Copyright 2004 by the Genetics Society of America DOI: 10.1534/genetics.103.026229 Transposition of Reversed Ac Element Ends Generates Chromosome Rearrangements in Maize Jianbo Zhang and Thomas Peterson1 Department of Genetics, Development and Cell Biology and Department of Agronomy, Iowa State University, Ames, Iowa 50011 Manuscript received December 31, 2003 Accepted for publication May 3, 2004 ABSTRACT In classical “cut-and-paste” transposition, transposons are excised from donor sites and inserted at new locations. We have identified an alternative pathway in which transposition involves the 5Ј end of an intact Ac element and the 3Ј end of a nearby terminally deleted fAc (fractured Ac). The Ac and fAc elements are inserted at the maize p1 locus on chromosome 1s in the same orientation; the adjacent ends of the separate elements are thus in reversed orientation with respect to each other and are separated by a distance of kb. Transposition involving the two ends in reversed orientation generates inversions, deletions, and 13ف a novel type of local rearrangement. The rearrangement breakpoints are bounded by the characteristic footprint or target site duplications typical of Ac transposition reactions. These results demonstrate a new intramolecular transposition mechanism by which transposons can greatly impact genome evolution. ONVENTIONALLY, a transposable element is of chromosomal rearrangements and thereby play an C considered to be a linear DNA segment that can important role in genome evolution. move from one molecular location to another. Transpo- In Drosophila, activity of P transposable elements is sition of type II (DNA) elements is thought to occur via associated with recombination in males; this has been two general mechanisms: in replicative transposition, attributed to UT events involving a pair of P-element the transposon is copied into a new site without excision termini on sister chromatids or homologous chromo- from the donor site; whereas, in the “cut-and-paste” somes. The presence of an intact mobile P element in mechanism, the transposon is excised from the donor one homologous chromosome results in a male recom- this is caused by sister ;%1–0.5ف site and inserted at the target site (Craig 2002). The bination frequency of molecular mechanism of cut-and-paste transposition has chromatid transposition (SCT), i.e., by transposition re- been elucidated for certain prokaryotic transposons actions involving P-element 5Ј and 3Ј ends on different such as Tn5, Tn7, and Tn10 (Craig 2002; Haniford sister chromatids (Preston et al. 1996). However, the 2002; Reznikoff 2002), but is largely unknown for eu- presence of a 5Ј- and 3Ј-terminally deleted P element karyotic transposable elements (TEs). However, it is on each copy of homologous chromosomes results in a this effect is ;%30ف commonly thought that transposition is initiated by male recombination frequency of binding of the element-encoded transposase to the ter- caused by interchromosome transposition events (Gray Ј Ј minal sequences at the 5 and 3 ends of the transposon, et al. 1996). followed by endonucleolytic cleavage at the junctions In maize, the Ac/Ds transposable element system com- between the transposon and the flanking genomic DNA. prises the autonomous element Activator and the non- The excised transposon ends can then be inserted at a autonomous element Dissociation. The Ac/Ds system was new site in the genome. From a biochemical point of first recognized by virtue of its ability to cause chromo- Ј Ј view, the pair of 5 and 3 transposon termini are sub- some breakage (McClintock 1947). The Ds elements strates of the transposase protein. Eukaryotic genomes that produce a high frequency of chromosome breakage commonly contain many copies of each type of transpo- are termed state I, while nonbreaking Ds elements are son, and thus the terminal sequences are often present termed state II. The best-studied state I Ds element is Ј Ј in multiple copies. Theoretically, a pair of 5 and 3 known as double Ds; it contains two copies of a simple termini from different transposon copies could partici- (state II) Ds element, with one Ds element inserted into pate in a transposition reaction. This type of unconven- the other Ds element in opposite orientation (Doring tional transposition (UT) event could generate a variety et al. 1984). Two adjacent (state II) Ds elements in oppo- site orientation can also cause chromosome breakage in the presence of Ac (Weil and Wessler 1993), as can 1Corresponding author: Department of Genetics, Development and a pair of 5Ј and 3Ј Ds termini in direct orientation Cell Biology and Department of Agronomy, 2208 Molecular Biology Bldg., Iowa State University, Ames, IA 50011-3260. (English et al. 1993). PCR and sequencing analysis E-mail: [email protected] showed that chromosome breakage is caused by SCT Genetics 167: 1929–1937 ( August 2004) 1930 J. Zhang and T. Peterson events involving a pair of 5Ј and 3Ј ends of Ds elements TABLE 1 on sister chromatids (Weil and Wessler 1993; English Oligonucleotide primers et al. 1995). In addition, Dooner and Belachew (1991) showed that closely linked Ac/Ds elements can also in- Primer Sequence duce chromosome breakage. To further characterize the molecular substrates of p1-1 TGTTCCTTCTGCCCTGAGTCCTG Ac-2 ATTTTACCGACCGTTACCGACC UT reactions, we studied various Ac/Ds insertion alleles Ac-3 TTATCCCGTTCGTTTTCGTTACC of the maize p1 gene. The p1 gene encodes a Myb- Ac-4 CCCGTTTCCGTTCCGTTTTCGT homologous transcription factor that regulates the syn- Ac-5 TACGATAACGGTCGGTACGGG thesis of red flavonoid pigments in various floral organs p1-6 GACAGTTCGCAGTTGGGTTGGG including kernel pericarp and cob (Grotewold et al. p1-7 TCCGTCCTCAAAACCAAAGCG 1991, 1994). Hence, structural alterations in the p1 gene p1-8 AGAGGAATACCTTAGACTTGG caused by transposition reactions can be easily identified p1-9 GAAAGGTTGTGGAGAATAATAATAAGTAGGGCA p1-10 AACTGCAGGGCAACACTAGGCACAACGAC and studied. We isolated an allele termed the p1-vv9D9A p1-11 GATGATGTCTTCTTCCTCCTTGG allele, which contains a whole Ac element and a frac- p1-12 TAGATTTCCGTTCTTCGTGTGA tured Ac (fAc; 2526 bp 5Ј portion is deleted) inserted p1-13 CTGGCGAGCTATCAAACAGGCCAC in intron 2 of the p1 gene. From p1-vv9D9A, we isolated p1-14 ACATTGAACTGGGATTGTCTGCTTTG two derivative alleles (one a deletion, the other a dupli- p1-15 GGTTTTGAGGACGGAGGAGG cation) from a twinned pericarp sector. Sequences of the rearrangement junctions proved that these alleles -kb upstream of the p1 transcription start site (Fig 9ف were the reciprocal products of a single transposition a site reaction involving a pair of Ac 5Ј end and fAc 3Ј ends ure 1). from different sister chromatids (Zhang and Peterson Genomic DNA extractions and Southern blot hybridization: 1999). Total genomic DNA was prepared from husk using a modi- Although unconventional transposition events have fied cetyltrimethylammonium bromide extraction protocol (Saghai-Maroof et al. 1984). Agarose gel electrophoresis and been the subject of much research, transposition events Southern hybridizations were performed as described (Sam- involving TE termini in reversed orientation have not brook et al. 1989), except hybridization buffers contained 250 yet been described in a eukaryote. To test whether such mm NaHPO4, pH 7.2, 7% SDS, and wash buffers contained “reversed-ends” transposition could occur, we studied a 20 mm NaHPO4, pH 7.2, 1% SDS. maize p1 allele that carries a pair of Ac termini in re- PCR amplifications: PCR amplifications were performed as described (Saiki 1989) using the oligonucleotide primers versed orientation. We show that this configuration of shown in Table 1. transposon ends can generate deletions, inversions, and Reactions were heated at 94Њ for 3 min and then cycled 35 a novel local rearrangement structure and that the times at 94Њ for 20 sec, 60Њ for 30 sec, and 72Њ for 1 min/1 kb breakpoints of these rearrangements are delineated by length of expected PCR product and then at 72Њ for 8 min. the sequence hallmarks of Ac/Ds transposition. We dis- The band amplified was purified from an agarose gel and cuss the possible role of this transposition mechanism sequenced directly. Sequencing was done by the DNA Synthe- sis and Sequencing Facility, Iowa State University. in mediating the various types of chromosomal re- arrangements that have shaped eukaryotic genomes. RESULTS MATERIALS AND METHODS The P1-rr11 allele and its derivatives: We isolated a Genetic stocks: Alleles of the p1 gene are identified by p1 allele designated P1-rr11 (red pericarp, red cob), a two-letter suffix that indicates their expression pattern in which contains the truncated Ac element fAc, inserted pericarp and cob: e.g., P1-rr (red pericarp and red cob); P1- in the second intron of p1, and a full-length Ac element, wr (white pericarp, red cob); and p1-ww (white pericarp and inserted in the p1 5Ј flanking sequences, 13,175 bp up- white cob). The standard p1-vv (variegated pericarp and varie- gated cob) allele described by Emerson (1917) contains an stream of the fAc element (materials and methods). Ac insertion in the second intron of a P1-rr gene. From p1- In P1-rr11, the 5Ј end of Ac and the 3Ј end of fAc are vv, we obtained a spontaneous derivative termed P1-ovov1114 oriented toward each other (Figure 1A). P1-rr11 exhibits (orange-variegated pericarp and orange-variegated cob), in unstable kernel pigmentation, as evidenced by frequent which the Ac element had undergone an intragenic transposi- tion to a site 153 bp upstream in p1 gene intron 2 and inserted colorless pericarp sectors and colorless kernels (Figure in the opposite orientation (Peterson 1990). From P1- 1B). Because the kernel pericarp and egg cell are de- ovov1114, we obtained a spontaneous derivative termed p1- rived from a common cell lineage, sporophytic muta- vv9D9A (Zhang and Peterson 1999); this allele contains an tions that give rise to sectors of colorless pericarp can Ac element, a 112-bp rearranged p1 gene fragment (rP), and be germinally transmitted through the kernel embryo the terminally deleted Ac element fAc.