Constitutive Activation of Stat5a by Retrovirus Integration in Early Pre-B Lymphomas of Sl͞kh Strain Mice

Constitutive Activation of Stat5a by Retrovirus Integration in Early Pre-B Lymphomas of Sl͞kh Strain Mice

Constitutive activation of Stat5a by retrovirus integration in early pre-B lymphomas of SL͞Kh strain mice Tatsuaki Tsuruyama†, Takuro Nakamura‡, Guang Jin†, Munetaka Ozeki†, Yoshihiro Yamada†, and Hiroshi Hiai†§ †Department of Pathology and Biology of Diseases, Kyoto University Graduate School of Medicine, 1 Yoshida-Konoe-cho, Sakyo-ku, Kyoto 606-8501, Japan; and ‡Laboratory of Carcinogenesis Cancer Institute, 1-37-1 Kami-Ikebukuro, Toshima-ku, Tokyo 170-8455, Japan Communicated by Tasuku Honjo, Kyoto University, Kyoto, Japan, April 4, 2002 (received for review January 9, 2002) We found that the second intron of Stat5a was one of the common (1, 2), and host genetic factors in lymphomagenesis (3, 4, 14). integration sites of the endogenous ecotropic murine leukemia They were maintained by brother–sister mating in our virus, i.e., SL͞Kh virus integration-1 (Svi1), in early pre-B lympho- laboratory. mas in SL͞Kh mice. The high expression of STAT5A induced by Svi1 integration and activation accelerated the transcription of its Southern Hybridization. High Mr DNAs were extracted from target genes such as c-Myc. Transfection of the constitutively lymphoma and normal kidney tissues, and 2.5- to 5-␮g aliquots active Stat5a mutant cDNA, but not of the wild-type cDNA, to the of DNAs were digested with a restriction enzyme of NcoI, SacI, bone marrow cells induced colony formation of pre-B cells in a PvuII, or SacII (New England Biolabs) for 16 h and transferred methylcellulose medium and escaped from dependence on IL-7. toaNϩ Hybond nylon membrane (Amersham Pharmacia) after Such growth depended on a genetic factor in the SL͞Kh strain. electrophoresis. MuLV env and gag probes were kindly provided Consitutively high expression of Stat5a either by retrovirus inte- by H. Ikeda (National Institute of Animal Health, Tsukuba, gration or transfection of active mutant cDNA can be lymphoma- Japan). The Stat5a probe A was located in the segment including genic to early pre-B cells in collaboration with a certain genetic its first and second exons. The probe was obtained by PCR from background factor of mice. the genomic DNA of SL͞Kh mice and labeled with Megaprime DNA-labeling system (Amersham Pharmacia). provirus ͉ hot spot ͉ lymphomagenesis Inverse PCR. Genomic DNA (100 ng) from each lymphoma was he SL͞Kh strain of mice develop spontaneous pre-B lym- first digested with SacII for 2 h and self-ligated with T4 ligase Ͼ (Takara Shuzo, Kyoto) at 14°C overnight. Amplification of the Tphomas at 90% incidence by 6 mo of age (1, 2). There are ␮ two morphological distinct types: the major lymphomas, which virus-host junctions was performed in a volume of 50 l con- taining 2.5 mM deoxynucleotide triphosphate. Each primer had show systemic lymphatic tissue involvement, and the minor type, ͞␮ which shows restricted growth in bone marrow (BM) (1). Both 10 pmol l and 0.25 unit of Taq DNA polymerase (expand long are pre-B lymphomas expressing BP-1 and B220 (2, 3). Several template PCR system, Roche Diagnostics). PCR amplification was carried out in three steps under the lines of evidence indicate that the endogenous murine leukemia ͞ virus (MuLV) plays an etiologic role in SL͞Kh lymphomas; in following conditions in a thermal cycler (Perkin–Elmer Cetus): particular, somatically acquired proviruses frequently are ob- The first step was 10 cycles (30 s at 94°C, 40 s at 62°C, and 4 min served in lymphoma DNAs (3, 4). at 68°C) preceded by an initial denaturation step (1 min at 95°C); To elucidate the mechanism of lymphomagenesis, we cloned the second step was 20 cycles (30 s at 94°C, 40 s at 62°C, and 4 the virus-host junctional segments from lymphoma DNAs by an min plus extended 20 s by one cycle at 68°C); and the final step inverse PCR technique and performed sequence analysis. In was elongation (10 min at 72°C). In some cases, nested PCR three of 60 SL͞Kh lymphomas, clonal ecotropic provirus inte- procedures were added to the above. gration was found within a 400-bp stretch in the second intron The primers for inverse PCR were located within the of the Stat5a gene, a member of the STAT family. In this article, AKV-MLV (AKV murine leukemia virus) genomes. Their we examined the effect of the provirus integration in this hot sequences were: 5B4, GAGGGCTTGGACCTCTCGTCTC- spot, named SL͞Kh virus integration-1 (Svi1). The effect of the CTAAAAAACCACG and 5F1, GTCTCTCCCAAACTCTC- constitutive high expression of Stat5a on early B cells was further CCCCTCTCCAACC in the first set, and 5F2, CCT CCTC- verified by colonial growth of early pre-B cells in soft agar TGACGGAGATGGCGACAGAGAAGAGG and 5B1, medium and loss of IL-7 dependence, when SL͞Kh BM cells GAGGGCTTGGAC CTCTCGTCTCCTAAAAGAAC- were transfected with an active Stat5a mutant cDNA. It was CACG in the second step of cycles for the nested PCR. The shown that the immortalization of early pre-B cells by Stat5a PCR products were resolved by electrophoresis in 1% agarose depended on an unidentified host factor in SL͞Kh mice. There gel and stained with ethidium bromide; they were then sub- cloned into the pCR 2.1-TOPO vector (Invitrogen), and are several reports on the relevance of Stat5a in hemopoietic sequence analysis reaction was performed with Thermo- malignancies (5–12). Stat5b is a human myeloid cell oncogene, sequenase (Amersham Pharmacia). but neither Stat family member has been shown to have a direct pathogenetic role in lymphoid disease. Herein, we report that (Northern Blot Analysis, 3؅ Rapid Amplification of cDNA Ends (RACE Stat5a is one of the hot spots of MuLV integration and subse- and Reverse Transcription–PCR (RT-PCR) Analysis. Total RNA was quent constitutive up-regulation of Stat5a perturbs signaling in extracted from lymphoma tissues by ISOGEN (Nippon Gene, early B lineage leading to lymphoma development in a certain Toyama, Japan). Samples containing equal amounts of RNA (20 genetic background. Materials and Methods Abbreviations: BM, bone marrow; MuLV, murine leukemia virus; GAS, interferon-␥- Mice. SL͞Kh is an inbred strain of mice with a high incidence of activated sequence; wt, wild type; RT-PCR, reverse transcription–PCR; RACE, rapid ampli- spontaneous pre-B lymphomas. Previously, we reported their fication of cDNA ends. MEDICAL SCIENCES origin (13) and virus expression (1), the pathology of lymphomas §To whom reprint requests should be addressed. E-mail: [email protected]. www.pnas.org͞cgi͞doi͞10.1073͞pnas.112202899 PNAS ͉ June 11, 2002 ͉ vol. 99 ͉ no. 12 ͉ 8253–8258 Downloaded by guest on September 27, 2021 ␮g) were size-fractionated by electrophoresis on a 1.0% form- cells were doubly stained with FITC-labeled anti-BP-1 (clone aldehyde-agarose gel, transferred to a Nϩ Hybond nylon mem- 6C3) and phycoerythrin-labeled anti-B220 (clone RA3–6B2; brane, and hybridized with a probe B (containing exons 3 and 4). PharMingen) and analyzed with a FACScan (Becton Dickinson). Ethidium bromide staining of rRNA bands was used to ensure equal RNA loading, and ␤-actin RNA was used as an internal The Time Course of STAT5A Phosphorylation After Stimulation by control. The probes were labeled with the kit (Amersham Anti-IL-7R. A 10-␮l aliquot of 200 ␮g͞ml anti-IL-7R was added to Pharmacia) mentioned above. the cultured Svi1 lymphoma cells, and the cell lysates were A3Ј RACE assay was performed with a 3Ј full RACE core set blotted to the poly(vinylidene difluoride) membrane (Bio-Rad). (Takara) with the primers located within a long terminal repeat The density of the band visualized by enhanced chemilumines- of retroviral genome. The products from the 3Ј RACE assay cence (ECL, Amersham Pharmacia) on the immunoblot mem- were checked by the additional poly(A) sequence of the terminus branes was measured by a LumiVision Imager (Taitec, Tokyo) specific to mRNA. RT-PCR was performed with a one-step RT kit (Invitro- Construction of an Expression Vector and Transfection and Colony gen). The primers for RT-PCR of ␤-actin were according to Growth Assay. A constitutive active form of murine Stat5a cDNA Wei et al. (15). (1*6-Stat5a) was described by Onishi et al. (16) and Ariyoshi et The probes for Northern hybridization were amplified with al. (17). The puro-pMX vectors for murine wild-type (wt) Stat5a RT-PCR primers: c-Myc, TCTGTACCTCGTCCGATTC and and mutant 1*6-Stat5a was constructed according to Kitamura TGCCTCTTCTCCACAGACAC; Bcl-xL, TGGATCCTG- and coworkers (16–18). These cDNAs were kindly given to us by GAAGAGAATCG and AGATCACTGAACGCTCTCCG; and Y. Kitamura (Institute of Medical Science, University of Tokyo). Pim-1, TTCTGGACTGGTTCGAGAGG and TAGCGAATC- The Stat5a cDNA was subcloned to pcDNA 3.1 expression vector CACTCTGGAGG. The primers for examining the phenotype (Invitrogen) that was introduced by Matsumura et al. (19). BM markers were as follows: Ig␣, ATCACATGGTGGTTCAGCC cells used for transfection assay were harvested from 3-wk-old and TCTCCAATGTGGAGGTTGC; CD19, TGTCTCTTCT- mice. They were washed once with PBS, and a 400-␮l cell GAGAAGCTGGC and AACCAGAAGTGGACCTGTGG; suspension (7 ϫ 106 cells͞ml) was transfected with 2–8 ␮gofan HSA(CD24), AACATCTAGAGAGTCGCGCC and CTGGT- expression vector of murine wt Stat5a or mutant 1*6-Stat5a in GGTAGCGTTACTTGG; and IL-7R ␣ chain, CTCTCAGAAT- 220 ␮l of PBS with 10 mg͞ml DEAE-dextran (Sigma). After GATGGCTCTGG and CTGTGCAGGAAGATCATTGG. washing, they were suspended in 10 ml of a semisolid medium. Either Methocult (Stemcell Technology, Vancouver, Canada) Abs. FITC, phycoerythrin, or biotin-conjugated rat mAbs against containing IL-7 or a StemPro methylcellulose medium (GIBCO) mouse B220 (RA3–6B2), BP-1, and anti-phosophorylated ty- without IL-7 was used as a basic semisolid medium in the colony rosine (PY20) Ab were purchased from PharMingen.

View Full Text

Details

  • File Type
    pdf
  • Upload Time
    -
  • Content Languages
    English
  • Upload User
    Anonymous/Not logged-in
  • File Pages
    6 Page
  • File Size
    -

Download

Channel Download Status
Express Download Enable

Copyright

We respect the copyrights and intellectual property rights of all users. All uploaded documents are either original works of the uploader or authorized works of the rightful owners.

  • Not to be reproduced or distributed without explicit permission.
  • Not used for commercial purposes outside of approved use cases.
  • Not used to infringe on the rights of the original creators.
  • If you believe any content infringes your copyright, please contact us immediately.

Support

For help with questions, suggestions, or problems, please contact us