![TWF2 (NM 007284) Human 3' UTR Clone – SC206178 | Origene](https://data.docslib.org/img/3a60ab92a6e30910dab9bd827208bcff-1.webp)
OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC206178 TWF2 (NM_007284) Human 3' UTR Clone Product data: Product Type: 3' UTR Clones Product Name: TWF2 (NM_007284) Human 3' UTR Clone Vector: pMirTarget (PS100062) Symbol: TWF2 Synonyms: A6r; A6RP; MSTP011; PTK9L ACCN: NM_007284 Insert Size: 452 bp Insert Sequence: >SC206178 3’UTR clone of NM_007284 The sequence shown below is from the reference sequence of NM_007284. The complete sequence of this clone may contain minor differences, such as SNPs. Blue=Stop Codon Red=Cloning site GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC GGCCCGGGTGAAAATGGGGATGACAGCTAGGAGGCTGGAGCAGGGCCGGCCACGTGTGGACTGTGGGGC TGCCCACCTTCCGCTCCCTGCCACCATCCTCCTTCCTGGGCTCCAGGAAAGTGTTTCTGGGAGGTCAGG AGGGCTGGCAGCTGAACGCACTTGCAGCGTCCGAGGGCCACCGGGCTGGCATTTTGTGACCCTTCCCTG TTGCTGTCCCTGCATCTCGTCTGTGTGCCCAGGGTGTCCGGGGACCCTGCCTGGCTGGCTTAAGGGGGC TGGGTCAGGGGCCTGGCATGAACCTGGCCTCCCGGGGAGCTGAGACTAGGGTCCCAGCACAGCCCAGAA ACCTTTGGCCACAAGAAGTGGGGTCAGTCAGGGCTGGGGCAGGGGTCACTGCAGTTTGGGATGGTTGAA TGCTGTATTTTCTAAAGAATAAAATATTTTTAAATCAA ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG Restriction Sites: SgfI-MluI OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs). RefSeq: NM_007284.4 Summary: The protein encoded by this gene was identified by its interaction with the catalytic domain of protein kinase C-zeta. The encoded protein contains an actin-binding site and an ATP-binding site. It is most closely related to twinfilin (PTK9), a conserved actin monomer-binding protein. [provided by RefSeq, Jul 2008] This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 2 TWF2 (NM_007284) Human 3' UTR Clone – SC206178 Locus ID: 11344 MW: 16.1 This product is to be used for laboratory only. Not for diagnostic or therapeutic use. ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 2 / 2.
Details
-
File Typepdf
-
Upload Time-
-
Content LanguagesEnglish
-
Upload UserAnonymous/Not logged-in
-
File Pages2 Page
-
File Size-