Proc. Nati. Acad. Sci. USA Vol. 83, pp. 3096-3100, May 1986 Biochemistry Secretion and autoproteolytic maturation of subtilisin (protein transport/proteolytic processing/mutagenesis) SCOTT D. POWER*, ROBIN M. ADAMS*, AND JAMES A. WELLSt *Department of Protein Chemistry, Genencor, Inc., 180 Kimball Way, South San Francisco, CA 94080; and tDepartment of Biocatalysis, Genentech, Inc., 460 Point San Bruno Boulevard, South San Francisco, CA 94080 Communicated by M. J. Osborn, December 19, 1985 ABSTRACT The sequence of the cloned Bacillus MATERIALS AND METHODS amyloliquefaciens subtilisin gene suggested that this secreted serine protease is produced as a larger precursor, designated T4 lysozyme was provided by Ron Wetzel (Genentech). T4 preprosubtilisin [Wells, J. A., Ferrari, E., Henner, D. J., DNA kinase was from Bethesda Research Laboratories. Estell, D. A. & Chen, E. Y. (1983) Nucleic Acids Res. 11, BamHI, EcoRI, and T4 ligase were from New England 7911-7925]. Biochemical evidence presented here shows that a Biolabs. DNA polymerase large fragment (Klenow fragment) subtilisin precursor is produced in Bacillus subtilis hosts. The was obtained from Boehringer Mannheim. Enzymes were precursor is first localized in the cell membrane, reaching a used as recommended by their respective suppliers. Eugenio steady-state level of -1000 sites per cell. Mutations in the Ferrari and Dennis Henner kindly provided the following B. subtilisin gene that alter a catalytically critical residue (i.e., subtilis strains used in these studies (6, 14): BG2036 (Apr-, aspartate +32 -* asparagine), or delete the carboxyl-terminal Npr-), BG2019 (Apr-, Npr+), BG2044 (Apr', Npr-), and portion of the enzyme that contains catalytically critical resi- I-168 (Apr', Npr+). dues, block the maturation ofthis precursor. This block occurs Site-Directed Mutagenesis. Oligonucleotides were synthe- when these mutant genes are expressed in B. subtilis hosts sized by the addition of monomers or presynthesized trimers where the chromosomal subtilisin gene has been deleted. When using phosphotriester chemistry (15), except that mesitylene the mutant B. amyloliquefaciens subtilisins are expressed in B. nitrotriazole was used as a condensing agent. Oligonucleo- subtilis hosts that contain an intact chromosomal subtilisin tides were purified by polyacrylamide gel electrophoresis. gene, the mutant precursors are processed to a mature form All mutants prepared are summarized in Fig. 1. Mutagen- and released to the medium. Such processing, in trans, of the esis of aspartate +32 to asparagine +32 was directed by a precursor is also demonstrated in vitro by addition of active phosphorylated oligonucleotide having the sequence 5'- CG- GTTATC-AAC-AGCGGTAT -3'. The B. amyloliquefaciens subtilisin. Thus, the release of subtilisin from the cell mem- subtilisin gene contained on a 1.5-kilobase EcoRI/BamHI brane is dependent on an autoproteolytic process that appears fragment (3) was cloned into M13 mphl, and single-stranded to be novel among secreted proteins. phage DNA was prepared (16). This template was double- primed with the 5'-phosphorylated M13 sequencing primer Subtilisins are a class of serine endoproteases secreted into and the mutagenesis primer as described (17). Mutant phage the external medium by a wide variety ofBacillus species (1). were identified by hybridization with the 32P-labeled The enzymes from Bacillus amyloliquefaciens, Bacillus mutagenic primer using a tetramethyl ammonium chloride licheniformis, and Bacillus amylosacchariticus have been washing procedure (18). All mutations were confirmed by sequenced (2), and the genes coding for B. amyloliquefaciens M13 dideoxy sequencing (19). The mutagenized 1.5-kilobase and Bacillus subtilis have been cloned (3-6). Kinetic (1, 7, 8) EcoRI/BamHI fragment was cloned back into the E. coli-B. and crystallographic studies (9, 10) have helped to charac- subtilis shuttle plasmid, pBS42 (20). To ensure that no terize the structural and catalytic properties of these en- second-site mutation(s) had occurred, the region ofDNA that zymes. In contrast, comparatively little is known of the was sequenced was replaced with wild-type sequence con- biogenesis of subtilisin aside from the observation that its taining aspartate +32. This reconstruction restored the wild- expression is linked to the onset of sporulation (11, 12). type protease phenotype. The DNA sequences of the two cloned subtilisins (3-6) A primer having the sequence 5'- AAGGCACTTCCGG- between a GAGCTCAACCCGGGTAAATACCCT -3' directed a 7- reveal an intervening propeptide sequence puta- base-pair deletion and a frameshift starting at codon 163 tive signal sequence and the mature enzyme sequence. By giving rise to the plasmid pA166 (unpublished observations). analogy to eukaryotic enteric proteases (for review, see ref. Mutagenesis was carried out as described above. A primer 13), it might be expected that subtilisin would be secreted as having the sequence 5'- GAGAGGCAAAAAGCTTTT- the zymogen, prosubtilisin. However, only mature subtilisin TGCTTTAGC -3' directed an in-frame deletion of codons is detected extracellularly (3). No biochemical evidence has -102 to -98 in the subtilisin signal sequence. Mutagenesis yet been presented to show the existence of precursor forms was carried out as described (21, 22). Plasmids were trans- of subtilisin. It is shown here, by analysis of subcellular formed into E. coli strain MM294 as described by Mandel and fractions of Bacillus strains expressing various mutations in Higa (23). Plasmid DNA prepared from E. coli (24) was used the subtilisin gene, that a full-length precursor of subtilisin to transform B. subtilis 1-168 and mutants of this strain (25). (i.e., preprosubtilisin) exists in association with the cell Transformants were selected for chloramphenicol resistance membrane. Furthermore, the conversion ofthis primary gene in LB medium containing chloramphenicol at 12.5 ,g/ml or product into the mature enzyme is mediated by active LB plates containing chloramphenicol at 5 ,ug/ml. subtilisin and therefore this processing is most likely In vitro transcription-translation was carried out using a kit autocatalytic. obtained from Amersham primed with CsCl-purified plasmid DNA isolated from E. coli (26). The publication costs of this article were defrayed in part by page charge Cell Fractionation and Immunoblot Analysis. Stationary- payment. This article must therefore be hereby marked "advertisement" phase cultures (1.25 ml) were treated with 1 mM phenyl- in accordance with 18 U.S.C. §1734 solely to indicate this fact. methylsulfonyl fluoride to inactivate subtilisin activity. Sam- 3096 Downloaded by guest on September 27, 2021 Biochemistry: Power et A Proc. Natl. Acad. Sci. USA 83 (1986) 3097 plasmid pre pro subtilisin volume of complete Freund's adjuvant and distributed -107 ? -1 +1 intracutaneously over several sites on each rabbit (1 mg per pS4.5 NH2 animal). Booster injections were given in the ear vein (200 yg Asp3iu..Asn per animal) on days 21 and 42. Blood was collected weekly after each injection. pAsn+32 Ne2 Subtilisin antigens in the membrane, media, and cytosol 163 fractions were quantitated by radioimmunoassay. The mem- J-COOH brane fractions were treated with 5 M urea prior to analysis PA-66N02 -102 -98 in order to solubilize the antigen. The urea extract was diluted 1:20 with assay buffer (10 mM Na phosphate, pH 7.4/0.9% PAH-02) NH2== NaCl/0.5% bovine serum albumin/1 mM phenylmethylsul- FIG. 1. Summary of mutations prepared to evaluate subtilisin fonyl fluoride) just before analysis. Affinity-purified anti- processing. pS4.5 is a wild-type B. amyloliquefaciens subtilisin gene subtilisin immunoglobulin fraction (31) was coated at 10 cloned into a B. subtilis-Escherichia coli shuttle plasmid (3). pg/ml onto the 96-well microtiter plate for 2 hr at room pAsn+32 is a point mutant in mature subtilisin sequence in which the catalytically critical aspartate +32 is mutated to asparagine +32. temperature. After washing with assay buffer, samples and pA166 introduces a frameshift at position 163 of mature subtilisin, standards were incubated in the wells as before. After causing premature chain termination 21 codons downstream. washing, 100,000 cpm of "25I-labeled antibody (31) was pA-102 introduces an in-frame deletion of five amino acids from introduced and the plate was incubated again for 2 hr. After codon -102 to -98 in the signal sequence. All mutations were washing, the plate was assayed. produced by site-directed mutagenesis. Pre, pro, and mature se- quence domains are indicated in blocks. The pro-mature boundary is known (1-3). However, the boundary between pre- and prose- RESULTS quences is unknown and only arbitrarily assigned. Identification of a Subtilisin Precursor. The wild-type B. amyloliquefaciens subtilisin gene was introduced on the ples were centrifuged at 11,000 x g for 10 min and a medium plasmid pS4.5 (3) into B. subtilis strain BG2036. In this strain, fraction of 0.6 ml was mixed with 0.6 ml of 20% trichloro- both the endogenous alkaline protease (apr) (i.e., subtilisin) acetic acid. The suspension was incubated at 40C for 30 min and neutral protease (npr) genes have been deleted (14). The and the precipitated protein was recovered by centrifugation immunoblot analysis in Fig. 2A shows that at both early and for 10 min at 19,000 rpm in a Sorvall SS34 rotor (37,000 x g). late stages of cell growth, only the 27-kDa mature form of After washing with 0.6 ml of acetone followed by centrifu- subtilisin (P27) was detected in media fractions. In contrast, gation, the pellet was dried. The sample was disassociated in analysis of membrane fractions shows the presence of a NaDodSO4 sample buffer [4% (wt/vol) glycerol/2% 42-kDaprecursor (P42). Initially, the appearance ofP42 in the NaDodSO4/10 mM Na phosphate, pH 6.8] at 95°C for 3 min. membrane was coincident with the appearance of P27 in the The cell fractionation procedure was modified from medium. Subsequently, P42 was seen to disappear as P27 Kaback (27). The cell pellet was washed with 100 ,l of 10 mM accumulated.