EXPERIMENTAL AND THERAPEUTIC MEDICINE 22: 870, 2021 Difluoromethylornithine attenuates isoproterenol‑induced cardiac hypertrophy by regulating apoptosis, autophagy and the mitochondria‑associated membranes pathway YU ZHAO*, WEI‑WEI JIA*, SAN REN, WEI XIAO, GUANG‑WEI LI, LI JIN and YAN LIN Department of Pathophysiology, Qiqihar Medical University, Qiqihar, Heilongjiang 161006, P.R. China Received October 9, 2020; Accepted April 28, 2021 DOI: 10.3892/etm.2021.10302 Abstract. Myocardial hypertrophy is an independent risk Introduction factor of cardiovascular diseases and is closely associated with the incidence of heart failure. In the present study, we The initial stage of cardiac hypertrophy is an adaptive hypothesized that difluoromethylornithine (DFMO) could response in volume related to hypertension, valvular disease attenuate cardiac hypertrophy through mitochondria‑associ‑ or neurohumoral stimuli. The decompensated stage of patho‑ ated membranes (MAM) and autophagy. Cardiac hypertrophy logical hypertrophy leads to contractile dysfunction and heart was induced in male rats by intravenous administration of failure (HF) (1,2). Mitochondria serve crucial biological roles isoproterenol (ISO; 5 mg/kg/day) for 1, 3,7 and 14 days. For in excitation‑contraction coupling in cardiac muscle, cellular DFMO treatment group, rats were given ISO (5 mg/kg/day) metabolism, HF progression and myocardial ischemia/reper‑ for 14 days and 2% DFMO in their water for 4 weeks. The fusion (3‑5). It has been hypothesized that abnormalities in expression of atrial natriuretic peptide (ANP) mRNA,heart mitochondrial function and endoplasmic reticulum (ER) may parameters, apoptosis rate, fibrotic area and protein expres‑ be related to cardiomyopathy (6,7). sions of cleaved caspase3/9, GRP75, Mfn2, CypD and Increasing evidence suggests that mitochondria and the VDAC1 were measured to confirm the development of cardiac ER are organelles that form an endomembrane network. hypertrophy, apoptosis and autophagy induced by ISO. ANP Mitochondria‑associated membranes (MAM) appear to be the mRNA and MAM protein expression levels were assessed contact point through which the ER directly communicates by reverse transcription‑quantitative PCR and western blot‑ with mitochondria (8‑10). The ER‑mitochondria interface ting to evaluate hypertrophy and the effects of DFMO oral is enriched in various proteins, such as the macromolecular administration. The results demonstrated that heart param‑ complex composed of voltage‑dependent anion chan‑ eters, ANP mRNA levels, fibrotic area and apoptosis rate nels 1 (VDAC1), glucose regulated protein 75 (GRP75) and were significantly increased in the heart tissue for ISO 7 and inositol 1,4,5‑triphosphate receptor (IP3R), which regulate 14 day groups compared with the control group. Furthermore, Ca2+ transfer from the ER to mitochondria (11,12). The cross‑ treatment with DFMO significantly inhibited these indicators, talk between these organelle and MAM in cardiomyopathy and DFMO downregulated the MAM signaling pathway and remains unknown and requires further investigation. upregulated the autophagy pathway in heart tissue compared Polyamines, such as putrescine, spermidine and spermine, with the ISO 14 day group. Overall, all ISO‑induced changes are involved in cell proliferation and survival and in numerous analyzed in the present study were attenuated following treat‑ biological and pathological processes, including apoptosis, ment with DFMO. The findings form this study suggested that regulation of Kir channels and oxidative stress (13‑15). DFMO treatment may be considered as a potential strategy for Previous studies have reported that elevated polyamine levels preventing ISO‑induced cardiac hypertrophy. are associated with cardiac hypertrophy (16,17). Certain stimuli, such as growth factors and oncogenes (hormones, Myc and Ras) can rapidly increase ornithine decarboxylase (ODC) protein level, which is a key enzyme involved in cellular poly‑ amine biosynthesis (18,19). Difluoromethylornithine (DFMO) is an ornithine analog that has previously been reported to Correspondence to: Professor Yan Lin, Department of deplete cellular polyamines through inhibition of ODC and Pathophysiology, Qiqihar Medical University, 333 Bukui Street, to promote cardioprotection by attenuating apoptosis and the Qiqihar, Heilongjiang 161006, P.R. China NO/cGMP‑dependent protein kinase‑1 pathway (17,20,21). E‑mail: [email protected] Subsequently, the present study investigated whether isopro‑ *Contributed equally terenol (ISO)‑induced cardiomyopathy could be associated with increased apoptosis and MAM. In addition, this study Key words: cardiac hypertrophy, difluoromethylornithine, examined if DFMO could be considered as an effective phar‑ mitochondria‑associated membranes, apoptosis, autophagy macological method to attenuate ISO‑induced cardiomyopathy and if this possible effect may be mediated by MAM signaling 2 Zhao et al: DFMO ameliorates cardiac hypertrophy by regulating autophagy and MAM pathway pathway regulation. In the present study, it was hypothesized first strand cDNA. RT‑qPCR was performed using PowerUp that cardiac hypertrophy induced by ISO was associated with SYBR‑Green Master Mix and the results were analyzed using apoptosis and MAM and polyamine depletion by DFMO the StepOne™ (Thermo Fisher Scientific, Inc.) system with exerts a protective effect on cardiac hypertrophy. GAPDH as an internal control. The primers for ANP (a marker gene of cardiac hypertrophy) were as follows: forward Materials and methods 5'‑GGGAAGTCAACCCGTCTCA‑3' and reverse 5'‑GGGCTC CAATCCTGTCAAT‑3'. The primers for GAPDH were as Chemicals and reagents. ISO (cat. no. 51‑30‑9) and follows: Forward, 5'‑GAGACAGCCGCATCTTCTTG‑3' and DFMO (cat. no. 70052‑12‑9) were both purchased from reverse, 5'‑ATACGGCCAAATCCGTTCAC‑3'. The thermocy‑ Sigma‑Aldrich; Merck KGaA. The TUNEL detection kit cling conditions were as follows: Initial denaturation at 95˚C for was purchased from Roche Diagnostics GmbH. The primary 30 sec; 40 cycles of annealing at 95˚C for 5 sec and extension at antibodies against cleaved caspase‑3/9, caspase‑3/9, VDAC1, 60˚C for 30 sec. The relative expression levels were normalized GRP75, cyclophilin D (CypD), mitofusin 2 (Mfn2), autophagy to endogenous control and were expressed as 2‑ΔΔCq (20). related 5 (Atg5) and Beclin1 were obtained from Santa Cruz Biotechnology, Inc. TRIzol reagent and a PrimeScript RT Western blotting. Harvested left ventricle tissues were frozen in Reagent kit were from Takara Biotechnology. Protein extrac‑ liquid nitrogen and stored at ‑80˚C until prepared as described tion kit and GAPDH antibody (both Wuhan Boster Biological previously (19). Heart tissues were homogenized in RIPA lysis Technology, Ltd.) and Masson's trichrome staining kit (Beijing buffer containing protease and phosphate inhibitors on ice (cat. Solarbio Science & Technology Co., Ltd.) were also purchased. no. P0013B; Beyotime Institute of Biotechnology) and centri‑ fuged at 12,000 x g for 20 min at 4˚C. The protein concentration Animals. Healthy male Wistar rats weighing 200‑250 g were was determined using a BCA protein assay. Proteins samples used in the present study (Qiqihar Medicine University Animal were separated by electrophoresis in 10% SDS‑PAGE gels Center). Rats were housed on a 12 h dark‑light cycle at 23±1˚C. (20 µg protein/lane) and transferred onto PVDF membranes. The study protocol was approved by the Institutional Animal After blocking with 5% skimmed milk in Tris‑buffered saline Research Committee (approval no. QMU‑AECC‑2019‑53). for 1.5 h at 25˚C, membranes were incubated with primary antibodies against GRP75 (1:1,000; cat. no. ab171089), VDAC1 Rat cardiac hypertrophy model and drug treatment. As (1:500; cat. no. ab14734), CypD (1:500; cat. no. ab231155), Mfn2 described previously (15), rats were randomly divided into six (1:500; cat. no. 11925S), GAPDH (1:1,000; cat. no. ab8245), groups (n=10 per group) as follows: i) Control group, rats were cleaved caspase‑3 (1:1,000; cat. no. 9661S), cleaved caspase‑9 given subcutaneous injections of 0.9% saline; ii) ISO1d group, (1:1,000; cat. no. 20750S), Atg5 (1:500; cat. no. 2630S) and rats were given ISO (5 mg/kg/day) for 1 day; iii) ISO3d group, Beclin1 (1:500; cat. no. 3738S) overnight at 4˚C. The membrane rats were given ISO (5 mg/kg/day) for 3 days; iv) ISO7d group, was washed three times in TBST and incubated with horse‑ rats were given ISO (5 mg/kg/day) for 7 days; v) ISO14d group, radish peroxidase‑conjugated secondary antibody (1:5,000; rats were given ISO (5 mg/kg/day) for 14 days; and vi) DFMO cat. no. BA1058; Wuhan Boster Biological Technology, Ltd.) treatment group, rats were given ISO (5 mg/kg/day) for 14 days in TBST for 1 h at 25˚C. The bands were detected using ECL and 2% DFMO in their water for 4 weeks. Following treat‑ chemiluminescence kit (cat. no. P0018M; Beyotime Institute ment, all rats were euthanized using 3% pentobarbital sodium of Biotechnology). Membranes were stripped with stripping (80 mg/kg) and hearts were collected for further experiments. buffer (cat. no. P0025; Beyotime Institute of Biotechnology) and The hearts were carefully isolated, excised and weighed re‑probed with different antibodies. Relative expression levels in cold buffer. The ventricles were separated and weighed were normalized to endogenous control GAPDH using ImageJ and the degree of ventricular hypertrophy was assessed by software (version 1.4.3.67; National Institutes of Health). evaluating the heart‑to‑body