olume 8/ Issue 2/ July-December 2018 V • Volume 8 • Issue 2 • July-December 2018 • Pages 61-** Tropical Parasitology Spine 3 mm Original Article Determination of genetic diversity of Leishmania species using mini‑circle kDNA, in Iran‑Iraq countries border Tahereh Mousavi, Sahar Shokohi, Jahangir Abdi, Razi Naserifar, Mahmoud Ahmadi1, Asad Mirzaei Department of Medical Parasitology, Paramedical School, Ilam University of Medical Sciences, Ilam, 1Department of Medical Parasitology, School of Medicine, Tabriz University of Medical Sciences, Tabriz, Iran Abstract Background and Objective: Cutaneous leishmaniasis (CL) is one of the most important diseases worldwide, with a different range of prevalence in endemic areas. Anthroponotic and zoonotic CL are two epidemiological forms of CL, in Iran. Although Ilam Province in the west of Iran is one of the main endemic areas of the disease, there is no inclusive study to determine the genetic variations of parasite in these areas. The objective of this study was to determine the genetic diversity of Leishmania species in Ilam Province, using mini-circle kDNA gene. Materials and Methods: Direct smears were taken from skin lesions of 200 suspected cases of CL. Smears were stained, screened under light microscope. Polymerase chain reaction (PCR) was performed, using specific kinetoplast DNA primers. Data were analyzed, using the molecular bio-software. Results: All the samples were positive by direct examination. PCR results showed all cases were positive for Leishmania major. Although all isolated cases belong to a different county of Ilam province, all were positive for L. major with intra-species genetic diversity, divided into four clades in the dendrogram. Interpretation and Conclusion: This variation can affect drug resistance and controlling strategies of parasite. It is possible that different species of sand flies and rodents are the vector and reservoir of parasite, respectively; however, further studies are needed to validate this. Keywords: Heterogeneity, Iran, Kinetoplast DNA, Leishmania major Address for correspondence: Prof. Asad Mirzaei, Department of Parasitology, Paramedical School, Ilam University of Medical Sciences, Ilam, Iran. E-mail: [email protected] DOA: 19-11-18, DOP: 27-12-2018 INTRODUCTION areas.[5] Among all neglected tropical diseases, leishmaniasis is the most important protozoan infection, in the Middle Leishmaniasis is a vector‑borne disease, caused by obligate East and North Africa region.[6] intracellular parasite belongs to the order of Kinetoplastida, transmitted by phlebotomine sand flies (Diptera: This disease is endemic in tropical and subtropical regions Psychodidae).[1‑4] Cutaneous leishmaniasis (CL) is an of 98 countries in Africa, Asia, Europe, and the Americas.[7] important health problem in many countries of the It is a major global health problem in five continents, and it southern and eastern Mediterranean.[2,5] In fact, the World is estimated that 350 million people are at risk and currently Health Organization has announced, leishmaniasis as the 12 million individuals are infected, worldwide.[2,8‑10] Annually sixth most significant disease in tropical and subtropical This is an open access journal, and articles are distributed under the terms of the Creative Commons Attribution-NonCommercial-ShareAlike 4.0 License, which allows others to Access this article online remix, tweak, and build upon the work non-commercially, as long as appropriate credit Quick Response Code: is given and the new creations are licensed under the identical terms. Website: For reprints contact: [email protected] www.tropicalparasitology.org How to cite this article: Mousavi T, Shokohi S, Abdi J, Naserifar R, DOI: Ahmadi M, Mirzaei A. Determination of genetic diversity of Leishmania 10.4103/tp.TP_3_18 species using mini-circle kDNA, in Iran-Iraq countries border. Trop Parasitol 2018;8:77-82. © 2018 Tropical Parasitology | Published by Wolters Kluwer - Medknow 77 Mousavi, et al.: Determination of genetic diversity of Leishmania species two million new clinical cases occur globally, and incidence Sampling of CL is 0.7 to1.2 million.[4,11] The samples [Table 1] were collected from cutaneous lesions [Figure 2], suspected with CL, and then transferred Unorganized urbanization and human migration in these to a clinical laboratory. From all cases, medical records regions are the two main factors affecting leishmaniasis, were collected. Direct smear was taken from each lesion [6] regarding epidemiology and morbidity. Despite the of the suspected cases. Slides were fixed with methanol, existence of a universal program for vectors control stained with Giemsa and examined with light microscopy. and leishmaniasis treatment, the disease continues to Serous sample from lesion prepared in microtube, with a [6] spread. In recent years, factors, such as new settlements, final volume of 250μ l phosphate‑buffered saline. Samples urbanization, agricultural development, migration, regional were stored at −20°C, for DNA extraction. wars, improvement of reporting systems, and ecological changes, resulted in a significant increase in CL.[2] Genomic DNA extraction Total DNA was extracted from all samples. 100 μl of each Annually, more than 20 thousand cases of CL are reported sample was used for DNA extraction process, using the from different parts of Iran, while the actual number of DNA extraction kit (DNG‑plus™, Cinna Gene, Iran). [5] cases is several times more than the official reports. In Then the DNA extraction was performed, according to Iran, three species of Leishmania, such as Leishmania major, the manufacturer’s instructions. DNA was stored at −20°C, Leishmania tropica, and somewhat Leishmania infantum, have for further analysis. caused CL lesion.[12,13] Polymerase chain reaction amplification Thus, identification of Leishmania species is important for Extracted DNA was amplified by PCR, using specific planning control program and treatment protocols of the primers for kDNA mini‑circles. The primers were [14] disease. Many polymerase chain reaction (PCR)‑based designed, as previously reported by Noyes et al.: forward techniques have been used for Leishmania diagnosis and been primer: 13Z (ACTGGGGGTTGGTGTAAAATAG), validated. PCR technique, using kDNA gene is the most homologous to conserved sequence block 3, and reverse sensitive method for the detection of Leishmania parasite, and primer: LiR (TCGCAGAACGCCCCT), complementary it is superior to parasitological methods for identifying the cases, missed by either microscopic examination or culture.[15] Kinetoplast is a unique DNA containing structure in the mitochondrion of the cell, consisting of two components, maxi‑circle (present in a number of 30–50 copies/parasite, with 20–40 kb in length) and mini‑circle kDNA (present in a number of 10,000–20,000 copies/parasite with 1 kb in length).[16‑19] Kinetoplast DNA minicircles are often the first choice for leishmaniasis diagnosis, containing three highly conserved blocks conserved sequence blocks (CSB) (CSB‑1, conserved blocks of synteny‑2 and CSB‑3).[20] The main advantage of minicircles is high copy number and variation of kDNA mini‑circles, used for the analysis of genetic Figure 1: Geographical location of study area, Ilam province where [4,16,17,21] polymorphism. Therefore, it is an ideal target for samples collected to be screened for Leishmania the identification of Leishmania species.[22] Hence, we used kDNA‑PCR to determine the genetic diversity of this Table 1: Samples information received from different protozoon, in Ilam Province. counties in the Ilam province that studied Province County Number of Direct Microtube with MATERIALS AND METHODS samples smear lesion serous Ilam Abdanan 2 * * Malekshahi 1 * * Study area Chardavol 5 * * Ilam province is located in the west of Iran, in border Dehloran 137 * * of Iraq‑Iran, covering 19,086 km2, including eight Eyvan 3 * * Ilam 1 * * counties, in which Mehran, Dehloran, and Abdanan Mehran 50 * * with a high‑temperature climate, has a joint border with Sirvan 1 * * Iraq [Figure 1]. Total 200 78 Tropical Parasitology | Volume 8 | Issue 2 | July-December 2018 Mousavi, et al.: Determination of genetic diversity of Leishmania species to conserved sequence block 1, amplifying 560, 750, presented in GenBank. Only 20 out of 80 (25%) PCR and 680 bp fragments for L. major, L. tropica, and products had sufficient amount of amplified DNA, L. infantum, respectively.[23] Each 25 μl reaction mixture, which have been used for direct sequencing [Table 2]. contained 1x PCR,1.5 mM MgCl2, 0.2 mM dNTP, Dendrogram of kDNA gene sequences of isolates, 2.5 U Taq (Qbiogene, Irvine, CA, USA) and 1 μM of constructed by the neighbor‑joining method, using Mega each primer. A total of, 35 cycles were performed, using a 6 software [Figure 4]. Sequences designated as L. major IR/ PCR‑Thermal‑Cycler (SensoQuest, Göttingen, Germany), IL. L. tropica (accession number AB901375), was used as using the following conditions: an Initial denaturation of the out‑group. Bootstrap values (%) are indicated at the 5 min at 94°C, followed by 30 cycles of 94°C for 30 s, internal nodes (1000 replicates). 55°C for 60 s, 72°C for 90 s, and subsequent extension at 72°C for 10 min. Positive and negative control were used DISCUSSION for each PCR reaction. Due to the heterogeneity among Leishmania species, and The PCR products were separated on 1.2% agarose various clinical manifestation, as well as different types gel electrophoresis and visualized by Molecular Imager of