~™ llll III II II II I Ml III II II I II (19) J European Patent Office Office europeen des brevets (11) EP 0 738 779 A2 (12) EUROPEAN PATENT APPLICATION (43) Date of publication:ation: (51) |nt. CI.6: C12N 15/10, C12Q 1/68 23.10.1996 Bulletin 1996/43 (21) Application number: 96250006.2 (22) Date of filing: 27.09.1991 (84) Designated Contracting States: • Fernandez, Joseph M. DE FR GB NL Carlsbad, CA 92008 (US) • Mead, David A. (30) Priority: 27.09.1990 US 589817 Madison, Wisconsin 5371 1 (US) • Smith, Lloyd (62) Application number of the earlier application in Madison, Wisconsin 53704 (US) accordance with Art. 76 EPC: 91919634.5 (74) Representative: UEXKULL & STOLBERG (71) Applicants: Patentanwalte • INVITROGEN CORPORATION Beselerstrasse 4 San Diego, CA 921 21 (US) 22607 Hamburg (DE) • CHIMERx (subdivision of Molecular Biology Resources. Inc.) Remarks: Madison, Wl 53704 (US) This application was filed on 15 - 01 - 1996 as a divisional application to the application mentioned (72) Inventors: under INID code 62. • Hernstadt, Corinna San Diego, CA 92130 (US) (54) Direct cloning of PCR amplified nucleic acids (57) Methods are described for producing recom- binant DNA molecules from suitable host vector and ^ nucleic acids subjected to 3'-terminal transferase activ- PROMOTER SStc-= £8 g» Se &n> .Xu ,Ha PROMOTER ity. In one embodiment, the method takes advantage of the single 3'-deoxy-adenosine monophosphate (dAMP) residues attached to the 3' termini of PCR generated nucleic acids. Vectors are prepared with recognition sequences that afford single 3'-terminal deoxy-thymi- dine monophosphate (dTMP) residues upon reaction with a suitable restriction enzyme. Thus, PCR gener- ated copies of genes can be directly cloned into the vec- RESTRICT WITH EcoRI * tors without need for preparing primers having suitable REMOVE CENTRAL FRAGMENTHlndlll; restriction sites therein. The invention also contem- LIGATE plates associated plasmid vectors and kits for imple- Xcm I OLIGONUCLEOTIDES menting the methods. Hfndlll Kail LEFT BlmHI SamHI XctnlRIGKT Eco RI T7 — ► AARrTTfiflrrArfiAATCAAATGGATCCCAAGCTGCTGCAGGATCCAGAAGATGCATGfiAATTC^ — T3 PROMOTER TTCGAACCGGTGCTTAGTTTACCTAGGGTTCGACGACGTCCTCGGTCTTCTACGTACCTTAAG PROMOTER CM < r»- co F/6. IA CO o Q_ LU Printed by Rank Xerox (UK) Business Services 2.13.8/3.4 (Cont. next page) EP 0 738 779 A2 Hind III Xcm I LEFT Xcm I RIGHT Eco Rl(a> 10 20 30 40 50 60 GAA AGC TTGG GCGCC ACG AAT CAA AT6 GAT CCC AAG CTG CTG CAG GAT CCA GAA GAT GCA TGG AAT TCG CTT TCG AAC CGG TGC TTA GTT TAC CTA GGG TTC GAC GAC GTC CTA GGT CTT CTA CGT ACC TTA AGC (b)| GAA AGC TTG GCC ACG AAT T GCA TGG AAT TCG CTT TCG AAC CGG TGC TT TA CGT ACC TTA AGC (c) GAA AGC TTG GCC ACG AA T | \\\\\\\\\\\\\\\\\\\\\\ A | T GCA TGG AAT TCG CTT TCG AAC CGG TGC TT|fr \\\\\\\\\\\\\\\\\\\\\\ | T A CGT ACC TTA AGC FIG. IB 2 EP 0 738 779 A2 Description The present invention relates to the cloning of nucleic acids. More particularly, the invention relates to a simplified method for directly cloning polymerase generated nucleic acids into vectors. 5 BACKGROUND OF THE INVENTION In the short time that practical PCR techniques for amplifying nucleic acid material have been available, many appli- cations have been advanced. For example, PCR has found numerous research applications, such as in the determina- 10 tion of genetic mutations, in engineering template-modified sequences using mismatched primer sequences, and in producing sufficient genetic material for direct sequencing. PCR has also been applied to many medical and legal prob- lems where it has been used in such areas as diagnosis of monogenic diseases, analysis of biological evidence, etc. Further applications of PCR amplification are discussed in a number of references. See, e.g., PCR Technology. H. A. Erlich, ed., Stockman Press, 1989. Doubtless, many more applications will be forthcoming. 15 In PCR, specific nucleic acid target sequences are transcribed by a chain reaction in which a primer molecule com- plementary to a particular section of a nucleic acid template is used to form an extension product of the primer. Each primer extension product specifically anneals with a complementary primer molecule and the resulting primed template acts as a substrate for a further extension reaction. These steps are repeated many times, preferably using an auto- mated cycling procedure, thereby exponentially amplifying the initial nucleic acid material. PCR is particularly useful in 20 detecting nucleic acid sequences that are initially present in only very small amounts. Procedures for conducting PCR have been extensively described. See, for example, U.S. Patent Nos. 4,683,195 and 4,683,202, both to Mullis et al., which descriptions are incorporated herein by reference. Modernly, PCR is performed by automated cycling of denaturation, oligonucleotide primer annealing to a genetic template, and primer extension using a thermostable DNA polymerase, e.g., the Taq enzyme isolated from the bacte- 25 rium Thermus Aquaticus. See, e.g., U.S. Patent 4,889,818 issued to Gelfand et al., which description is incorporated herein by reference. While PCR alone may be satisfactory for certain applications, e.g., direct sequencing, often it is desirable to obtain a clone of PCR amplified products for further analysis, modification, or synthesis of probes. For example, a number of mRNA species exhibit polymorphic transcripts. Alternative splicing of the mRNA species to give multiple transcripts can 30 be unambiguously sequenced after molecular cloning of the PCR amplification products (Frohman et al., Proc. Natl. Acad. Sci. USA 85:8998-9002 (1988)). Cloning of PCR generated samples to construct cDNA libraries may also be desired. Generally, a protocol entailing cloning of PCR products can be expected to generate a smaller set of products than PCR alone, thereby reducing the background associated with direct sequencing of PCR products. The most common method for cloning PCR products involves incorporation of flanking restriction sites onto the 35 ends of primer molecules. The PCR cycling is carried out and the amplified DNA is then purified, restricted with an appropriate endonuclease(s) and ligated to a compatible vector preparation. Thus, typical PCR cloning methods require preparation of PCR primer molecules attached to "add on" base sequences having a preferred restriction recognition sequence. Also, these methods can result in unintended internal restriction of uncharacterized or polymorphic sequences. Such limitations of previous methods add to the cost and complexity of cloning PCR products routinely. 40 Recently, it was reported that Taq polymerase catalyzes the non-templated addition of single deoxyadenosine monophosphate (dAMP) residues to the 3' termini of blunt-ended DNA duplexes (Clark, J.M., Nucl. Acids Res. 20:9677- 9686 (1 9899)). Thus, Taq polymerase (and other thermostable polymerases) naturally creates restriction-like termini on DNA fragments. However, since these overhanging residues are widely viewed as incompatible with most molecular cloning schemes, the residues are routinely removed with nucleases to create blunt ends, such as S1 , Klenow, and T4. 45 In view of the above considerations, a method is desired for directly cloning PCR products containing terminal 3'- dAMP residues into appropriate plasmids. Such method would eliminate the need for preparing primers having restric- tion recognition sequences and it would eliminate the need for a restriction step to prepare the PCR product for cloning. Additionally, such method would preferably allow cloning PCR products directly without an intervening purification step. 50 BRIEF SUMMARY OF THE INVENTION The present invention is for a method of producing recombinant DNA nucleic acid molecules that include a DNA segment having terminal 3'-dAMP residues. Such DNA segments are generated by thermophilic polymerases during PCR amplification. Thus, in one embodiment of the invention, the method involves subjecting a target DNA segment to 55 PCR amplification so that a plurality of double-stranded nucleic acids including the segment are formed with each dou- ble-stranded nucleic acid having a single overhanging 3'-deoxyadenosine monophosphate (dAMP) residue. The dou- ble-stranded nucleic acids are admixed with a heterologous source of linear double-stranded DNA molecules, such as linearized plasmids, which are provided with a single overhanging deoxythymidylate (dTMP) residue at the 3' termini of 3 EP 0 738 779 A2 the DNA molecules. The reaction mixture is maintained under predetermined ligation conditions to effect ligation of the 3'-dAMP-containing nucleic acids with the 3'-dTMP-containing DNA molecules to give the recombinant molecules. In a preferred embodiment of the invention, the target DNA segment will be a gene. In further preferred embodi- ments of the invention, a suitable host cell line will be transformed with the gene and the gene will be maintained under 5 predetermined reaction conditions which allow expression of the gene. The present invention affords plasmids that comprise a first nucleotide sequence recognized by a restriction enzyme and a second nucleotide sequence recognized by a second restriction enzyme. Each recognition sequence is capable of generating a single terminal 3'-dTMP group upon reaction with the restriction enzymes. In a further preferred embodiment of the invention the restriction enzymes will be identical and either Xcm I or Hphl. In further preferred 10 embodiment, the DNA fragment that is removable upon restriction is synthesized as an oligonucleotide with additional restriction sites flanking the first set of restriction sites so that the oligonucleotide may be inserted readily into a suitable substrate. Kits suitable for directly cloning PCR amplification products having 3'-dAMP residues into the instant plasmids are afforded by the present invention. The kits will include plasmids having at least two nucleotide sequences recognized 15 by a restriction enzyme capable of generating single 3'-dTMP termini at each sequence. The kits will also include a restriction enzyme capable of cleaving the plasmids at each nucleotide sequence.