC3 accounts for 20–25% of all new cases of primary lung CHT1, nAChR, and mAChR and synthesize ACh and that interruption cancer. In addition to morphological characteristics, SCLC is distin- of cholinergic signaling affects cell growth. guished from non-SCLC by its rapid tumor doubling time, high growth fraction, and early development of widespread metastasis (2). Overall, survival beyond 5 years occurs in only 3–8% of all patients MATERIALS AND METHODS with SCLC because relapse occurs within 2 years despite initial responses to chemotherapy and radiotherapy (3). Thus, there is clear Cell Culture and SCLC Tissue Samples. SCLC cell lines NCI H69, H82, H209, H345, H378, H417, H510, H592 were generously provided by Phelps et al. and Carney et al. (28, 29). H82 cells were grown in RPMI 1640 (Invitrogen, Received 6/27/02; accepted 10/31/02. Carlsbad, CA) supplemented with 5 ␮g/ml insulin, 5 ␮g/ml transferrin, 5 ng/ml The costs of publication of this article were defrayed in part by the payment of page ␮ charges. This article must therefore be hereby marked advertisement in accordance with sodium selenite, 100 units/ml penicillin, and 100 g/ml streptomycin. These 18 U.S.C. Section 1734 solely to indicate this fact. lines encompass both classic, neuroendocrine-differentiated SCLC cell lines 1 Supported by NIH Grants RR00163, CA69533, HD/HL37131, AG09525, DA11203, (H69, H209, H345, H378, H510, H592) and variant SCLC cell lines that lack and NS42793. neuroendocrine differentiation (H82, H417; Ref. 29). In addition, these lines 2 To whom requests for reprints should be addressed, at Division of Neuroscience, Oregon National Primate Research Center, Beaverton, OR 97006. Phone: (503) 690-5512; have previously been reported to express nicotinic and/or muscarinic receptors Fax: (503) 690-5384; E-mail: [email protected]. (17, 18, 30). Paraffin-embedded bronchoscopic biopsies of SCLC were ob- 3 The abbreviations used are: SCLC, small cell lung carcinoma; ACh, acetylcholine; tained from the Department of Pathology of the Oregon Health and Science ChAT, choline acetyltransferase; VAChT, vesicular ACh transporter; nAChR, nicotinic University. Five-␮m sections were cut, and 1 section was stained with H&E to ACh receptor; mAChR, muscarinic ACh receptor; RT, reverse transcription; HPLC, high-performance liquid chromatography; LEMS, Lambert-Eaton myasthenic syndrome; confirm the diagnosis; then other sections were processed for immunohisto- AEC, 3-amino-9-ethylcarbazole; MTS, methyltetrazolium. chemistry as described below. 214 Downloaded from cancerres.aacrjournals.org on October 4, 2021. © 2003 American Association for Cancer Research. ACH IS AN AUTOCRINE GROWTH FACTOR FOR SCLC Immunohistochemistry and Immunocytochemistry. Paraffin sections of GAAGTT, and TaqMan probe: TCATCTGCACCATCGGCATCCTGA; ␤2 SCLC were processed for immunohistochemistry as described previously (31). nAChR: 5Ј, GGTCCACGAACGGAACTTCA, 3Ј, CTGCCGCCTGCCATC- Antibodies used were mouse anti-ChAT (mAB 305; Chemicon International, TAC, and TaqMan probe GCACTTCCCATTTGACCAGCAGAACTG. 18S Inc.; 1:400), rabbit anti-VAChT (H-V005; Phoenix Pharmaceuticals), and rat RNA amplifications were conducted with the Pre-Developed TaqMan Assay anti-␣7 nAChR (mAB 319; 1:250; Ref. 32). Immunohistochemistry for SCLC Reagent (Applied Biosystems). All real-time PCR reactions were run in was performed using Vector ABC reagents and VIP as a chromogen (Vector triplicate. Laboratories, Burlingame, CA) for ChAT and AEC for ChAT. VIP is a Sequence Analysis of ChAT. Two ␮g of total RNA prepared from H82 proprietary peroxidase substrate from Vector Laboratories that yields a purple cells was reverse transcribed as described above. Primers were used to amplify color. Intensity of immunohistochemical staining was scored from 0 to 4ϩ by cDNAs spanning exons 5 to 11 and 11 to 18 to span the entire ChAT coding two independent readers (E.R.S. and H.S.S.) (where 0 ϭ no staining; region (24). Amplified cDNA bands were gel isolated and subcloned into 1ϩϭfocal weak staining; 2ϩϭfocal strong staining or diffuse weak pGEM-T (Promega Corp., Madison, WI) and sequenced. The 5Ј and 3Ј primers staining; 3ϩϭdiffuse medium staining; and 4ϩϭdiffuse strong staining). used to amplify from exon 5 to exon 11 of ChAT were TCCACACCTCTG- Fluorescent immunohistochemistry on H82 cells was performed using Texas- CATCCCTG and GACTTGTCGTACCAGCGATT; the 5Ј and 3Ј primers red conjugated second antibody. used to amplify from exon 11 to exon 18 of ChAT were ACCGGGACTCGCT- RT-PCR. RT-PCR and Southern hybridization were used to investigate the GGACATG and GGAGGTGAAACCTAGTGGCA. expression of nAChR, mAChR, ChAT, VAChT, and CHT1 genes in SCLC cell ACh Assay. For investigation of ACh release from H82 cells, 5 ϫ 106 cells lines. For nAChR, ␣3, ␣5, ␣7, ␤2, and ␤4 subunits were examined. For in 10 ml were plated in 60-cm2 culture dishes. After plating, the acetylcho- mAChR, M3 and M5 subtypes were examined. RNA was isolated from SCLC linesterase inhibitor neostigmine was added at a concentration of 5 ϫ 10-5 M cell lines with Tri Reagent (Molecular Research Center, Cincinnati, OH). (Sigma, St.