GENES,CHROMOSOMES&CANCER29:147–156(2000) GeneStructureoftheHumanReceptorTyrosine KinaseRONandMutationAnalysisinLung CancerSamples DeboraAngeloni,1* AllaDanilkovitch-Miagkova,1 SergeyV.Ivanov,2 RichardBreathnach,3 BruceE.Johnson,4 EdwardJ.Leonard,1 andMichaelI.Lerman1 1LaboratoryofImmunobiology,NationalCancerInstitute,FrederickCancerResearchandDevelopmentCenter,Frederick,Maryland 2IntramuralResearchSupportProgram,ScienceApplicationsInternationalCorporation,FrederickCancerResearchandDevelopment Center,Frederick,Maryland 3InstitutdeBiologie,Nantes,France 4MedicineBranchattheNavy,NationalCancerInstitute,NationalInstitutesofHealth,Bethesda,Maryland ThehumanRONgene(MST1R)mapsto3p21.3,aregionfrequentlyalteredinlungcancerandothermalignancies.Itencodes areceptortyrosinekinase(RTK)closelyrelatedtoMET,whosemutationsareassociatedwithneoplasia.Weinvestigated whetherRONmightbeinvolvedinthedevelopmentorprogressionoflungcancer.Wefirstdeterminedtheexon-intron structureofthegenebydirectsequencingofRONcosmidDNAandPCRproductscontainingintronicsequences,andthen developedprimerssuitableformutationanalysisbythesingle-strandconformationpolymorphism(SSCP)method.Twenty codingexonswerecharacterized,allbutthefirstonesmall(averagesize:170bp),afeaturesharedwithotherRTKgenes.We performedSSCPanalysisofRONinsmallandnon-smallcelllungcancersamples,upondetectionofitsexpressioninasample oflungcancercelllines.Amutation(T915C:L296P)wasfoundinanadenocarcinomaspecimen.Severalsinglenucleotide polymorphismswerealsofound.Thepanelofintron-anchoredprimersdevelopedinthisworkwillbeusefulformutation analysisoftheRONgeneindifferenttypesofhumantumors. ©2000Wiley-Liss,Inc. INTRODUCTION haveoverall33%identity,whichincreasesto64% ThehumanRONgene(MST1R,accordingtothe inthekinasedomain. officialnomenclature,seehttp://www.ncbi.nlm.nih. Missensemutationslocatedinthetyrosineki- gov/LocusLink/list.cgi)encodesareceptortyrosine nasedomainoftheMETgenehavebeenidentified kinase(RTK)of1400aminoacidsthatbelongstothe intheconstitutionalDNAofaffectedmembersof familieswithhereditarypapillaryrenalcellcarci- METgenefamily(Ronsinetal.,1993).Itissynthe- nomaandinasubsetofsporadicrenalcellcarci- sizedasasingle-chainprecursorthatundergoespro- nomasofthesamehistology(Schmidtetal.,1997, teolyticcleavageintotwosinglepolypeptidechains 1998;ZbarandLerman,1998).Thesearelikelyto linkedbydisulfidebonds.Thematureheterodimeric begain/change-of-functionmutationsthatleadto proteiniscomposedofone␣-(35kD)andone constitutiveactivationoftheMETproteinand ␤ ␣ -chain(150kD).The -chainislocatedextracellu- tumorigenesisintherenaltissue(Schmidtetal., ␤ larly,whereasthe -chaincontainsanextracellular 1997,1998).Similarmutationsoccurringinother portion,aone-passtransmembranehelix,andanin- RTKsareassociatedwithdifferenthumanmalig- tracellularportionthatharborsthetyrosinekinase nancies,namely,mastocytomasandgastrointestinal domain.Thenumberandthelocationofthedisulfide tumorsinthecaseofKIT(Nagataetal.,1995;Piao bondsarestillunknown.RONanditsligand,macro- andBernstein,1996;Hirotaetal.,1998),multiple phagestimulatingprotein(MSP),areinvolvedinthe endocrineneoplasiatypes2Aand2B,andfamilial developmentofepithelialtissues,bones,andneuro- medullarythyroidcarcinomasinthecaseofRET ectodermaltissues,drivingcellularproliferation (Mulliganetal.,1993;Hofstraetal.,1994).Muta- (Wangetal.,1994;Gaudinoetal.,1995;Quantinet al.,1995).ThegenescodingforRONandMSP bothmapat3p21.3(http://www.ncbi.nlm.nih.gov/ Supportedby:NationalCancerInstitute,NationalInstitutesof genemap/map.cgi?CHRϭ3,HumanGenomeMap Health;Grantnumber:NO1-CO-56000. *Correspondenceto:DeboraAngeloni,LaboratoryofImmunobi- 1998),aregionfrequentlyalteredinlung,kidney, ology,NationalCancerInstitute,FrederickCancerResearchand andothermalignancies(Brauchetal.,1987;Zbaret DevelopmentCenter,Frederick,MD21702-1201. E-mail:[email protected] al.,1987;Ronsinetal.,1993;Koketal.,1997).The Received3November1999;Accepted30March2000 predictedaminoacidsequencesofRONandMET ©2000Wiley-Liss,Inc. 148 ANGELONI ET AL. tions (D1232V and M1254T) introduced into the tion according to the manufacturer’s instructions RON kinase domain induce oncogenic and meta- (Clontech Laboratories, Palo Alto, CA). static properties (Santoro et al., 1998). These mu- tant RON receptors show an increased kinase cat- Determination of the Exon-Intron Structure alytic efficiency. Additional findings, both in vivo To define the exon-intron boundaries of RON, and in vitro, suggest that RON could be an onco- we designed several PCR primers on the cDNA gene. In liver progenitor cells, RON activation has sequence (GenBank accession number X70040). a strong cell dissociation, motogenic and mitogenic These primers were used on RON cosmid clones activity (Medico et al., 1996). In a breast cancer cell and RON cDNA. Comparing the PCR products by line (ZR75.1), RON activation led to more rapid size allowed us to determine whether an intronic proliferation, migration, and invasion (Maggiora et sequence was present. The sequencing of the PCR al., 1998). Rearrangements occurring in the extra- products to identify intronic sequence led to the cellular region of the protein result in altered ki- characterization of the exon-intron boundaries. nase activity. For example, a RON splicing variant When this approach did not work, because of the discovered in a gastric carcinoma cell line (KATO- presence of a large intron, we performed direct III) was found to be responsible for invasive prop- primer-walking sequencing on the cosmid DNA. erties acquired in vitro by these cells (Collesi et al., 1996). The uncleaved single-chain RON protein PCR Reactions undergoes aberrant intermolecular disulfide dimer- Each PCR primer pair (GIBCO-BRL, Gaithers- ization and intracellular oligomerization, and shows burg, MD; BioServe Ltd, Laurel, MD) was tested constitutive activation along with the potential of by running the product on a 4% 3:1 Nu-Sieve eliciting a motile-invasive phenotype. The effects agarose gel (FMC, Rockland, ME). All pairs were on cell motility shown by the RON/MSP system used under the following cycling conditions: 1 min were intriguing in view of the high metastatic ac- at 95°C, 30 sec at 64°C, 30 sec at 72°C, for 35 tivity of SCLC cells. cycles. PCR products were cloned using a TA To investigate whether the putative proto-onco- Cloning Kit (Invitrogen, Carlsbad, CA). gene RON could contribute to the development or progression of lung cancer, we first showed that the Sequencing gene is expressed in lung cancer cell lines. Next, Sequencing reactions were done either manu- we performed mutation analysis of the gene in 55 ally (T7 Sequence Kit, Amersham, Arlington paired lung cancer samples (Johnson et al., 1988). Heights, IL) or automatically (ABI 373 Stretch RON cDNA was previously cloned (Ronsin et al., Automated DNA Sequencer, Applied Biosys- 1993), but the gene exon-intron structure was not tems, Foster City, CA). elucidated. To perform a detailed mutation analy- sis of the RON gene in the lung cancer samples, it Web-Based Sequence Analysis Servers was necessary to define the exon-intron structure The web-based sequence analysis servers used and develop intron-based primers suitable for ex- were: http://gnomic.stanford.edu/GENSCAN.html onic and splice-site sequence study. We solved the and http://www.sanger.ac.uk/Pfam/search.shtml. gene structure through a PCR/sequencing strategy, and designed intronic primers to apply the single- Single-Strand Conformation Polymorphism strand conformation polymorphism (SSCP) method Analysis (SSCP) to do mutation analysis. We analyzed for mutations Each exon of the kinase domain, plus a region in the kinase-domain exons and the region contain- containing the proteolytic cleavage site in exon 1, ing the protein cleavage site in exon 1. was examined for mutation using a specific PCR primer pair (Table 1). The radioactive reaction was MATERIALS AND METHODS performed in a total reaction volume of 12.5 ␮l, containing 100 ng of genomic DNA, 12.5 pmol of Northern Blot Analysis ␮ each primer, 200 M dNTPs, 1.5 mM MgCl2, 1.25 Filters carrying polyAϩ mRNA from several nCi ␣35S-dATP, and 0.5 U AmpliTaq DNA poly- lung cancer cell lines were prepared according to merase (Perkin-Elmer). After heat denaturation (8 Sambrook et al. (1989). Radioactive DNA probes min at 90°C) in formamide buffer (Stop Solution, were prepared by random priming (Rediprime II, Amersham, Arlington Heights, IL), PCR products Amersham, Arlington Heights, IL). Hybridization (ranging in size from 88 to 298 bp) were run over- was performed in ExpressHyb hybridization solu- night in a 0.5ϫ MDE gel (FMC Bioproducts, CHARACTERIZATION OF THE HUMAN RON GENE 149 TABLE 1. PCR Primers Used for SSCP Analysis of the RON Gene Kinase Domain-Coding Exons (exons 14–20) and Cleavage Site (exon 1) PCR product Size in bp Forward primer Reverse primer 876F-971R 115 5ЈTTAGCGCCACTGAGCCAGAGTTGG 5ЈAGCACAGGGTAGGGCTGTCC 921F-1011R 112 5ЈTCGACTGCAGATTTGCTCCA 5ЈGTGGCAAGTTGGGCACCCACTG EXON 14 159 5ЈGCGGAAAGAGTCCATCCAG 5ЈCTTGAGACTCCATCTCTGC EXON 15 113 5ЈATTATGCACCTCACACCAGGCCAC 5ЈCTGCCCCACTTACGACTTAGTGAC EXON 16 206 5ЈTCGCTCTGCAGGCATCACAGAGATG 5ЈGATGAACACTGACCCGCTGAGGTGA EXON 17 162 5ЈTTGCCCACCAACCCACCTGTG 5ЈCACCCCAGCTACTCTGGACTC EXON 18 223 5ЈAGTCCTAAGTGTGATCCTCTCCCTAC 5ЈGCCTCACCACATCAGACTTGGTGGT EXON 19 163 5ЈCCACAGTGGTCATTTGGTGTGCTGC 5ЈCCACCTCCACATACTCACAGAGAATCAG EXON 20 108 5ЈCAGGTACCAAGTGATGCAGCAATGCTG 5ЈTCCCCAAGCAGTGCAGACACTATCTG Rockland, ME), 0.6ϫ TBE, at room temperature, 8 mutagenesis primer sequence was 5Ј P-CTA TCG W constant power, transferred to 3 MM paper, GGA