Supporting Information Mayanagi et al. 10.1073/pnas.1010933108 SI Material and Methods. (GCCTGCACGAATTAAGCAATTCGTAATCATGGTCAT- Purification of the Pyrococcus furiosus family B polymerases (PfuPolB) AGCT) primed with primer (AGCTATGACCATGATTAC- and Pfu Proliferating Cell Nuclear Antigen (PfuPCNA) Proteins. Escher- GAATTGCTTAAT) for pri30/40, template ichia coli JM109 containing the plasmid for PfuPolB overproduc- (GCCTGCACGAATTAAGCAATTCGTAATCATGGTCAT- tion was grown at 37 °C with shaking in 1 L of Luria–Bertani AGCT) primed with primer (AGCTATGACCATGATTAC- medium containing 50 mg ampicillin. When the culture reached GAATTGC) for pri25/40, and template an optical density at 600 nm of 0.6, IPTG was added to a final (GCCTGCACGAATTAAGCAATTCGTAATCATGGTCAT- concentration of 1 mM, and the culture was further incubated AGCT) primed with primer (AGCTATGACCATGATTACG) for for 14 h. The cells were harvested and disrupted by sonication pri19/40. in buffer A, containing 50 mM Tris–HCl, pH 7.6, 2 mM EDTA, 2.4 mM PMSF and 0.2% Tween 20, and the cell debris was Structure Analysis and Fitting of the Crystal Structures. No filter was removed by centrifugation at 24;000 × g for 15 min at 4 °C. The applied to the individual 18,897 images of the PfuPolB-PfuPC- NA-DNA complex, each boxed in a 56 × 56 pixel square supernatant was incubated at 80 °C for 15 min to denature and 3 1 ∕ precipitate most of the E. coli proteins. After centrifugation, ( . Å pixel), prior to image analysis. The initial 3D model was the heat-treated supernatant was dialyzed against buffer A con- obtained using the common-line method. Subsequent iterative alignment and 3D reconstruction were performed using the taining 10% glycerol, and then was subjected to anion-exchange REFINE routine in EMAN (1). The total number of the particles chromatography (RESOURCE Q, GE Healthcare), which was included in the final reconstruction was 16,679. The average num- developed with a linear gradient of 0–500 mM NaCl, by using ber of particles per class averages was 60. The threshold used a high-pressure liquid chromatography apparatus (ÄKTA Ex- for volume calculation was 2.25, which corresponds to 210 kD plorer 10S; GE Healthcare. The fractions containing the PfuPolB (1.3 g∕mL). Only a spheric mask (24-pixel radius, which corre- protein eluted at around 100 mM NaCl and were subjected to sponds to 74 Å) has been applied for final reconstruction, and cation-exchange chromatography (RESOURCE S, GE Health- no low pass filter has been applied to the final map. The resolu- care) on a column equilibrated with the same buffer. The PfuPolB tion of the final map was estimated by means of the Fourier shell protein was eluted with a linear gradient of 150–200 mM NaCl. correlation (FSC) method, using the 0.5 FSC criteria. The visua- To produce purified PfuPCNA, E. coli BL21-CodonPlus lization of the electron microscopy (EM) map and the fitting (DE3)-RIL cells containing the plasmid for PfuPCNA overpro- of the crystal structures into the map were performed with the duction were grown in 1 L of Luria–Bertani medium containing Chimera software (2). Initially, PfuPCNA crystal structure was 50 mg ampicillin to an optical density at 600 nm of 0.3 at 37 °C. manually placed to the hexagonal ring region of the map, so that IPTG was then added to the culture at a final concentration of the so-called C side of PCNA should face the PolB. Then the 0.2 mM, and growth was continued for 2 h. Cells were harvested, structure was rotated around the axis of the ring, and the inter- suspended in 25 mL of buffer B (50 mM Tris-HCl, pH 8.5; 0.1 mM domain connecting loops (IDCLs) were roughly adjusted to the EDTA; 2 mM β-mercaptoethanol; 0.1 M NaCl; 10% glycerol), flat edges of the hexagonal ring region. Finally the best fit and the cell extract was prepared as described above. The E. coli was searched using the “Fit Model in Map” tool in Chimera. proteins were partially removed by a two-step heating program, The PfuPolB crystal structure was also manually docked to the involving an initial incubation at 75 °C for 15 min. The superna- PolB region covering the PCNA, so that the DNA binding pock- tant after centrifugation was incubated at 80 °C for 10 min, and ets side should face the DNA rod density and PCNA. The crystal then centrifuged. To the second supernatant, polyethyleneimine structure was then further fitted to the EM map considering the and NaCl were added to 0.2% (wt∕vol) and 0.58 M, respectively, oval shell-like shape of the EM map and the crystal structure. and the mixture was stirred for 30 min at 4 °C. The proteins in the Notably the flexible C-terminal loop with the PCNA-interacting supernatant (30 mL) were precipitated by adding 16.8 g of am- protein (PIP)-binding motif was found in the vicinity of the bind- monium sulfate (80% saturation). The precipitate was dissolved ing pocket of PCNA, suggesting that the model is placed prop- in buffer C (50 mM Tris-HCl, pH 8.0; 0.1 mM EDTA; 10% gly- erly, close to the best fit. The final model was obtained by Fit Model in Map tool. No flexible fitting was used and both PCNA cerol; and 0.5 mM dithiothreitol) and dialyzed against the same and PolB crystal structures were fitted as rigid body. buffer. The dialysate was applied to an anion-exchange column (HiTrap Q, 5 ml; GE Healthcare), and the chromatography Sequence Alignments of Amino Acids Around the Second Contact Site. was developed with a 50-mL linear gradient of 0 to 1.0 M NaCl Sequence alignments of the representative clamp proteins 2 ∕ in buffer C, at a flow rate of mL min. The PfuPCNA was around the second contact site (E171 of PfuPCNA) were con- eluted at a salt concentration of 0.5 M. The purified PfuPolB structed. The amino acid sequences of the clamp proteins in the and PfuPCNA was stored at 4 °C after dialysis against buffer C. Protein Data Bank (PDB) (1isqA, Pyrococcus furiosus PCNA; The protein concentrations were determined by measuring the 1rwzA, Archaeoglobus fulgidus PCNA; 2ntiABC, Sulfolobus solfa- absorbance at 280 nm. The theoretical molar extension coeffi- taricus PCNA; 1ok7A, Escherichia coli polymerase β subunit; cients of these molecules were calculated based on the numbers 1vpkA, Thermotoga maritima polymerase β subunit; 2avtA, Strep- of tryptophan and tyrosine residues. tococcus pyogenes polymerase β subunit; 1b77A, bacteriophage RB69 gp4 protein; 1plqA, Saccharomyces cerevisiae PCNA; Synthetic DNAs Used for Sample Preparation. The primed-template 2z0lA, human herpes virus 4 BMRF1 protein; 2zvvA, Arabidopsis DNAs (priDNAs) were produced by annealing four pairs of syn- thaliana PCNA1; 2zvmA, Homo sapiens PCNA; 3a1jABC, Homo thetic DNAs, as follows: template (AGCTACCATGCCTGCAC- sapiens Rad9A-Hus1-Rad1 complex) were used for a blast search GAATTAAGCAATTCGTAATCATGGTCATAGCT) primed against the UniProt database, and the detected close relatives with primer (AGCTATGACCATGATTACGAATTGC) for pri25/ (>20% sequence identity, and >80% mutual coverage with query) 49, template were aligned with ClustalW (3–5). Mayanagi et al. www.pnas.org/cgi/doi/10.1073/pnas.1010933108 1of7 The sequence alignments of the representative archaeal PolBs Step 5: 1isq was trimerized into stp5 according to the BIOMT around the second contact site (379RRLR of PfuPolB) was matrix. constructed by the same method. The amino acid sequences of Step 6: stp4 and stp5 were assembled into stp6. The stp6 model the archaeal DNA polymerase B homologue in the PDB (3a2fA, showed that the DNA from 2po5 (yellow in stp6), in which the 3′ Pyrococcus furiosus; 1tgoA, Thermococcus gorgonarius; 1s5jA, terminus of the nascent strand is in the exonuclease active site, Sulfolobus solfataricus; 1d5aA, Sesulfurococcus sp.) were used made a smaller angle (∼22°) relative to the DNA clamped by the for a blast search against the UniProt database. PCNA (red in stp6). On the other hand, the angle was larger (∼43°) for the DNA from 2vwj (magenta in stp6), in which the Single Particle Analysis of the Mutant PolB (R379E)-PCNA-DNA nascent terminus was in the DNA polymerase active site. Complex. The mutant PfuPolB-PCNA-DNA was prepared by Step 7: DNA polymerase B in stp6 was divided into the the same method as that for the wild-type complex, using R379E N-terminal PIP box (residues 760–770) and the other part (resi- mutant PfuPolB and pri30/40. EM images of the mutant complex dues 1–759). PCNA, DNA, and PIP box were extracted from were recorded with a pixel size of 5.1 Å∕pixel. The total number stp6 (stp7). of boxed images used for single particle analyses was 13,447. The Step 8: The 20bp dsDNA and stp7 were assembled into stp8. 2D class averages were obtained using refine2d tool of EMAN, Step 9: DNA polymerase from 3a2f and the DNA from 2vwj assuming 100 classes. The obtained class averages obviously were extracted from stp6 and assembled into stp9e. exhibited a structural heterogeneity of the complex: Although Step 10: stp8 and stp9e were assembled into stp10e. some of the class averages exhibited the closed conformation very Step 11: The hairpin ssDNA of 2vwj was divided into the dsDNA of the template (nucleotides 0–13 of 2vwjB) and nascent similar to the wild-type complex (Fig. S6A), many class averages – exhibited open conformations, in which the PolB is rising up due (nucleotides 14 27 of 2vwjB) strands. The DNA polymerase- to the second contact disruption (Fig. S6B). DNA in stp10e was moved relative to the PCNA-PIP box, to bring the residues 759 (C terminus of DNA polymerase without PIP Construction of the Atomic Model of the DNA Polymerase B-PCNA- box) and 760 (N terminus of PIP box), and each strand of the DNA Complex.