Copeia, 2002(3), pp. 618±631 Phylogenetic and Biogeographic Analysis of the Sparidae (Perciformes: Percoidei) from Cytochrome b Sequences THOMAS M. ORRELL,KENT E. CARPENTER,JOHN A. MUSICK, AND JOHN E. GRAVES We used complete sequence of the mitochondrial cytochrome b gene to test mono- phyly of the Sparoidea, Sparidae, six subfamilies of Sparidae, and to elucidate the interrelationships of the 33 recognized sparid genera. The analysis included 40 spar- id species, 10 closely related species, 10 basal percoids, and two nonperciform out- group species. The aligned 1140 base pairs of cytochrome b yielded 542 parsimony informative characters. Mutational analysis revealed that third codon position tran- sitions were saturated and, therefore, of questionable use in phylogenetic analysis. However, the third codon position transversions and all ®rst and second codon substitutions were not saturated and thus judged more reliable for inferring evolu- tionary relationship. Parsimony analysis of the equally weighted nucleotide data, weighted nucleotide data set (saturated position transitions given a weight of zero) supported a monophyletic Sparidae with the inclusion of Spicara, which is tradition- ally included in Centracanthidae. The previously proposed composition of genera within the six sparid subfamilies (Boopsinae, Denticinae, Diplodinae, Pagellinae, Pagrinae, and Sparinae) were not monophyletic in all analyses. This suggests the feeding types on which the subfamilies are based were independently derived mul- tiple times within sparid ®shes. In all analyses, Lethrinidae were sister to Sparidae. Sparoidea (Sparidae, Centracanthidae, Lethrinidae, and Nemipteridae) were mono- phyletic only in the weighted nucleotide phylogeny. PARIDAE are a diverse group of over 110 extending to the interorbital region, molar S mostly neritic species whose putative six teeth in two series, and body reddish. subfamilies have been de®ned primarily on the Sparidae have been historically a heteroge- basis of dentition and feeding type (Smith, nous group of ®shes, often associated with Leth- 1938; Akazaki, 1962). Monophyly of these sub- rinidae, Nemipteridae, Lutjanidae, Caesionidae, families has not been tested, nor have the phy- and Haemulidae ( Jordan and Fesler, 1893; logenetic relationships of all sparid genera been Schultz 1953). Akazaki (1962) used osteology to hypothesized. Smith (1938) and Smith and de®ne ``spariform'' ®shes that included the Smith (1986) initially partitioned sparid genera Nemipteridae, Sparidae, and Lethrinidae. Aka- into four subfamilies based mainly on dentition. zaki suggested that spariform ®shes had three Boopsinae have compressed outer incisiform ``stems'': the primitive Nemipteridae-stem; the teeth and are typically herbivores or feed on intermediate Sparidae-stem; and the highly spe- small invertebrates. Denticinae are typical pis- cialized Lethrinidae-stem. Johnson (1980) pro- civores with enlarged canines in front and small- posed the superfamily Sparoidea to include Ak- er conical teeth behind. Pagellinae lack canines, azaki's three spariform families and Centracan- have small conical outer teeth and small inner thidae. He added Centracanthidae based on molars, and are usually carnivorous on small in- maxillary-premaxillary distal articulation and vertebrates. Sparinae have jaws with bluntly other osteological characters. Johnson dis- rounded molars posteriorly, enlarged front agreed with Akazaki's placement of Sparidae be- teeth, and are carnivorous on crustaceans, mol- tween Nemipteridae and Lethrinidae, and he lusks, and small ®shes. Akazaki (1962) erected presented tentative anatomical and osteological two new subfamilies, also most easily de®ned by evidence that Nemipteridae and Lethrinidae dentition. He removed the genera Diplodus, Ar- were more closely related to each other than chosargus, and Lagodon from Sparinae and they were to either sparids or to centracanthids. placed them into Diplodinae. He also moved Few molecular studies have examined the Pagrus, Argyrops, and Evynnis from Sparinae into evolutionary relationships of Sparidae, and Pagrinae. Akazaki de®ned Diplodinae as having none has employed cladistic analysis to under- six to eight anterior teeth in the jaws and stand the evolutionary history of all sparid gen- obliquely projecting incisors, and Pagrinae as era. Taniguchi et al. (1986) investigated 18 iso- having four canines on the upper jaw, four to zyme loci from skeletal muscle, liver, and heart six canines on the lower jaw, scales on the head tissues to infer the genetic relationships of 10 q 2002 by the American Society of Ichthyologists and Herpetologists ORRELL ET AL.ÐMOLECULAR PHYLOGENY OF THE SPARIDAE 619 species from six genera of Japanese sparids. nized genera of Sparidae, other members of the Their results established a close genetic rela- superfamily Sparoidea (Centracanthidae, Nem- tionship of Japanese sparids; a genetic distance ipteridae, and Lethrinidae), and possible close (Nei, 1978) of less than 0.01 between Japanese outgroups in Percoidei (Haemulidae, Lutjani- members of the genera Pagrus, Evynnis, Argyrops, dae, and Caesionidae). Basal percoids, Moroni- and Dentex. A greater genetic distance (. 0.013) dae and Lateolabracidae (Springer and Raasch, was found between these four genera and Spa- 1995), were used to root Sparidae and related rus and Acanthopagrus. Basaglia (1991) analyzed families within Perciformes. Sequences of two six isozymes from seven different tissues of 15 ostariophysins, Luxilus and Cyprinus, were used sparid species to infer phylogenetic relation- as distant outgroups in this study. GenBank se- ships based on an ``index of divergence.'' Bas- quences were used for six of the 62 taxa exam- aglia and Marchetti (1991) examined white ined. Voucher designations and collection data muscle protein using the same 15 species in Bas- are provided in Material Examined below. Gill aglia (1991) and presented a more quantitative tissue or white muscle tissue was dissected from analysis based on pairwise similarity coef®cients fresh or frozen samples and placed into a buffer that clustered sparids into respective subfami- solution of 0.25 M disodium ethylenediamine- liesÐBoopsinae, Diplodinae, and Pagellinae. tetra-acetate (EDTA), 20% dimethyl sulfoxide The pagelline Lithognathus mormyrus and the (DMSO), saturated sodium chloride (NaCl), pH denticine Dentex dentex clustered with Sparinae. 8.0 (Seutin et al., 1990) and stored at room tem- Garrido-Ramos et al. (1994, 1995, 1999) used perature. centromeric satellite DNA to elucidate the re- lationships of Mediterranean sparids. The last DNA isolation, ampli®cation, cloning, and sequenc- study sampled 10 taxa from four genera to infer ing.ÐDNA was isolated from approximately phylogenetic relationships from neighbor-join- 0.05±0.1 g of tissue following (Sambrook et al., ing and distance analyses. Jean et al. (1995) ex- 1989) or by using the tissue protocol of amined three mitochondrial regions, the dis- QIAampt System DNA extraction kits (QIA- placement loop, tRNAPhe, and 12S rRNA gene, GEN, Inc). Primer pairs used for PCR ampli®- of ®ve taxa from two genera of Taiwanese spar- cation in this study were mapped against the ids. Their resulting phylogenetic tree was based equivalent sequence positions on the mitochon- on Tamura-Nei genetic distances. Hanel and drial genome of Cyprinus carpio (Chang et al., Sturmbauer (2000) used 16S rDNA sequences 1994; GenBank accession number X61010). The to examine the evolution of trophic types in following primer pairs were used: CytbGludgL Northeastern Atlantic and Mediterranean spar- (TGACTTGAARAACCAYCGTTG, L15249; S. Pal- ids. Based on their limited subset of sparid gen- umbi, A. Martin, S. Romano, W. O. McMillan, L. era, they concluded that trophic types evolved Stice, and G. Grabowski, The Simple Fools Guide more than once in sparid ®shes. to PCR, University of Hawaii, Honolulu, HI, 1991, In this paper, we present the results of phy- unpubl.), CytbThrdgH (CTCCAGTCTTCG- logenetic analyses of the complete mitochon- RCTTACAAG, H16565; S. Palumbi, A. Martin, drial cytochrome b (cyt b) gene (1140bp) for 40 S. Romano, W.O. McMillan, L. Stice, and G. sparid species, 10 closely related species, 10 bas- Grabowski, 1991, unpubl.), CytbUnvL (CGA- al percoids, and two nonperciform outgroup ACGTTGATATGAAAAACCATCGTTG, L15242, species. Cytochrome b has proven a valuable Kocher and White, 1989), CytbUnvH (ATCTTC- evolutionary marker for ®shes because it has GGTTTACAAGACCGGTG, H16458, Cantatore produced robust phylogenies at various taxo- et al., 1994), Cytb4XdgL (TGAYWTGAARAAC- nomic levels (Lydeard and Roe, 1997; Schmidt CAYCGTTG, L15249 modi®ed from S. Palumbi, et al., 1998; Song et al., 1998). We used mito- A. Martin, S. Romano, W. O. McMillan, L. Stice, chondrial DNA from the complete cyt b gene to and G. Grabowski, 1991, unpubl.) and test monophyly of the Sparoidea, Sparidae, six Cytb4xdgH (TGRVNCTGAGCTACTASTGC, subfamilies of Sparidae, and to elucidate the in- H16435, generated during this study). Primers terrelationships of the 33 recognized sparid were ordered from Genosys (Genosys Biotech- genera. A resulting phylogeny was used to elu- nologies, Inc.). All primers sites were located cidate the biogeographic aspects of sparid evo- within the transfer ribonucleic acids (tRNAs) lution. that ¯ank either end of the mtDNA cyt b gene (tRNAGlu and tRNAThr). A50ml PCR ampli®cation of cyt b was per- MATERIALS AND METHODS formed with 5±10 ng of each template DNA. Specimens and tissue samples.ÐSpecimens