SSR Marker-Based Genetic Resource Assessment of The Rainbow Clam Moerella Iridescens Along The Coasts of China: Implications for Strategy of Conservation Management Xiaoying Li Jiangsu Ocean University Shan Gao Jiangsu Ocean University Manman Zhao Jiangsu Ocean University Zhiguo Dong ( [email protected] ) Jiangsu Ocean University https://orcid.org/0000-0001-7652-3316 Research Article Keywords: Moerella iridescens, SSR, Genetic diversity, China coasts, Conservation management Posted Date: August 18th, 2021 DOI: https://doi.org/10.21203/rs.3.rs-769531/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Page 1/10 Abstract This study aims to determine the genetic structure and diversity of rainbow clam Moerella iridescens in different sea areas of China. Seventeen pairs of microsatellite primers (SSR) were used to amplify the SSRs of rainbow clam in Lianyungang of Haizhou Bay, Chongming of Shanghai, Ningde in Fujian, Cixi and Wenzhou in Zhejiang. A total of 1146 alleles were detected in 310 individuals from the 17 SSR loci. The average observed heterozygosity of six populations was 0.4381–0.6139, the average expected heterozygosity was 0.5897–0.7325, and the average Shannon diversity index was 1.2655–1.7998. The clams exhibited rich genetic diversity and the FST of the genetic differentiation index of the six populations was 0.0470, indicating low genetic differentiation amongst the populations. The results indictated that rainbow clam along China coasts exhibited high diversity and low population differentiation. Introduction The rainbow clam Moerella iridescens is an economically important small-sized marine clam due to delicious taste and high nutritional value. The clam mainly is distributed in the West Pacic coast and northern Australia. In recent years, rainbow clam has been increasingly used as high-valued seafood and as feed for shrimps and crabs in some mariculture industry of China. Deterioration of the ecological environment has led to a sharp decline in the natural resources of rainbow clams due to overshing and increases in shrimp and crab farming. Thus, protection of rainbow clam resources is of great importance. Several authors have explored the biological characteristics and morphological differences of rainbow clam (Ji et al. 2007; Lv et al. 2012). To date, however, reports on the genetic diversity and relationships amongst clam populations are limited (Xu et al. 2016). Microsatellites, also known as simple repetitive sequences (SSR), present the advantages of co-dominance, single locus, high polymorphism and easy operation and can be screened from different populations to complete genetic diversity studies (Cui et al. 2011). Microsatellite marker technology has been widely used in the structural analysis of the population genetics of aquatic animals, e.g. the rainbow trout (Zhao et al. 2010), the scallop Patinopecten yessoensis (Chang et al. 2007) and triangle pearl Hyriopsis cummingii (Bai et al. 2015). So far, few reports are available on the genetic diversity of the population of rainbow clam. In the present study, the genetic diversity of six populations of rainbow clams in Lianyungang, Chongming Island, Ningde, Zhoushan, Cixi and Wenzhou was analysed by using microsatellite markers. The results obtained can provide a scientic basis for assessing germplasm resources and genetic diversity protection of rainbow clam. Materials And Methods Materials Rainbow clams were collected from the six coastal mud ats, Lianyungang Haizhou Bay (LYG), Chongming Island Dongtan (CM), Ningde Fu’an (ND), Zhoushan Daishan (ZS), Hangzhou Bay Cixi (CX) and Wenzhou Yueqing Bay (WZ). Fifty samples were obtained randomly from each population. Information on the samples collected is presented in Table 1 and Fig. 1. The sampled rainbow clams were stored at − 70°C until analysis. Table 1 Sampling time, place and sample size of rainbow clam Stock LYG CM ND ZS CX WZ Sampling time 2012·10 2012·10 2012·10 2012·10 2012·10 2012·10 Number of 50 50 50 50 50 50 samples Sampling site Sanyang East beach, Chongming Xiabaishi, Sansha Bay Datian Cixi Sanbei Simon Island, harbor, Island in Fu'an Bay, shoal,Hangzhou Bay Yueqing Bay, Haizhou Bay Daishan, Zhoushan GPS E119.2835 E122.0058 E119.6263 E122.2095 E121.4337 E121.2031 N34.7996 N31.5316 N26.7948 N30.2888 N30.2998 N28.3229 Microsatellite Primer The M13 (-21) universal primer sequence of 5′-TGTAAAACGACGGCCAGT-3′ reported by Schuelke (2000) was adopted in this study to elongate short primers in for economic consideration in genotyping. We used two uorescent labels FAM and HEX for forward primes which were abbreviated as FAM-M13 and HEX- M13. Totally, 19 SSRs were used for PCR and these primer information was shown in Table 2. Page 2/10 Table 2 Microsatellite primer information. *Primers of forward sequence tailed with universal M13 (− 21) sequences (5′- TGTAAAACGACGGCCAGT-3′) at their 5′ ends. SSR Repeat motif Sequence (5′–3′)* Size of original fragment /bp (Tm)/°C HGZ2 (AC)17(CA)11 F:TGAGGTGGAATGAGTTAC 124 45 R:TAAGTTCGGATGACAAAG HGZ3 (GT)22 F:ATGGGAGACAACTCGCTAC 353 52 R:CTGTCACAACGGCAATCT HGZ6 (TG)4 F:GGGCCAAATCAGGGAATG 103 58 R:AGCAGGAAACGCAGCACA HGZ9 (AC)9(AC)7(CA)7 F:CAGCCTGGGCAACATAGT 116 53 R:TAGGACCACAGGTAAGCATC HGZ10 (GT)6(GT)8(GT)6 F:AGGTAGGGCGTGAAGGAA 193 55 R:GCAAAATCGACCCTACTACATA HGZ14 (CA)6 F:ACTAGTACGTGAAGATTAGCCAA 338 55 R:GAGGCGATACTCATAATGTTCA HGZ17 (AC)26(CA)21 F:ATGAGAGAGCGACAGAATG 150 50 R:TAGAGGCTCCCTAAATGG HGZ22 (GA)19(AG)12 F:TTTCCACTTCGCACATTG 196 52 R:CTCGCACAAACAAATGAAC Mir8 (GT)15 F:GTAGGTTTGGCATGGCTTTGTAGC 124 64 R:ACCATTGAGGGCTCGTCTGAATTAT Mir12 (AG)16 F:TCACCAGAAAGGAGACCGTAAAAGT 120 63 R:CTACGGATTTCGCAGTGAAAATGT Mir13 (AC)15 F:GCAACACAACGAGAGTG 116 47 R:ACAACAAACAACAAAGAAAT Mir14 (CT)4 F:ATCGTTGGGGCATTCTAGTTTTCT 83 62 R:GGGTATAATAATTTTGAAACGCAGC MH19A (TG)28 F:GTGAGCAGGAATCAAAGGTG 105–145 55 R:CTCCGCTCTGTTTGCCTAT Mi44A (TG)61 F:CCTCGGAGACCATTCGCTAC 85–101 52 R:TGCTTTTCTATGACAACCCT MW33A (TG)13TA(TG)5(CG)2TGCG F:TTCCTATCCTTACCCTTG 111–171 48 R:CTGACTGGAAACTCAACAC MW15A (CA)24 F:GATCAAAATTGACAAGGCT 88–150 46 R:AAGACAAACACGGATGGT MX39C TGTT(TG)6(GG)4GT F:CCCAACCAGAATAATACCA 200–220 48 R:TCCAACAAAGGAATACGATA MY36B (TG)7(GG)3 F:CCGTTGGTAAAGACGATAT 251–283 58 R:TGGTTGCGAGTTGGACAC MZT46B (TG)75 F:GACATAAAGGTTGTAGGGA 151–283 46 R:ATGGTAGTGATGATGCTTG Method Page 3/10 Total DNA was extracted with SDS–phenol chloroform method. The PCR system used consisted of 1 µL of template DNA (about 30 ng), 2 µL of primer mix, 1 µL of universal uorescent primers, 10 µL of 2× Taq PCR MasterMix and 6 µL of ddH2O to form a total volume of 20 µL. PCR program was as follows: pre- denaturation at 90°C for 5 min, 30 cycles, denaturation at 94°C for 3 min, annealing at 53°C for 1 min and at 72°C for 30 s and a nal extension at 72°C for 10 min at the end of the cycle. The PCR products were subjected to capillary electrophoresis, and the electrophoresis patterns were genotyped by GeneMapper 3.7 and Peak Scanner software. Data Processing Pop32 software was utilised to calculate the number of effective alleles (Ne), expected heterozygosity (He), observed heterozygosity (Ho) and gene ow (Nm), genetic distance (Ds) and Shannon diversity index. Population clustering was analysed using the unweighted pair-population method with arithmetic means (UPGMA) of the MEGA 3.0 software. Analysis of molecular variance (AMOVA) was performed using Arlequin 3.11 software, and the genetic diversity and genetic differentiation index (FST) were computationally analysed. Results Genetic diversity of the rainbow clam There were 1146 alleles successfully detected in the six populations through 17 SSR loci scanning the genomes of rainbow clam populations, except in the HGZ22 in the Wenzhou population failed to amplied by PCR. Except for the alleles detected at the two loci of HGZ2 and HGZ14, the remaining alleles were highly polymorphic loci, which indicated that the 17 microsatellite loci can be used to study the population genetics of rainbow clam (Table 3). Page 4/10 Table 3 Analysis of Molecular Variance among Six Populations of Rainbow Clam pop SSR MH19A Mi44A MW15A MX39C MY36B MZT46B HGZ3 HGZ6 HGZ9 Mir8 Mir12 Mir14 ZS Sample 96 100 100 98 84 96 100 100 100 96 96 94 No. Na 17 7 20 18 27 6 19 3 10 10 21 21 Ne 7.5789 3.3003 4.1391 3.2035 17.9086 2.3226 8.7260 1.1064 5.6243 5.8701 7.1888 4.3829 Ho 0.8542 0.9600 0.6200 0.8980 0.2619 0.8958 0.0400 0.0600 0.8800 0.8125 0.9583 0.8085 He 0.8772 0.7040 0.7661 0.6949 0.9555 0.5754 0.8943 0.0972 0.8305 0.8384 0.8700 0.7801 I 2.3251 1.3946 1.9772 1.8728 3.0815 1.0159 2.5069 0.2322 1.9486 1.9286 2.4370 2.0440 ND Sample 78 92 96 98 78 86 98 98 98 100 96 94 No. Na 18 8 30 10 15 24 8 14 2 8 9 10 Ne 11.7000 2.9782 11.1036 2.7805 18.2156 2.3012 5.5514 1.0416 5.2082 3.6928 3.3932 3.8518 Ho 0.7692 1.0000 0.8333 0.8163 0.4615 0.9767 0.0204 0.0408 1.0000 0.9800 0.9583 0.7447 He 0.9264 0.6715 0.9195 0.6470 0.9574 0.5721 0.8283 0.0404 0.8163 0.7366 0.7127 0.7483 I 2.6503 1.3328 2.8777 1.6638 3.0326 1.0217 2.0495 0.0996 1.7543 1.5876 1.4903 2.0490 CX Sample 90 100 100 96 82 88 98 100 100 94 100 98 No. Na 22 5 30 18 28 5 11 4 15 11 6 18 Ne 11.3764 4.0750 6.7843 5.2364 15.0089 1.9979 2.4984 1.3369 6.8871 7.1143 2.9656 3.0703 Ho 0.9111 1.0000 0.9400 0.9167 0.6585 0.7045 0.7755 0.0000 0.9400 0.9362 0.9600 0.6735 He 0.9223 0.7622 0.8612 0.8175 0.9449 0.5052 0.6059 0.2545 0.8634 0.8687 0.6695 0.6813 I 2.7154 1.4715 2.5566 2.2264 2.9907 0.8671 1.3413 0.5388 2.2126 2.0765 1.2420 1.7969 CM Sample 108 120 114 112 90 116 116 120 120 120