301 Stimulation of endogenous GH and interleukin-6 receptors selectively activates different Jaks and Stats, with a Stat5 specific synergistic effect of dexamethasone S von Laue1, J Finidori3, M Maamra1, X-Y Shen1, S Justice1, P R M Dobson2 and R J M Ross1 1Division of Clinical Sciences, University of Sheffield, UK 2Institute for Cancer Studies, University of Sheffield, UK 3INSERM, Unité 344, Faculté de Médecine Necker, Paris, France (Requests for offprints should be addressed to S von Laue, INSERM U344, Laboratoire d’Endocrinologie Moléculaire, Faculté de Médecine Necker-Enfants Malades, 156, rue de Vaugirard, 75 730 Paris cedex 15, France; Email: [email protected]) Abstract The interaction of GH, interleukin (IL)-6 and glucocorti- Stat3 activation. In contrast, the reporter gene containing coids is likely to be important in regulating the GH- the Stat3 responsive element (SIE) was IL-6 specific. The insulin-like growth factor (IGF)-I axis. The signalling levels of gene induction by GH and IL-6 were not altered cascades activated by GH and IL-6 appear to be very by the co-stimulation with GH and IL-6, suggesting that similar, as demonstrated by studies using overexpression of there is little cross-talk at the Jak–Stat activation level the receptor and other components of the Jak-Stat and between the two cytokines. Neither GH nor IL-6 acti- mitogen-activated protein (MAP) kinase pathways. Here vated the MAP-kinase responsive serum response element we show that the human embryonic kidney cell line 293 (SRE), unless GH receptors or gp130 were overexpressed. (HEK293) expresses GH and IL-6 receptors endogenously. Transfection of Stat3 or Stat5 expression vectors enhanced To determine which specific pathways might be activated the response to GH and IL-6. Stimulation with dexa- by the two cytokines, at physiological levels of all compo- methasone synergistically enhanced GH activation of the nents, we studied GH and IL-6 mediated signal transduc- LHRE reporter gene but had no effect on the IL-6 tion both under basal conditions and in the presence of activation of the same reporter or on the SIE reporter gene. overexpressed receptors and Stat proteins. Our results Thus, our studies suggest that while each cytokine, GH suggest a receptor specificity of Jak2 for GH receptors, and and IL-6, may activate various members of the Jak–Stat Jak1 for IL-6 receptors. Stat activation in response to GH pathway in overexpression studies, specific activation of and IL-6 was determined by reporter gene induction. Both Stat3 by IL-6 and of Jak2 and Stat5 by GH can be observed GH and IL-6 were able to induce the reporter gene in HEK293 cells and that in this system the synergistic containing the Stat5 responsive element (LHRE) but the effect of dexamethasone appears specific for Stat5. IL-6 response appeared to be mediated mainly through Journal of Endocrinology (2000) 165, 301–311 Introduction (Jenkins & Ross 1996). Recently interleukin (IL)-6 has been shown to decrease IGF-I levels and impair growth in Growth hormone (GH) plays an essential role in childhood mice (De Benedetti et al. 1997), and IL-1 and tumour growth and is important in maintaining normal adult body necrosis factor (TNF) reduce IGF-I mRNA levels in composition, acting either directly on target tissues, or primary hepatocyte cultures (Thissen & Verniers 1997). indirectly by regulating insulin-like growth factor (IGF)-I Other potential inhibitors of GH actions are glucocorti- levels. Conditions with increased protein catabolism, as coids which reduce IGF-I secretion from rat chondrocytes can be found in critically ill, septic or post-surgical (Jux et al. 1998) and which are known to have a growth patients, are often accompanied by GH resistance, and retarding effect in children. Dexamethasone (Dex) a abnormally low IGF-I levels (Ross et al. 1991). It has been synthetic glucocorticoid increases IL-6 receptor (IL-6R) proposed that the levels of inflammatory cytokines could expression (Mori et al. 1998) and enhances several cell cause this cachectic state (Argiles & Lopez-Soriano 1999) responses to IL-1 and IL-6, such as the induction of and hence might also be responsible for the GH resistance the acute-phase protein and alpha-1-acid glycoprotein observed at the GH receptor (GHR) or post receptor level (Watanabe et al. 1999, Mejdoubi et al. 1999). The latter Journal of Endocrinology (2000) 165, 301–311 Online version via http://www.endocrinology.org 0022–0795/00/0165–301 2000 Society for Endocrinology Printed in Great Britain Downloaded from Bioscientifica.com at 09/23/2021 05:29:21PM via free access 302 S VON LAUE and others · GH and IL-6 mediated gene induction and synergism by Dex induction is inhibited by GH, indicating a complex system (Abingdon, UK). The Jak1 and Jak2 specific antibodies of interaction and cross-talk between the cytokine were from UBI TCS (Buckingham, UK). The reporter activated receptor pathways. plasmids pUC18-lactogenic hormone response element Despite the different biological actions of GH and IL-6, (LHRE)/TK-luciferase with four copies of the LHRE: they activate very similar sets of proteins, both having CTGCAGTGTGGACTTCTTGGAATTAAGGGCTT been shown to stimulate Jak1, Jak2, Stat1, Stat3, Stat5, TTGCTGCAG, pUC18-SIE m67/TK-luciferase with MAP-kinase, and SHP2 (Guschin et al. 1995, Narazaki three copies of the m67: CTGCAGTCGACATTTCC et al. 1994, Lai et al. 1995, Sotiropoulos et al. 1996, CGTAAATCGTCGACTGCA (Sotiropoulos et al. 1996) Moutoussamy et al. 1998b, Hirano 1998). For both the and pUC18-SRE/TK-luciferase with one copy of the GHR and the IL-6R, activation is dependent on the serum response element (SRE): CTAGAGGATGTCCA binding of Jaks to the Box 1 motif in the cytoplasmic TATTAGGACATCTGGATCTAG (Moutoussamy et al. domain of the GHR and gp130 respectively, and the 1998b), and the expression vector pcDNAI/Amp-GHRfl tyrosine phosphorylation of Jak and the receptor (reviewed (Ross et al. 1997) have all been described previously. The in Hirano 1998, Moutoussamy et al. 1998a). Furthermore, other plasmids were generous gifts, the -galactosidase it has been shown that the ligand occupied glucocorticoid (-gal) reporter IEP-gal-CMV from Gerald Clesham, receptor can effect gene induction by IL-6 and prolactin (Papworth Hospital, Cambridge, UK) the expression by interacting with Stat3 and Stat5 respectively (Stöcklin vectors for gp130 from Yannick Jacques (INSERM et al. 1996, Takeda et al. 1998). U463, Nantes), Stat3 from James Darnell (Rockefeller Our aim was to compare the signalling pathways University, NY, USA), and Stat5 (MGF) from Bernd activated by GH and IL-6 and to investigate how Dex Groner (Institute of Experimental Cancer Research, affects them, in a human cell line endogenously expressing Freiburg, Germany). both the GHR and IL-6R, in order to identify a potential target for IL-6 in GH resistance. The majority of studies on Cell culture and transfection GH and IL-6 signalling have been carried out in murine tissue or mouse and rat cell lines (Hirano 1998, Gronowski HEK293 cells were grown in Dulbecco’smodified Eagle’s et al. 1995, Smit et al. 1996), or by transfecting one of the medium–nutrient mix F12 (DMEM Nut F12), supple- receptors and one or more of the signalling molecules mented with 10% fetal calf serum (FCS), 10 IU and 10 (Sotiropoulos et al. 1996, Takeda et al. 1998, Wang et al. UG/ml penicillin–streptomycin, and 2 mM -glutamine 1995). This makes it difficult to analyse the relative (all Gibco BRL, Paisley, UK). For transfection 2·4106 induction of different pathways and to account for the cells were plated out in six-well plates with 12 ml medium distinct biological effects of GH and IL-6 in humans. The total, and left overnight. Cells were then incubated in 60% human embryonic kidney cell line, HEK293, contains DMEM Nut F12, 30% DMEM 4·5 g/l glucose (Gibco many active signal transduction pathways, and has been BRL) and 10% FCS, for 6 h. Transfection was carried out widely used in overexpression studies. We show here that using the calcium phosphate transfection kit (Gibco) as it also endogenously expresses both the GHR and IL-6R previously described (Ross et al. 1997), using 3 µg LHRE, at physiological levels. Stimulation with GH and IL-6 c-sis inducible element (SIE), Stat3, Stat5, 1 µg IEP- resulted in the phosphorylation of Jak kinases and the gal-CMV and carrier DNA up to a total of 20 µg DNA. induction of luciferase reporter genes, at low but signifi- After an overnight incubation, the medium was changed cant levels. We show that (i) the two cytokines appear to to FCS free DMEM Nut-F12. 293 GHRhi, a stable clone, activate distinct subsets of Jak and Stat proteins, (ii) expressing high levels of the human GHR was generated dexamethasone enhanced Stat5 mediated gene activation by cotransfecting pcDNAI/Amp-GHRfl and pcDNA3 by GH, but not IL-6 mediated Stat3 activation, (iii) and selection by 400 µM G418 (Gibco). co-stimulation with IL-6 did not down-regulate GH mediated gene induction, and that GH had no effect on Receptor detection the IL-6 induced luciferase levels. It is unlikely that cross-talk, at the level of the activation of the Jak–Stat RT-PCR experiments for IL-6R and gp130 involved 30 pathways by the two cytokines, could explain the cycles of PCR carried out using the primers 5cccggatc interference of IL-6 on GH signalling. cattttctggaagtgaggcc and 5ccggttaacgtagaaatcttcttcacatg for GHR, 5ttattcacccactcaccctc and 5aaaagatgcttctcact gcc for IL-6R and 5ccatccccaccttcatc and 5cctgcctgtgactt Materials and Methods tcaagc for gp130, 1·5mMMg2+, and 58 C annealing temperature, after reverse transcription. Negative controls Reagents included PCR of RNA preparations that had not been Recombinant human GH (Genotrophin) was obtained reverse transcribed, and samples lacking template (water).