9856–9873 Nucleic Acids Research, 2015, Vol. 43, No. 20 Published online 7 October 2015 doi: 10.1093/nar/gkv1026 Control of the localization and function of a miRNA silencing component TNRC6A by Argonaute protein Kenji Nishi1, Tomoko Takahashi1, Masataka Suzawa1, Takuya Miyakawa2, Tatsuya Nagasawa1, Yvelt Ming3, Masaru Tanokura2 and Kumiko Ui-Tei1,3,* 1Department of Biological Sciences, Graduate School of Science, University of Tokyo, Tokyo 113-0033, Japan, 2Department of Applied Biological Chemistry, Graduate School of Agricultural and Life Sciences, University of Tokyo, Tokyo 113-8657, Japan and 3Department of Computational Biology and Medical Sciences, Graduate School of Frontier Sciences, University of Tokyo, Chiba-ken 277-8651, Japan Received April 14, 2015; Revised September 25, 2015; Accepted September 28, 2015 ABSTRACT complexes, leading to translational repression and mRNA degradation of miRNA-targeted mRNAs (4,11–17). GW182 family proteins play important roles in mi- In human HEp-2, HeLa, and many other cell lines, a croRNA (miRNA)-mediated RNA silencing. They di- human GW182 family protein, TNRC6A, is known to rectly interact with Argonaute (Ago) proteins in pro- be localized mainly in the processing (P) bodies (18–20), cessing bodies (P bodies), cytoplasmic foci involved which are cytoplasmic foci that contain proteins involved in in mRNA degradation and storage. Recently, we re- mRNA degradation, storage, and translational repression vealed that a human GW182 family protein, TNRC6A, (reviewed in 21). However, recently we found a nuclear lo- is a nuclear-cytoplasmic shuttling protein, and its calization signal (NLS) and a nuclear export signal (NES) subcellular localization is regulated by its own nu- in the central region of TNRC6A and showed that it is a clear localization signal and nuclear export sig- nuclear–cytoplasmic shuttling protein and its subcellular nal. Regarding the further controlling mechanism localization is regulated by its own NLS and NES (10). In good agreement with our previous result, several of recent of TNRC6A subcellular localization, we found that reports have suggested that human GW182 proteins might TNRC6A protein is tethered in P bodies by direct in- function in the nucleus as well as in the cytoplasm. Chro- teraction with Ago2 under Ago2 overexpression con- matin silencing and alternative splicing, or transcriptional dition in HeLa cells. Furthermore, it was revealed that control targeting promoter RNA of inflammatory pathway such Ago proteins might be strongly tethered in the genes is shown to be associated with RNA silencing fac- P bodies through Ago-bound small RNAs. Thus, our tors in the nucleus (10,22–24). Furthermore, immunohisto- results indicate that TNRC6A subcellular localization chemical analyses of several human cancers, such as gas- is substantially controlled by the interaction with Ago tric, colorectal, prostate and esophageal cancers, show the proteins. Furthermore, it was also revealed that the strong nuclear localization of TNRC6A (25,26). Thus, the TNRC6A subcellular localization affects the RNA si- actual subcellular localization is different due to the cell lencing activity. types, and the molecular machinery involved in specifica- tion of the subcellular localization of TNRC6A remained unknown. INTRODUCTION In our previous report, we showed that TNRC6A pro- tein with NES mutations (TNRC6A-NES-mut) is predom- In small RNA-mediated gene silencing, Argonaute (Ago) inantly localized in the nucleus, due to the defect of the cy- proteins play key roles by directly binding to microRNAs toplasmic export machinery via its NES (10). Regarding (miRNAs) or small interfering RNAs (siRNAs) (reviewed the further controlling mechanism of TNRC6A subcellu- in 1,2). GW182 family proteins are shown to be necessary lar localization, in this paper, we show that, when wild-type for miRNA-mediated RNA silencing, hereafter referred to Ago proteins are overexpressed, TNRC6A-NES-mut pro- as miRNA silencing, in animals (reviewed in 3,4). They in- teins are tethered in P bodies by direct binding to abundant teract with Ago proteins via their N-terminal regions con- amount of Ago proteins, but they are not tethered by Ago2 taining multiple glycine-tryptophan (GW) repeats (5–10). mutant protein deficient for binding to small RNA and also On the other hand, their C-terminal regions, called as silenc- TNRC6A protein. These results suggest that TNRC6A pro- ing domain, recruit cytoplasmic poly(A)-binding protein 1 tein is tethered by the excessive amount of Ago proteins in (PABPC1), the PAN2-PAN3 and CCR4-NOT deadenylase *To whom correspondence should be addressed. Tel: +81 3 5841 3043; Fax: +81 3 5841 3044; Email: [email protected] C The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by-nc/4.0/), which permits non-commercial re-use, distribution, and reproduction in any medium, provided the original work is properly cited. For commercial re-use, please contact [email protected] Nucleic Acids Research, 2015, Vol. 43, No. 20 9857 the P bodies through Ago-bound small RNAs, which is con- from pcDNA3.1-FLAG/HA-Dicer using primers (5- sidered to form base-pairing with complementary RNAs in AAAAGGAAAAGCGGCCGCTCTAGAGGGCCCGT the P bodies. Our results strongly suggest that the nuclear- TTAAACCCG-3 and 5- AAAGGGCTCGAGAGCG cytoplasmic shuttling of TNRC6A is mechanistically reg- TAATCGGGCACGTCATAAGG-3) for deleting Dicer ulated by its own NLS and NES, but its subcellular local- region. Both fragments were digested with XhoI and NotI, ization is substantially determined by the comparative ex- and ligated. For construction of FLAG/HA-RCK/p54 pression level of cellular Ago proteins. Furthermore, it was expression plasmid, pFLAG/HA-RCK/p54, a cDNA frag- revealed that the cytoplasmic TNRC6A protein enhances ment of RCK/p54 CDS region was amplified using cDNA miRNA silencing activity when excessive amount of Ago purified from HEK293 cells by primers (5- AAAGGGAA proteins were expressed, although TNRC6A overexpression GCTTATGAGCACGGCCAGAACAGAGAAC-3 and repressed both RNA interference (RNAi) and miRNA si- 5-AAAGGGTCTAGATTAAGGTTTCTCATCTTCTA lencing activity with low level of Ago2 protein in the cyto- CAGGC-3). Amplified RCK/p54 fragment was digested plasm. with HindIII and XbaI, and ligated with HindIII/XbaI- digested fragment of pcDNA3.1-FLAG/HA-Dicer. The expression constructs of chemokine (C-X-C mo- MATERIALS AND METHODS tif) receptor 4 (CXCR4) shRNA and control DsRed shRNA, named pSUPER-CXCR4 and pSUPER-DsRed, Plasmid construction respectively, were constructed as described previously The expression plasmids of pmyc-GFP, a full-length (10). The plasmid expressing Renilla luciferase har- TNRC6A, pmyc-GFP-TNRC6A, and its derivatives were boring a perfectly complementary target site or four constructed as described previously (10). pIRESneo- target sites with a central bulge for CXCR4 siRNA in FLAG/HA-Ago1, -Ago2, -Ago3, and -Ago4 (27)were its 3 UTR, psiCHECK-CXCR4-perfect-match (PM) or kindly provided by Dr Thomas Tuschl through Ad- psiCHECK-CXCR4-mismatch (MM) 4×, was constructed dgene, and designated as pFLAG/HA-Ago1, -Ago2, by inserting a pair of annealed oligonucleotides (5- and -Ago3, respectively, in this study. For construction TCGAGAAGTTTTCACTCCAGCTAACAG-3 and 5- of pFLAG/HA-FL, FL cDNA was amplified from AATTCTGTTAGCTGGAGTGAAAACTTC-3)ortwo firefly luciferase gene in pGL3-Control (Promega) by pairs of annealed oligonucleotides to form a tandem inser- PCR using primers (5- AAAAGGAAAAGCGGCC tion with four target sites (5-TCGAGAAGTTTTCACA GCATGGAAGACGCCAAAAACATAAAG-3 and AAGCTAACAAGTCAAGTTTTCACAAAGCTAACA- 5-AAAGGGGAATTCTTACACGGCGATCTTTCC 3 and 5-TTGACTTGTTAGCTTTGTGAAAAC GCCCT-3). The amplified product was digested with TTGACTTGTTAGCTTTGTGAAAACTTC-3, NotI and EcoRI, and ligated with NotI/EcoRI-digested and 5-AGTCAAGTTTTCACAAAGCTAACAAG fragment of pFLAG/HA-Ago2. For construction of an TCAAGTTTTCACAAAGCTAACAG-3 and 5- empty vector, pFLAG/HA, an untagged Ago2 expression AATTCTGTTAGCTTTGTGAAAACTTGACTTGT construct, pAgo2, and pFLAG/HA-Ago2-Y529E encod- TAGCTTTGTGAAAAC-3), respectively, into the ing Ago2 with a substitution from tyrosine to glutamic XhoI/EcoRI sites of psiCHECK-1 (Promega). acid at amino acid residue 529, the linear fragments with such deletions or mutations were amplified from Cell culture pFLAG/HA-Ago2 by PCR using primers (5 -TGAGAA TTCAGTGGATCCACTAGTAACGG-3 and 5-GCGG HeLa cells were cultured in Dulbecco’s Modified Ea- CCGCTAGCGTAATCGGGCACG-3 for pFLAG/HA, gle Medium (DMEM; Invitrogen) with 10% fetal bovine ◦ 5 -CATGGCGGCGGCGATATCGATCCG-3 and 5 - serum (FBS; Sigma) at 37 C with 5% CO2. Transfec- TACTCGGGAGCCGGCCCCGCACTTG-3 for pAgo2, tion was conducted using Lipofectamine 2000 (Invitrogen) and 5-GCCGAGGTCAAGCGCGTGGGAGAC-3 and or polyethylenimine MAX (Polysciences) (29). For Lepto- 5- TTCCACGGGCGTCTTGCCGGGCAGGATG-3 for mycin B (LMB; Calbiochem) treatment, 2 days after trans- pFLAG/HA-Ago2-Y529E), and self-ligated. fection, HeLa cells were washed twice with DMEM with FLAG/HA-Dcp1 expression plasmid was constructed 10% FBS and incubated in DMEM with 10% FBS contain- as follows: At first, both strands of chemically synthesized ing 10 ng/ml LMB or the same volume of solvent for 4 or 8 oligonucleotides for FLAG and HA tags (5- CTAGCC h. CACCATGGACTACAAGGACGACGATGACAAGT ACCCTTATGACGTGCCCGATTACGCTA-3